sort by

22 publications mentioning mmu-mir-542

Open access articles that are associated with the species Mus musculus and mention the gene name mir-542. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 358
Other miRNAs from this paper: mmu-mir-204, mmu-mir-483
Figure 6 (A) Expression of miR-542-3p and ILK mRNA in (1) blank (2) miR-542-3p mimics (3) mimics control (4) miR-542-3p inhibitors (5) inhibitors control (6) small interfering RNA (siRNA)-ILK and (7) miR-542-3p inhibitors + siRNA-ILK groups. [score:9]
demonstrated that ILK was the target gene of miR-542-3p and overexpression of miR-542-3p negatively regulated ILK expression. [score:8]
In conclusion, our study demonstrates that overexpression of miR-542-3p inhibits TGF-β1/Smad2/3 signaling pathway by downregulating ILK. [score:8]
Analysis of SCC-9 proliferation by in (1) blank (2) miR-542-3p mimics (3) mimics control (4) miR-542-3p inhibitors (5) inhibitors control (6) small interfering RNA (siRNA)-ILK and (7) miR-542-3p inhibitors + siRNA-ILK groups. [score:7]
Figure 10 (A) Representative plots of SCC-9 cell cycle in (1) blank (2) miR-542-3p mimics (3) mimics control (4) miR-542-3p inhibitors (5) inhibitors control (6) small interfering RNA (siRNA)-ILK and (7) miR-542-3p inhibitors + siRNA-ILK groups. [score:7]
Figure 8 (A) Scratch test analysis of SCC-9 cell migration in (1) blank (2) miR-542-3p mimics (3) mimics control (4) miR-542-3p inhibitors (5) inhibitors control (6) small interfering RNA (siRNA)-ILK and (7) miR-542-3p inhibitors + siRNA-ILK groups. [score:7]
Additionally, our study found that miR-542-3p inhibited the SCC-9 cell proliferation by suppressing ILK expression. [score:7]
Figure 5 (A) Numbers of CD44 [+] SCC-9 cells in (1) blank (2) miR-542-3p mimics (3) mimics control (4) miR-542-3p inhibitors (5) inhibitors control (6) small interfering RNA (siRNA)-ILK and (7) miR-542-3p inhibitors + siRNA-ILK groups, 48h after transfection. [score:7]
Therefore, these data indicated that miR-542-3p inhibited ILK protein expression, which correlated with the expression of TGF-β1 and Smad2/3 proteins. [score:7]
They were then transfected into the corresponding SCC-9 cells, thereby generating (1) blank (2) miR-542-3p mimics (3) mimics control (4) miR-542-3p inhibitors (5) inhibitors control (6) small interfering RNA (siRNA)-ILK and (7) miR-542-3p inhibitors + siRNA-ILK groups. [score:7]
Figure 7Analysis of SCC-9 proliferation by in (1) blank (2) miR-542-3p mimics (3) mimics control (4) miR-542-3p inhibitors (5) inhibitors control (6) small interfering RNA (siRNA)-ILK and (7) miR-542-3p inhibitors + siRNA-ILK groups. [score:7]
Moreover, overexpression of miR-542-3p inhibited the TGF-β1/Smad signaling pathway by down -regulating ILK and diminished self-renewal, differentiation, proliferation and survival of SCC-9 cells. [score:6]
miR-542-3p, microRNA-542-3p; ILK, integrin-linked kinase; OSCC, oral squamous cell carcinoma; TGF-β1, transforming growth factor-beta-1. Kaplan-Meier survival curves showed that patients with low miR-542-3p expression (average expression of miR-542-3P was 0.67, which used as cutoff value) had lower survival rates compared to high miR-542-3p expression group (Figure 3A). [score:6]
These results suggested that miR-542-3p inhibition increased SCC-9 cell cycling, whereas its upregulation resulted in G0/G1 cell cycle arrest. [score:6]
We demonstrated that miR-542-3p regulates TGF-β1/Smad2/3 signaling pathway by inhibiting ILK expression. [score:6]
Figure 9 (A) Representative images (200X) of Transwell assay showing invasion ability of SCC-9 cells from (1) blank (2) miR-542-3p mimics (3) mimics control (4) miR-542-3p inhibitors (5) inhibitors control (6) small interfering RNA (siRNA)-ILK and (7) miR-542-3p inhibitors + siRNA-ILK groups. [score:6]
The number of invading cells in the miR-542-3p inhibitors + siRNA-ILK group (163.37 ± 13.19) was between the miR-542-3p inhibitors and the blank groups (both P < 0.05; Figure 9A-9B). [score:5]
