sort by

96 publications mentioning hsa-mir-574

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-574. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 241
Other miRNAs from this paper: hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3
To further confirm that it was TLR9/MyD88 signaling that conferred the up-regulated expression of miR-574-5p, the TLR9 signaling inhibitor chloroquine and MyD88 inhibitory peptide were applied to block their signaling pathway. [score:10]
To further understand the effect of miR-574-5p on regulating the tumor progression of human lung cancer cells, we predicted the targets of miR-574-5p by prediction programs including TargetScan and Miranda, and selected 10 possible target including CALCOCO1, RFX4, CD96, CHEX1, FOXI2, DGKG, ZNF589, ZDHHC14, CCDC88C, CLVS1 for real time PCR analysis. [score:8]
To investigate the potential role of miRNAs in the increased tumor progression of human lung cancer cells upon TLR9 agonist stimulation, we performed miRNA microarray assay to detect the expression profile of miRNA in 95D cells with or without treatment of CpG ODNs, and found that CpG ODNs stimulation alternated the miRNA expression profile in 95D cells and the difference in expressions of 23 miRNAs between the CpG ODNs treated group and untreated group was at least two-fold, among which miRNA-574-5p was the mostly up-regulated miRNA in CpG ODNs stimulated 95D cells compared with that the untreated group [19]. [score:6]
TLR9 Signaling Up-regulated the Expression of miR-574-5p in Human Lung Cancer Cells. [score:6]
To further confirm this phenomenon in vivo, miR-574-5p sponge was constructed to downregulate the expression of miR-574-5p. [score:6]
Further studies showed that checkpoint suppressor 1 (Ches1) was a dominant direct target for miRNA-574-5p to confer the TLR9 signaling enhanced tumor progression. [score:6]
Of note, we showed that down-regulation of miR-574-5p in 95D cells significantly inhibited their enhanced progression induced by TLR9 signaling in vivo (Figure 2D, p<0.05). [score:6]
To confirm this result, we performed western blot to detect the expression of Ches1 in 95D cells transfected with miR-574-5p inhibitor. [score:5]
In this study, we identified Ches1 as the direct target of miR-574-5p in regulating the progression of human lung cancer cells. [score:5]
To address the potential role of miR-574-5p in TLR9 signaling enhanced progression of human lung cancer cells, we evaluated the effect of down-regulation of miR-574-5p on TLR9 signaling enhanced progression of 95D cells and found that down-regulation of miR-574-5p could obviously reduce the progression of 95D cells in vitro and in vivo. [score:5]
Retrovirus -mediated overexpression or inhibition of miR-miR-574-5p was generated based on pMX vector (Invitrogen) as previously described [21]– [23]. [score:5]
We found that both chloroquine and MyD88 inhibitory peptide could significantly abrogate the elevated expression of miR-574-5p induced by CpG ODNs in 95D cells in a dose dependent manner (Figure 1E and F, p<0.05). [score:5]
Ches1 was a direct target of miR-574-5p in regulating tumor progression of human lung cancer cells. [score:5]
Importantly, we found that the expression level of miR-574-5p was positively correlated to the expression of TLR9 in clinical tumor tissues (Figure 6B, p<0.05). [score:5]
Notably, we showed that transfection with miR-574-5p inhibitor significantly inhibited the proliferation of 95D cells induced by CpG ODNs (Figure 2B, p<0.5). [score:5]
As shown in Figure 2A, we found that transfection with miR-574-5p inhibitor effectively reduced their expression in 95D cells (p<0.05). [score:5]
Furthermore, we revealed that the expression of miR-574-5p was reversely correlated with the expression level of Ches1 in the tumor tissues (Figure 6C, p<0.05). [score:5]
We found that the expression of Ches1 exhibited a dramatically elevation in 95D cells transfected with miR-574-5p inhibitor (Figure 4A, p<0.05). [score:5]
Down-regulation of miR-574-5p abrogated the TLR9 signaling enhanced tumor progression. [score:4]