The transfection protocol is shown in Table 3. Table 3 Gene Sequence (5’-3’) MiR-542-3p mimics TGTGACAGATTGATAACTGAAA Mimics control UUCUCAGAAAGGUGAAAUUUAUU MiR-542-3p inhibitors TTTCAGTTATCAATCTGTCACA Inhibitors control UUGUACUACACAAAAGUACUG SiRNA-ILK GGACACATTCTGGAAGGGG Note: MiR-542-3p, microRNA-542-3p; ILK, integrin-linked kinase. [score:5]
This showed that the overexpression of miR-542-3p inhibited SCC-9 cell growth. [score:5]
These data indicated that miR-542-3p inhibition of ILK expression decreased SCC-9 cell proliferation. [score:5]
The transfection protocol is shown in Table 3. Table 3 Gene Sequence (5’-3’) MiR-542-3p mimics TGTGACAGATTGATAACTGAAA Mimics control UUCUCAGAAAGGUGAAAUUUAUU MiR-542-3p inhibitors TTTCAGTTATCAATCTGTCACA Inhibitors control UUGUACUACACAAAAGUACUG SiRNA-ILK GGACACATTCTGGAAGGGG Note: MiR-542-3p, microRNA-542-3p; ILK, integrin-linked kinase. [score:5]
These data indicated that overexpression of miR-542-3p inhibited SCC-9 cell migration. [score:5]
Effects of differential miR-542-3p expression on ILK, TGF-β1 and Smad2/3 protein expression. [score:5]
Apoptosis rate in the miR-542-3p inhibitors + si-ILK group (10.14% ± 0.97%) was between the blank and the miR-542-3p inhibitors groups (both P < 0.05; Figure 10C-10D). [score:5]
The overexpression of miR-542-3p significantly inhibited the activation of β-catenin and nuclear factor-κB signaling pathways that promote carcinogenesis [25]. [score:5]
This suggested that over expression of miR-542-3p and low expression of ILK decreased the invasion of SCC-9 cells. [score:5]
Recent studies showed low miR-542-3p expression in bladder cancer tissues; its inhibition promoted tumor cell growth [13, 14]. [score:5]
In the miR-542-3p inhibitors + si-ILK group, cell proliferation was between the blank and the miR-542-3p inhibitors groups (P < 0.05; Figure 7). [score:5]
We observed that expression of miR-542-3p, ILK and TGF-β1/Smad signaling pathway-related proteins was similar in mimic control, inhibitor control, si-ILK and the blank groups (all P > 0.05; Figure 6). [score:5]
A previous study showed that miR-542-3p expression decreased cell proliferation by inhibiting G1 and G2/M cell cycle phases [34]. [score:5]
Moreover, overexpression of miR-542-3p inhibited the migration and invasion of SCC-9 and arrested SCC-9 cells in G0/G1 phase. [score:5]
The cell migration level in the inhibitors + siRNA-ILK group was between the miR-542-3p inhibitors and the blank groups (both P < 0.05). [score:5]
Also, overexpression of miR-542-3p and low expression of ILK promoted apoptosis of SCC-9 cells. [score:5]
Most importantly, we demonstrated that miR-542-3p inhibition increased the proportion of CD44 [+] SCC-9 cells, which suggested that miR-542-3p inhibited the proliferation of SCC-9 cells. [score:5]
Cell cycle distribution in the miR-542-3p inhibitors + si-ILK group was between the blank and the miR-542-3p inhibitor groups (P < 0.05; Figure 10A-10B). [score:5]
This suggested that miR-542-3p inhibited self-renewal and differentiation of SCC-9 cells by down -regulating ILK/TGF-β1/Smad2/3 signaling pathway. [score:4]
Compared with the blank group, miR-542-3p levels increased in the miR-542-3p mimics group and decreased in the miR-542 inhibitors and the miR-542-3p inhibitors + si-ILK groups (both P < 0.05; Figure 6A). [score:4]
Moreover, compared with the miR-542-3p inhibitors group, the number of tumor spheres decreased in the miR-542-3p inhibitors + siRNA-ILK group. [score:4]
Moreover, compared to the miR-542-3p inhibitors group, the number of tumor spheres decreased in the miR-542-3p inhibitors + siRNA-ILK group (40.37% ± 1.34%; P < 0.05). [score:4]
Hence, miR-542-3p inhibited ILK/TGF-β1/Smad signaling pathway. [score:3]
The microRNA-542-3p (miR-542-3p) has been recognized as a tumor suppressor gene in numerous cancers [13, 14]. [score:3]
Effects of differential miR-542-3p expression on SCC-9 cell proliferation. [score:3]
As shown in Table 1, miR-542-3p expression correlated with the TNM stage (both P < 0.05), but not with gender, age, history of smoking, tumor size or histological differentiation in OSCC patients (all P > 0.05). [score:3]
Moreover, cell proliferation decreased in the miR-542-3p mimics and si-ILK groups and increased in the miR-542-3p inhibitors group (P < 0.05; Figure 7). [score:3]
Therefore, miR-542-3p is a potential therapeutic target for OSCC. [score:3]
Oneyama et al. also demonstrated that miR-542-3p performed tumor suppressor function in many human tumors and controlled ILK -mediated cell adhesion and invasion during tumor progression [20]. [score:3]
U6 was used as internal reference of miR-542-3p [41], and GAPDH was used as the internal reference of other target genes. [score:3]
ILK is also the target gene of miR-542-3p [20]. [score:3]
Although miR-542-3p serves as a tumor suppressor in esophageal squamous cell carcinoma (ESCC), its role in OSCC is unclear [23]. [score:3]
MiR-542-3p binds to 3’UTR of ILKThe miR-542-3p binding site in ILK gene was located in the 3’UTR by the Target Scan software (Figure 4A). [score:3]
Effects of differential miR-542-3p and ILK expression on xenograft tumor growth in nude mice. [score:3]
Spearman correlation analysis showed that miR-542-3p levels negatively correlated with ILK (r = -0.351, P < 0.001), TGF-β1 (r = -0.658, P <0.001) and Smad2/3 (r = -0.247, P = 0.010) expression (Figure 2A-2C). [score:3]
Associations of miR-542-3p and ILK protein expressions with the clinicopathological features of patients with OSCC. [score:3]
However, the SCC-9 cell invasiveness decreased in the miR-542-3p mimics (59.38 ± 7.55) and siRNA-ILK (71.13 ± 6.52) groups, but increased in the miR-542-3p inhibitors (198.63 ± 17.62) group (all P < 0.05; Figure 9A-9B). [score:3]
Figure 4Dual luciferase reporter analysis of miR-542-3p binding to 3’UTR of ILK gene (A) Target Scan prediction of miR-542-3p binding site in 3’UTR of ILK gene. [score:3]
COX proportional hazard mo del analysis showed that miR-542-3p and ILK expression and lymph node metastasis indicated poor prognosis for OSCC patients (both P < 0.05; Table 2). [score:3]
Kaplan-Meier curves showing survival characteristics based on (A) high and low miR-542-3p expression, (B) high and low ILK protein expression, (C) early and advanced TNM stages and (D) degree of differentiation (undifferentiated versus moderate or highly differentiated) in OSCC patient tissues and (E) presence or absence of lymph node metastasis is shown. [score:3]
In comparison, there was increased proportion of CD44 [+] SCC-9 cells in the miR-542-3p inhibitors group (93.12%; all P < 0.05; Figure 5A). [score:3]
Expression of miR-542-3p, ILK, TGF-β1 and Smad2/3 in SCC-9 cells. [score:3]
The putative miR-542-3p binding site in the ILK gene was identified at 233-240 bases of its 3’UTR by Target Scan (http://www. [score:3]
However, apoptosis increased in the miR-542-3p mimics (25.19% ± 0.79 %) and the si-ILK (25.36% ± 1.53%) groups and decreased in the miR-542-3p inhibitors (5.43% ± 0.86%) group (P < 0.05; Figure 10C-10D). [score:3]
Effects of differential miR-542-3p expression on SCC-9 cell invasiveness. [score:3]
Association between miR-542-3p and ILK, TGF-β1 and Smad 2/3 expression in OSCC tissues. [score:3]
Expression of miR-542-3p, ILK, TGF-β1 and Smad2/3 proteins in OSCC tissues. [score:3]
The miR-542-3p binding site in ILK gene was located in the 3’UTR by the Target Scan software (Figure 4A). [score:3]
The miR-542-3p mimics, miR-542-3p inhibitors, their corresponding controls and ILK siRNA (Shanghai Sangon Biotech Co. [score:3]
Figure 3Kaplan-Meier curves showing survival characteristics based on (A) high and low miR-542-3p expression, (B) high and low ILK protein expression, (C) early and advanced TNM stages and (D) degree of differentiation (undifferentiated versus moderate or highly differentiated) in OSCC patient tissues and (E) presence or absence of lymph node metastasis is shown. [score:3]
Effects of differential miR-542-3p expression on SCC-9 cell migration. [score:3]