Consistently, we found that down-regulation of miR-574-5p also significantly prolonged the survival time of tumor bearing nude mice (Figure 2E, p<0.05). [score:4]
Ches1 was a Direct Target for miR-574-5p to Promote Tumor Progression of Human Lung Cancer. [score:4]
0048278.g002 Figure 2(A) 95D cells were transfected with miR-574-5p inhibitor for 48 h and then assayed for their expression of miR-574-5p. [score:4]
Up-regulation of miR-574-5p in TLR9 signaling stimulated human lung cancer cells. [score:4]
Consistently, down-regulation of miR-574-5p in 95D cells abrogated their growth in vivo and prolonged the survival time of tumor bearing mice (Figure 3E and F, p<0.05). [score:4]
Here we extended our previous study by demonstrating that up-regulation of miR-574-5p conferred the enhanced tumor progression induced by TLR9 signaling in human lung cancer cells. [score:4]
0048278.g004 Figure 4(A) 95D cells were transfected with miR-574-5p inhibitor for 48 h and then assayed for their expression of the indicated genes using real time PCR. [score:4]
These results indicated that Ches1 was a bona fide target of miR-574-5p in regulating TLR9 signaling enhanced tumor progression of human lung cancer. [score:4]
The Expression of miR-574-5p was Positively Correlated with TLR9 and Reversely Correlated with Ches1 in Clinical Lung CancerTo further investigate the potential role of miR-574-5p in the effect of TLR9 signaling on human lung cancer patients, we detected the relationship between the expression of miR-574-5p and TLR9 in clinical NSCLC patients. [score:3]
Indeed, our successive study showed that miR-574-5p could promote the progression of human lung cancer cells, indicating that sustained expression of miR-574-5p was pivotal for the progression of human lung cancer cells. [score:3]
Consistently, reduced expression of miR-574-5p in 95D cells impaired their proliferation in vitro (Figure 3B, p<0.05). [score:3]
We further showed that transfection with Ches1 expression vector effectively abrogated the tumor promoting effect of miR-574-5p in vivo (Figure 4F, p<0.05). [score:3]
We revealed that the expression of miR-574-5p was indeed significantly elevated in 95D cells after CpG ODNs treatment in a dose and time dependent manner (Figure 1C and D, p<0.05). [score:3]
To further confirm these results in vivo, nude mice were challenged with 95D cells which were stably transfected with miR-574-5p expression vector or miR-574-5p sponge vector respectively. [score:3]
To elucidate the potential role of miR-574-5p in the enhanced tumor progression of human lung cancer induced by TLR9 signaling, 95D cells were transfected with miR-574-5p inhibitor and then stimulated with CpG ODNs. [score:3]
The Expression of miR-574-5p was Positively Correlated with TLR9 and Reversely Correlated with Ches1 in Clinical Lung Cancer Patients. [score:3]
To elucidate the potential role of miR-574-5p in the effects of TLR9 signaling on the progression of human lung cancer cells, we validated our previous microarray platform and assessed the expression of miR-574-5p in 95D cells with or without CpG ODNs treatment by real time PCR analysis. [score:3]
In present study, we found that TLR9 signaling significantly elevated the expression of miR-574-5p in 95D cells, which was consistent with our previous study [19]. [score:3]
Down-regulation of MiR-574-5p Abrogated the Enhanced Tumor Progression Induced by TLR9 Signaling in Human Lung Cancer. [score:3]
We found that the protein level of Ches1 was significantly increased by transfection with miR-574-5p inhibitor in 95D cells (Figure 4B, p<0.05). [score:3]
As shown in Figure 3A, we found that over -expression of miR-574-5p in 95D cells resulted in their elevated proliferation in vitro (p<0.05). [score:3]
Thus, groups of nude mice were challenged with 95D cells which stably expressed miR-574-5p sponge, and then stimulated with CpG ODNs. [score:3]
We found that over-expressed miR-574-5p significantly enhanced the tumor progression of 95D cells in vivo, accompanied by a reduced survival time of tumor bearing mice (Figure 3C and D, p<0.05). [score:3]