Moreover, ILK, TGF-β1and Smad2/3 protein levels in the miR-542-3p + siRNA-ILK group were between miR-542-3p inhibitors and blank group levels (all P < 0.05; Figure 6B-6C). [score:3]
Effects of differential miR-542-3p expression on SCC-9 cell cycle and apoptosis. [score:3]
MiR-542-3p inhibits SCC-9 cell migration. [score:2]
MiR-542-3p, ILK, TGF-β1 and Smad2/3 expression in OSCC tissues. [score:2]
MiR-542-3p has a tumor suppressor role in osteoblast cells and ESCC tissues, and gastric and bladder cancers [13, 23- 25]. [score:2]
MiR-542-3p mimics and ILK siRNA inhibit SCC-9 xenograft tumor growth in nude mice. [score:2]
MiR-542-3p was a tumor suppressor in melanomas by reducing cell migration and invasion [35]. [score:2]
SCC-9 cells co -transfected with miR-542-3p mimics and mutant (Mut-miR-542-3p/ILK) recombinant plasmid showed no significant effect on luciferase activity (P > 0.05), whereas luciferase activity decreased in SCC-9 cells with Wt-miR-542-3p/ILK plasmid (P < 0.05) indicating that miR-542-3p negatively regulated ILK (Figure 4B). [score:2]
Compared with the blank group, miR-542-3p mimics and the siRNA-ILK groups showed increased G0/G1 and decreased S and G2/M phase cells (all P < 0.05), whereas the miR-542-3p inhibitors group showed decreased G0/G1 and increased S and G2/M phase cells (all P < 0.05; Figure 10A-10B). [score:2]
Besides, compared with the blank group, the numbers of tumor spheres decreased in the miR-542-3p mimics and siRNA-ILK groups and increased in the miR-542-3p inhibitors group. [score:2]
Compared with the blank group (31.04% ± 0.86%), there were lower number of tumor spheres in the miR-542-3p mimics (19.86% ± 0.61%) and siRNA-ILK (21.18% ± 0.86%) groups, and increased number of tumor spheres in the miR-542-3p inhibitors group (51.31% ± 2.13%; all P < 0.05; Figure 5B). [score:2]
MiR-542-3p inhibits CD44 [+]SCC-9 cell growth and self-renewalCompared to the blank (71.37%) and mimic control (69.86%) groups, CD44 [+] SCC-9 cells decreased in the miR-542-3p mimics (31.21%) and siRNA-ILK (42.37%) groups (all P < 0.05). [score:2]
Compared with the mimic group, ILK mRNA and protein levels as well as TGF-β1 and Smad2/3 protein levels decreased in the miR-542-3p and si-ILK groups and increased in the miR-542-3p inhibitors group (all P < 0.05; Figure 6A-6C). [score:2]
Since our study was based on only one cell line, namely, SCC-9, further clinical research is necessary to demonstrate the efficacy of treating OSCC by regulating miR-542-3p. [score:2]
Compared with the blank group (0.78 ± 0.07), SCC-9 cell migration decreased in the miR-542-3p mimics (0.35 ± 0.10) and siRNA-ILK (0.44 ± 0.11) groups and increased in the miR-542-3p inhibitors group (1.41 ± 0.12; all P < 0.05; Figure 8A-8B). [score:2]
MiR-542-3p inhibits CD44 [+]SCC-9 cell growth and self-renewal. [score:2]
Association between miR-542-3p and ILK, TGF-β1 and Smad2/3 proteins. [score:1]
Dual luciferase reporter analysis of miR-542-3p binding to 3’UTR of ILK gene. [score:1]
To confirm miR-542-3p binding to the 3’UTR site in ILK gene, genomic DNA was extracted from SCC-9 cell line according to the instructions of TIANamp Genomic DNA Kit (TIANGEN Biotechnology Co. [score:1]
We designed two 72bp sequences, (1) ILK-3’-UTR-wt with wild type miR-542-3p binding site (5’- CUCAGAGCUUUGUCACUUGCCACAUGGUGUCUCCCAACAUGGGAGGGAUCAGCCCCGCCUGUCACAAUAAAG-3’) and (2) ILK-3’-UTR-mut with mutated miR542-3p binding site (UCGAGCUUGGUUGUGACACAAUGGUUGGCCGCCACUUCUCACCAGCACAAACCGUCCUUGGGGACCGAGAGCU). [score:1]
Our study showed decreased invasion of SCC-9 cells in the miR-542-3p mimics and siRNA-ILK groups. [score:1]
MiR-542-3p expression was decreased in OSCC tissues (0.67 ± 0.14) compared to adjacent normal tissues (0.91 ± 0.05; P < 0.05; Figure 1A). [score:1]
miR-542-3p, microRNA-542-3p; ILK, integrin-linked kinase; OSCC, oral squamous cell carcinoma; qRT-PCR, quantitative real-time polymerase chain reaction; TGF-β1, transforming growth factor-beta-1; GAPDH, glyceraldehyde-3-phosphate dehydrogenase. [score:1]
Correlation between miR-542-3p, ILK and clinicopathological features of OSCC patients. [score:1]
miR-542-3p, microRNA-542-3p; ILK, integrin-linked kinase; OSCC, oral squamous cell carcinoma; TGF-β1, transforming growth factor-beta-1. Correlation analysis between miR-542-3p and (A) ILK (B) TGF-β1 and (C) Smad 2/3 protein levels in OSCC patient tissues (n=108) is shown. [score:1]
Figure 1 (A) RT-PCR analysis of miR-542-3p and ILK mRNA levels in OSCC and adjacent normal tissues is shown. [score:1]
The mice were divided into the control, miR-542-3p mimic and siRNA-ILK groups (5 mice in each group). [score:1]
In this study, we analyzed the role of miR-542-3p in OSCC progression. [score:1]
Figure 2Correlation analysis between miR-542-3p and (A) ILK (B) TGF-β1 and (C) Smad 2/3 protein levels in OSCC patient tissues (n=108) is shown. [score:1]
Note: Each experiment was repeated thrice; * denotes P < 0.05 compared with the blank group; # denotes P < 0.05 compared with the miR-542-3p inhibitors group. [score:1]
Figure 11 (A) Total tumor volume of xenografted control, miR-542-3p mimic and siRNA-ILK transfected SCC-9 cells in nude mice. [score:1]
[1 to 20 of 99 sentences]
2
[+] score: 42
In the present study, our results show that down-regulation of caspase-3, a putative target of miR-706, combined with the high level of miR-706 and down-regulation of miR-542-3p expression, suggests cellular apoptosis may to some extent be inhibited in S. japonicum infected mice. [score:13]
Moreover, we found that S. japonicum infection up-regulated miR-706 levels in the plasma of infected mice, and miR-706 and miR-542-3p co-regulate target genes according to DAVID analysis. [score:7]
Up-regulation of miR-542-3p regulates the cell cycle by inducing both G1 and G2/M arrest [36], which inhibits breast cancer progression [37]. [score:7]
Among them, mmu-miR-874-5p showed the greatest increase of the up-regulated miRNAs and those of mmu-miR-673-3p, mmu-miR-5112, mmu-miR-711, and mmu-miR-542-3p showed the greatest decrease of the down-regulated miRNAs (Figure  2). [score:7]
For example, down-regulation of miR-542-3p levels is closely associated with tumor progression via c-Src-related oncogenic pathways [35]. [score:4]
MiR-542-3p is a tumor suppressor and plays a crucial role in preventing malignant transformation. [score:2]
Here, we detected low levels of miR-542-3p in the plasma of S. japonicum infected mice. [score:1]
Eight altered levels of miRNAs (let-7b-3p, miR-1194, miR-134-5p, miR-1981-3p, miR-210-5p, miR-542-3p, miR-706, and miR-92a-2-5p) were selected for qRT-PCR analysis. [score:1]
[1 to 20 of 8 sentences]
3
[+] score: 22
The miR-200a-3p was involved in the regulation of neuronal differentiation and proliferation and miR-542-3p up-regulated in blood after ischemic stroke, intracerebral hemorrhage, and kainate seizures [78, 79]. [score:5]
Correspondingly, the gender, age and smoking did not significantly contribute to the expression difference of miR-200a-3p (p = 0.69, 0.34 and 0.03), miR-144-5p (p = 0.47, 0.19 and 0.83) and miR-542-3p (p = 0.56, 0.65 and 0.65, Supplementary Figure 4). [score:3]
The relative expression of miR-200a-3p C., miR-144-5p D. and miR-542-3p E. in CSF from PD and health controls by qRT-PCR. [score:3]
The expression of miR-144-5p, miR-200a-3p and miR-542-5p showed an increased tendency accompanied with high H&Y scales of PD patients (Figure 4D-4F). [score:3]
Our data revealed that more than 644 miRNAs were detected with significant level-change in A53T mice, especially 40 miRNAs with fold-change ≥ 2. Among the 40 miRNAs, miR-542-3p, -10a-5p, -10b-3p, -141, -200b-3p, -542-3p, and -505-5p were confirmed with similar fluctuation of expression as reports [26, 30, 66– 68]. [score:3]
And only the raised tendency of miR-542-3p was influenced by different smoking habit. [score:1]
The ROC results and ordinal regression analysis further suggested the miR-200a-3p, miR-144-5p and miR-542-3p may be potential biomarkers for PD prediction. [score:1]