0048278.g006 Figure 6 (A) Relative TLR9, miR-574-5p and Ches1 expression were determined by real time PCR in 23 NSCLC lung cancer samples. [score:3]
Briefly, the miR-574-5p expression vector was constructed by ligating EcoRI/XhoI polymerase chain reaction (PCR) fragments with pMX-puro retroviral vector. [score:3]
The expression of TLR9, miR-574-5p and Ches1 in clinical lung cancer. [score:3]
A significantly negative effect on luciferase activity was observed on the 3′ UTR of Ches1 in the presence of miR-574-5p, such repression disappeared when the predicted target site in the 3′ UTR of Ches1 was mutated (Figure 4C, p<0.05). [score:3]
MiR-574-5p mimics and miR-574-5p inhibitor were purchased from Ribobio (Guangzhou, China). [score:3]
These findings were in line with our above data which demonstrated that Ches1 was a predominate target for miR-574-5p to confer the enhanced tumor progression induced by TLR9 signaling in human lung cancer. [score:3]
Consistently, we further showed that the expression of TLR9 and miR-574-5p was higher in clinical tumor tissues and exerted a positively correlation. [score:3]
Notably, we found that transfection of miR-574-5p mimics failed to enhance the proliferation of 95D cells which were co -transfected with the Ches1 expression vector (Figure 4E, p<0.05). [score:3]
However, the precise mechanism for how TLR9 signaling activated miR-574-5p expression still remains unclear. [score:3]
Our findings strongly demonstrated that TLR9 signaling effectively elevated the expression of miR-574-5p in human lung cancer cells. [score:3]
Our data were in line with previous study which demonstrated that the expression of miR-574-5p was significantly increased in NSCLC samples with respect to the controls [25]. [score:3]
We found that transfection of 95D cells with the miR-574-5p sponge caused significant increase in luciferase activity compared with the control sponge (Figure 2C, p<0.05), suggesting that effective inhibition of miR-574-5p activity was achieved. [score:2]
In conclusion, here we extended previous study by demonstrating that miR-574-5p was pivotal for TLR9 signaling enhanced tumor progression via down -regulating Ches1 in human lung cancer. [score:2]
To address this issue, here we characterized the effect of miRNA-574-5p which was up-regulated under TLR9 signaling in human lung cancer cells. [score:2]
TaqMan micro -RNA assays (Applied Biosystems) were used to quantitative the expression levels of mature miR-574-5p, and U6 small nuclear RNA was used as an internal control. [score:2]
MiR-574-5p mimics or its control was co -transfected into 95D cells with a single report plasmid (pMIR-Report plasmid; Ambion) containing either the wild-type or mutated 3′ UTR of Ches1 which was generated using Quickchange Site-Directed Mutagenesis Kit (Stratagene). [score:2]
As shown in Figure 6A, the expression levels of TLR9 and miR-574-5p were higher in lung cancer tissue compared with adjacent tissue of tumor from clinical lung cancer samples (p<0.05). [score:2]
Retroviral miR-574-5p “sponge” vector was constructed using ligation of two copies of miR-574-5p complementary oligos and pMX-puro vector. [score:1]
Combing all these findings suggested that miR-574-5p might be an optimistic candidate for diagnosis, prediction and treatment of human lung cancer. [score:1]
Combining these data suggested that miR-574-5p conferred the effect of TLR9 signaling on tumor progression of human lung cancer cells. [score:1]
These results suggested that miR-574-5p was an important factor associated with enhanced tumor progression of human lung cancer. [score:1]
Besides, the important role of miR-574-5p in TLR9 signaling did not exclude other miRNAs that might be involved in TLR9 signaling in human lung cancer. [score:1]
Our data suggested that intrinsic miR-574-5p could contribute to the progression of human lung cancer cells. [score:1]
Sequence encoding mutant miR-574-5p was cloned into the same vector and used as the control vector. [score:1]