As a result, the candidate miRNAs were significant increased following the PD severity with the coefficient: 12.51 (95% CI: 7.51-17.51) in miR-200a-3p, 1.33 (95% CI: 0.74-1.92) in miR-144-5p, 4.64 (95% CI: 3.05-6.52) in miR-542-3p respectively (Table 3). [score:1]
At the cut-off values of 0.35 for miR-144-5p, 0.05 for miR-200a-3p, and 0.40 for miR-542-3p, the sensitivity and specificity for these markers were 65.91% and 75.56%, 73.17% and 75.61%, 84.09% and 91.11%, respectively (Figure 4A-4C). [score:1]
The miR-200a-3p D., miR-144-5p E. and miR-542-3p F. were increased in CSF form PD and changed with H&Y scale. [score:1]
[1 to 20 of 10 sentences]
4
[+] score: 16
[179] In addition, some non-BMP-regulated miRNAs also have regulatory roles in BMP signaling: miR-141 and -200a remarkably modulate the BMP-2 -induced pre-osteoblast differentiation through the translational repression of Dlx5; [180] miR-542-3p targets BMP7 and represses BMP7 -induced osteoblast differentiation and survival; [181] miR-20a promotes osteogenic differentiation through upregulation of BMP/Runx2 signaling by targeting PPARγ, Bambi, and Crim1; [182] miR-140 targets a mild inhibitor of BMP Dnpep, and loss of miR-140 in mice causes growth defects of endochondral bones and craniofacial deformities. [score:16]
[1 to 20 of 1 sentences]
5
[+] score: 14
Furthermore the magnitude of downregulation in scrapie-infected versus mock-infected cells of mmu-miR-351 and mmu-miR-542-5p was comparable to that estimated by ultra-deep sequencing. [score:4]
Among these, twofold downregulation of mmu-miR-351 and mmu-miR-542-5p was confirmed by qRT-PCR. [score:4]
Future studies that will focus on the identification of putative targets of miR-351 and miR-542-5p need to be carried out to reinforce the significance of our results. [score:3]
The relative expression levels of mmu-miR-503, mmu-miR-503*, mmu-miR-351 and mmu-miR-542-5p was determined in a stem-loop based quantitative real-time PCR (qRT-PCR) assay (TaqMan MicroRNA Assay, Applied Biosystems) according to the supplier's instructions. [score:1]
Four of those miRNAs, namely mmu-miR-351, mmu-miR-503, mmu-miR-503*, and mmu-miR-542-5p, are clustered in a miRNA dense region on the mouse X-chromosome. [score:1]
Interestingly, four of those miRNAs, namely mmu-miR-351, mmu-miR-503, mmu-miR-503*, and mmu-miR-542-5p are located in a genomic cluster within 5 kb on the mouse X-chromosome. [score:1]
[1 to 20 of 6 sentences]
6
[+] score: 14
The AccuOligo human miR-206 mimic/inhibitor, miR-133b mimic/inhibitor, miR-542 mimic, and each negative control were obtained from the Bioneer Corporation. [score:5]
Results showed that miR-133 and miR-542-3p did not target c-MET/EGFR in our system. [score:3]
The above results indicated that miR-133b, miR-206, and miR-542-3p are the NRF2-silencing-inducible miRNAs, and therefore, might be responsible for the dual inhibition of c-MET and EGFR in shNRF2 cancer cells. [score:3]
Second, when levels of these miRNAs were assessed in the control and NRF2-silenced cells, levels of miR-133b, miR-206, and miR-542-3p were commonly elevated by more than 50% by NRF2 knockdown in both S KOV3 and A498 cells (Table 3). [score:2]
Similarly, miR-542-3p transfection did not affect the levels of c-MET and EGFR (Supplementary Figure 5B). [score:1]
[1 to 20 of 5 sentences]
7
[+] score: 10
Thus, both miR-335 and miR-582 were down-regulated at 7 dpi; while miR-21 was up-regulated, miR-34b and miR-542 were down-regulated at 15 dpi. [score:10]
[1 to 20 of 1 sentences]
8
[+] score: 10
Evidence of the concerted interplay of miRNAs regulated by CpG-ODN and their potential target mRNAs was observed (Fig. 4) for 2 miRNAs upregulated (hsa-miR-302b and hsa-miR-374b) and for 13 miRNAs downregulated in CpG-ODN -treated mice (hsa-miR-135a, hsa-miR-136, hsa-miR-340, hsa-miR-445-5p, hsa-miR-424, hsa-miR-96, hsa-miR-142-3p, hsa-miR-140-5p, hsa-miR-542-3p, hsa-miR-18a, hsa-miR-18b, hsa-miR-101, and hsa-miR-99a). [score:10]
[1 to 20 of 1 sentences]
9
[+] score: 9
For example, the levels of miR-542-3p are lower in decidualizing versus normal human ESCs, and overexpression of miR-542-3p inhibits the expression of IGFBP1, PRL, and WNT4, suggesting an inhibitory role of miR-542-3p in decidualization [94]. [score:9]
[1 to 20 of 1 sentences]
10
[+] score: 8
In this study, we also observed up-regulated expression of SGTB, targeted by miR-133a-3p, miR-181a-5p, miR-409-5p, and miR-542-3p, at both the transcriptional and protein levels in Sertoli cells following exposure to MC-LR (Supplementary Figure S1B and Fig. 5B). [score:8]
[1 to 20 of 1 sentences]
11
[+] score: 7
Other miRNAs from this paper: hsa-let-7c, hsa-let-7d, hsa-mir-16-1, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-28, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-99a, hsa-mir-101-1, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-30a, mmu-mir-99a, mmu-mir-101a, mmu-mir-125b-2, mmu-mir-126a, mmu-mir-128-1, mmu-mir-9-2, mmu-mir-142a, mmu-mir-144, mmu-mir-145a, mmu-mir-151, mmu-mir-152, mmu-mir-185, mmu-mir-186, mmu-mir-24-1, mmu-mir-203, mmu-mir-205, hsa-mir-148a, hsa-mir-34a, hsa-mir-203a, hsa-mir-205, hsa-mir-210, hsa-mir-221, mmu-mir-301a, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-142, hsa-mir-144, hsa-mir-145, hsa-mir-152, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-126, hsa-mir-185, hsa-mir-186, mmu-mir-148a, mmu-mir-200a, mmu-let-7c-1, mmu-let-7c-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-21a, mmu-mir-24-2, mmu-mir-29a, mmu-mir-31, mmu-mir-34a, mmu-mir-148b, mmu-mir-339, mmu-mir-101b, mmu-mir-28a, mmu-mir-210, mmu-mir-221, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-125b-1, mmu-mir-128-2, hsa-mir-128-2, hsa-mir-200a, hsa-mir-101-2, hsa-mir-301a, hsa-mir-151a, hsa-mir-148b, hsa-mir-339, hsa-mir-335, mmu-mir-335, hsa-mir-449a, mmu-mir-449a, hsa-mir-450a-1, mmu-mir-450a-1, hsa-mir-486-1, hsa-mir-146b, hsa-mir-450a-2, hsa-mir-503, mmu-mir-486a, mmu-mir-450a-2, mmu-mir-503, hsa-mir-542, hsa-mir-151b, mmu-mir-301b, mmu-mir-146b, mmu-mir-708, hsa-mir-708, hsa-mir-301b, hsa-mir-1246, hsa-mir-1277, hsa-mir-1307, hsa-mir-2115, mmu-mir-486b, mmu-mir-28c, mmu-mir-101c, mmu-mir-28b, hsa-mir-203b, hsa-mir-5680, hsa-mir-5681a, mmu-mir-145b, mmu-mir-21b, mmu-mir-21c, hsa-mir-486-2, mmu-mir-126b, mmu-mir-142b, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
In the metastatic line, the miR-542 showed up-regulation of the 3p arm but down-regulation of the 5p arm. [score:7]
[1 to 20 of 1 sentences]
12
[+] score: 7
Other miRNAs from this paper: hsa-mir-542
C-Src upregulation was correlated with miR-542-3p downregulation. [score:7]
[1 to 20 of 1 sentences]
13
[+] score: 7
Seven miRNAs showed differential expression (Figure 1a, Figure S2a); miR-1 and miR-542-3p showed decreased expression, whereas miR-132, miR-214, miRNA-31, miR-210 and miR-10b showed increased expression. [score:7]
[1 to 20 of 1 sentences]
14
[+] score: 5
Interestingly, among the retina-expressed miRNAs, we identified miR-542-3p, that showed an apparent low dorsal to high ventral gradient of expression in the developing (E16.5) and newborn (P0) retina (Figure 4B). [score:5]
[1 to 20 of 1 sentences]
15
[+] score: 4
The eQTL for miR130b (Chr 9: 36–44 Mb, −log P = 4.42), miR-542-3p (Chr 12: 79–103 Mb, −log P = 4.73) and miR-449b (Chr 14: 50–72 Mb, −log P = 4.49) were mapped on QTL for disease onset on chromosome 9, 12 and 14. [score:3]
The same SNP (rs3680665) also showed association with miR-542 additionally with another SNP (rs4200124, nearest gene: Gbe1) present nearby. [score:1]
[1 to 20 of 2 sentences]
16
[+] score: 3
In vitro experiments have demonstrated that hyaluronic acid-decorated polymeric nanoparticles can co- deliver doxorubicin and miR-542-3p to breast cancer cell lines 33 and mesoporous silica nanoparticles have been exploited to simultaneously deliver a miR-122 antagomir and small molecule inhibitors to hepatocellular carcinoma cells 34. [score:3]
[1 to 20 of 1 sentences]
17
[+] score: 3