Here we found that miR-574-5p could enhance the tumor progression of 95D cells in vivo, indicating that miR-574-5p might be also involved in the metastasis of human lung cancer cells, which remains to be elucidated. [score:1]
However, the possible effect of miRNA-574-5p on the enhanced tumor progression induced by TLR9 signaling still remains to be elucidated. [score:1]
We found that miRNA-574-5p was pivotal for TLR9 signaling to enhance the tumor progression of human lung cancer cells. [score:1]
To further investigate the potential role of miR-574-5p in the effect of TLR9 signaling on human lung cancer patients, we detected the relationship between the expression of miR-574-5p and TLR9 in clinical NSCLC patients. [score:1]
Our findings suggested that miR-574-5p was an important player in TLR9 signaling and tumor biology. [score:1]
[1 to 20 of 71 sentences]
2
[+] score: 139
Compared to corresponding control group, the protein expression of MACC-1 was down-regulated in mimic groups in both SW1116 and HCT116 cell lines (P < 0.05), as shown in Figure 3A, B. Compared to corresponding control group, the protein expression of MACC-1 was up-regulated in inhibitor group in both SW1116 and HCT116 cell lines (P < 0.05), also shown in Figure 3A, B. The protein expression of has-miR-574-5p was reduced in antisense transfected HCT116 cells, while it was increased in miRNA mimics transfected SW1116 cells (Figure 3C). [score:13]
Effect of hsa-miR-574-5p on MACC-1 expression in HCT116 and SW1116 cells; compared with control group, mimic group reduced MACC-1 expression, while inhibitor group increased MACC-1 expression (*P < 0.05, inhibitor vs. [score:10]
Therefore, we speculated that hsa-miR-574-5p played a suppressive role in colorectal cancer liver metastasis by negatively involved in the down-regulation of MACC-1 expression. [score:8]
Taken together, our findings partly elucidated that hsa-miR-574-5p played a suppressive role in colorectal cancer liver metastasis by negatively directing the expression of MACC-1. The results in this study might offer a novel therapy option of hsa-miR-574-5p in colorectal cancer liver metastasis. [score:6]
It was partly elucidated that hsa-miR-574-5p played a suppressive role in colorectal cancer liver metastasis by negatively directing MACC-1 expression, offering a novel therapeutic approach for colorectal cancer liver metastasis. [score:6]
Has-miR-574-5p directly targets MACC-1. The effect of hsa-miR-574-5p antisense and miRNA mimics transfection on MACC-1 protein expression in SW1116 and HCT116 cell lines. [score:6]
Furthermore, the effect of hsa-miR-574-5p antisense and miRNA mimics transfection on MACC-1 expression in SW1116 and HCT116 cell lines showed that hsa-miR-574-5p negatively regulated MACC-1 expression at protein level. [score:6]
control group); C. hsa-miR-574-5p expression was reduced in antisense (inhibitor group) transfected HCT116 cells, while it was increased in miRNA mimics (mimic group) transfected SW1116 cells ([#]P < 0.01 vs. [score:5]
It has been reported that hsa-miR-574-5p decreased CBR1 (carbonyl resuctase 1) gene expression and activity [21] and negatively regulated Qki6/7 to impact β-catenin/Wnt signalling and the development of colorectal cancer [22]. [score:5]
Inhibition of hsa-miR-574-5p suppressed the growth of colorectal tumors in the nude mice [22]. [score:5]
It was hypothesized that hsa-miR-574-5p affected colony formation, cell invasion and cell spheroid formation by mediating the expression of MACC-1. Increased MACC-1 expression in colorectal cancer cells can induce proliferation, migration and invasion of cancer cells in vitro, while promoting liver metastasis in a xenograft mo del [30]. [score:5]
The top 15 were shown in Table 1. Among those miRNAs, hsa-miR-574-5p expression level may be correlated to MACC-1 expression for the E value (0.10) was relatively lower. [score:5]
The results showed that has-miR-574-5p might inhibit MACC1 expression. [score:5]
Our work firstly demonstrated that hsa-miR-574-5p negatively regulated MACC-1 expression in colorectal cancer cells. [score:4]