Other miRNAs from this paper: mmu-mir-30a, mmu-mir-101a, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-132, mmu-mir-134, mmu-mir-135a-1, mmu-mir-138-2, mmu-mir-142a, mmu-mir-150, mmu-mir-154, mmu-mir-182, mmu-mir-183, mmu-mir-24-1, mmu-mir-194-1, mmu-mir-200b, mmu-mir-122, mmu-mir-296, mmu-mir-21a, mmu-mir-27a, mmu-mir-92a-2, mmu-mir-96, rno-mir-322-1, mmu-mir-322, rno-mir-330, mmu-mir-330, rno-mir-339, mmu-mir-339, rno-mir-342, mmu-mir-342, rno-mir-135b, mmu-mir-135b, mmu-mir-19a, mmu-mir-100, mmu-mir-139, mmu-mir-212, mmu-mir-181a-1, mmu-mir-214, mmu-mir-224, mmu-mir-135a-2, mmu-mir-92a-1, mmu-mir-138-1, mmu-mir-181b-1, mmu-mir-125b-1, mmu-mir-194-2, mmu-mir-377, mmu-mir-383, mmu-mir-181b-2, rno-mir-19a, rno-mir-21, rno-mir-24-1, rno-mir-27a, rno-mir-30a, rno-mir-92a-1, rno-mir-92a-2, rno-mir-96, rno-mir-100, rno-mir-101a, rno-mir-122, rno-mir-125a, rno-mir-125b-1, rno-mir-125b-2, rno-mir-132, rno-mir-134, rno-mir-135a, rno-mir-138-2, rno-mir-138-1, rno-mir-139, rno-mir-142, rno-mir-150, rno-mir-154, rno-mir-181b-1, rno-mir-181b-2, rno-mir-183, rno-mir-194-1, rno-mir-194-2, rno-mir-200b, rno-mir-212, rno-mir-181a-1, rno-mir-214, rno-mir-296, mmu-mir-376b, mmu-mir-370, mmu-mir-433, rno-mir-433, mmu-mir-466a, rno-mir-383, rno-mir-224, mmu-mir-483, rno-mir-483, rno-mir-370, rno-mir-377, rno-mir-542-1, mmu-mir-494, mmu-mir-20b, mmu-mir-503, rno-mir-494, rno-mir-376b, rno-mir-20b, rno-mir-503-1, mmu-mir-1224, mmu-mir-551b, mmu-mir-672, mmu-mir-455, mmu-mir-490, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-504, mmu-mir-466d, mmu-mir-872, mmu-mir-877, rno-mir-466b-1, rno-mir-466b-2, rno-mir-466c, rno-mir-872, rno-mir-877, rno-mir-182, rno-mir-455, rno-mir-672, mmu-mir-466l, mmu-mir-466i, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-466j, rno-mir-551b, rno-mir-490, rno-mir-1224, rno-mir-504, mmu-mir-466m, mmu-mir-466o, mmu-mir-466c-2, mmu-mir-466b-4, mmu-mir-466b-5, mmu-mir-466b-6, mmu-mir-466b-7, mmu-mir-466p, mmu-mir-466n, mmu-mir-466b-8, rno-mir-466d, mmu-mir-466q, mmu-mir-21b, mmu-mir-21c, mmu-mir-142b, mmu-mir-466c-3, rno-mir-322-2, rno-mir-503-2, rno-mir-466b-3, rno-mir-466b-4, rno-mir-542-2, rno-mir-542-3
ABCG1 may be a target gene of miR-542. [score:3]
[1 to 20 of 1 sentences]
18
[+] score: 3
Additionally, prior studies from various mo dels of retinal degeneration identified over 300 differentially expressed miRNAs 63– 90, a total of 16 common miRNAs were identified (miR-1187, miR-125b-5p, miR-331-3p, miR466d-3p, miR-467f, miR-542-3p, miR-574-5p, miR654-3p, miR669h-3p, miR-882, miR-342-3p, miR-466a-5p, miR-466d-5p, miR-706, miR-345-3p, miR532-5p). [score:3]
[1 to 20 of 1 sentences]
19
[+] score: 3
01 Stress response, cell proliferation miR-542 ↓2.60 NA miR-574 ↑2.09 Inflammation (Tlr9 activation), cell proliferation, apoptosis miR-669j ↑3.12 NA miR-672 ↑2.40 NA miR-674 ↑2.19 NA miR-744 ↑4.35Oncogene (Tgf) suppression miR-873 ↑2.53 ↑3.22 NA miR-1930 ↑3.31 NA miR-1934 ↑2.17 ↑3.27 NA miR-1942 ↑2.49 NA miR-3064 ↑2.50 NA miR-3065 ↑3.20 NA miR-3069 ↑2.98 NA miR-3071 ↑3.51 NA miR-3073 ↓2.78 NA miR-3092 ↑3.48 NA miR-3093 ↑3.28 NA miR-3109 ↓2.07 NAAll reported variations were statistically significant (P < 0.05). [score:3]
[1 to 20 of 1 sentences]
20
[+] score: 1
Taken together, these elements may represent a multipart transcript, and interestingly four additional miRNA coding sites (mir-542, mir-450a-2, mir-450a-1, and mir-450b) reside nearby, which do not have any evidence of being transcribed based on known dbEST sequence records. [score:1]
[1 to 20 of 1 sentences]
21
[+] score: 1
Interestingly, four of the 11 significantly changed miRNAs (mmu-miR-196b-5p, mmu-miR-210-3p, mmu-miR-1944(16), and mmu-miR-542-5p) were also identified in the previous experiment. [score:1]
[1 to 20 of 1 sentences]
22
[+] score: 1
Three of the newly identified editing sites show higher editing levels in the absence of ADAR2 (miR-542-3p, position 16; let-7e, position 19; and miR-574-5p, position 17), showing that these miRNAs are preferentially edited by ADAR1 (Table 4). [score:1]
[1 to 20 of 1 sentences]