Thus, it was indicated that hsa-miR-574-5p negatively regulated MACC-1 expression at protein level. [score:4]
Figure 3 The effect of hsa-miR-574-5p antisense and miRNA mimics transfection on MACC-1 expression in SW1116 and HCT116 cell lines. [score:3]
Western-blot to detect MACC-1 protein expression in hsa-miR-574-5p antisense or miRNA mimic transfected SW1116 and HCT116 cell lines. [score:3]
Hairpin-it miRNAs qPCR kit (GenePharma, China) was used to detect the hsa-miR-574-5p expression in SW1116 and HCT116 cell lines with stem-loop reverse transcription. [score:3]
It showed that the decreased expression of has-miR-574-5p in HCT116 cells stimulated cell proliferation and invasive activity, inducing increased colony formation, cell invasion and cell spheroid formation of HCT116 cells, compared to control group (P < 0.05), as shown in Figure 4. Conversely, the increased expression of has-miR-574-5p in SW1116 cells decreased colony formation, cell invasion and cell spheroid formation, compared to control group (P < 0.05), as shown in Figure 4. Figure 4 The effect of hsa-miR-574-5p antisense and miRNA mimics transfection on cell colony formation, cell invasion and cell spheroid formation in SW1116 and HCT116 cell lines. [score:3]
Figure 2 The mRNA expression levels of MACC-1 and hsa-miR-574-5p in SW1116 and HCT116 cell lines. [score:3]
It showed that the decreased expression of has-miR-574-5p in HCT116 cells stimulated cell proliferation and invasive activity, inducing increased colony formation, cell invasion and cell spheroid formation of HCT116 cells, compared to control group (P < 0.05), as shown in Figure 4. Conversely, the increased expression of has-miR-574-5p in SW1116 cells decreased colony formation, cell invasion and cell spheroid formation, compared to control group (P < 0.05), as shown in Figure 4. Figure 4 The effect of hsa-miR-574-5p antisense and miRNA mimics transfection on cell colony formation, cell invasion and cell spheroid formation in SW1116 and HCT116 cell lines. [score:3]
Bioinformatics analysis showed hsa-miR-574-5p negatively regulated MACC-1 and then their interaction was demonstrated at mRNA and protein level. [score:2]
It was verified that hsa-miR-574-5p was negatively involved in the regulation of MACC-1 at mRNA and protein levels. [score:2]
Subsequently, results demonstrated that hsa-miR-574-5p was involved in the regulation of MACC-1, playing a functional role in colorectal cancer liver metastasis. [score:2]
Therefore, it was verified that hsa-miR-574-5p was negatively involved in the regulation of MACC-1 at mRNA and protein levels. [score:2]
Our results indicated that an inverse correlation between hsa-miR-574-5p and MACC-1 at mRNA level was observed in the SW1116 and HCT116 cell lines. [score:1]
The E value of hsa-miR-574-5p is relatively lower. [score:1]
MACC-1 and hsa-miR-574-5p mRNA levels in SW1116 and HCT116 cell lines. [score:1]
HCT116); C. hsa-miR-574-5p mRNA level in HCT116 is significant higher than that in SW1116 cell ([✩]P < 0.01 vs. [score:1]
We co -transfected MACC-1 (3′UTR sequence) vector and hsa-miR-574-5p or negative control into cells. [score:1]
So the hsa-miR-574-5p is chosen for investigating if this miRNA is correlated with the expression of MACC-1. In this study, qRT-PCR analysis indicated that an inverse correlation between hsa-miR-574-5p and MACC-1 at mRNA level was observed in the SW1116 and HCT116 cell lines. [score:1]
And the knockdown of has-miR-574-5p demonstrated increased colony formation, cell invasion and cell spheroid formation in HCT116 cells, compared to control group (P < 0.05). [score:1]
We performed qRT-PCR analysis to detect the mRNA level of MACC-1 and hsa-miR-574-5p in SW1116 and HCT116 cell lines. [score:1]
The effect of hsa-miR-574-5p on colony formation, cell invasion and cell spheroid formation in SW1116 and HCT116 cell lines. [score:1]
Though HCT116 cells represented a low metastasis potential, siRNA mediated knockdown of has-miR-574-5p increased colony formation, cell invasion and cell spheroid formation in HCT116 cells, compared to control group. [score:1]
Transfection of hsa-miR-574-5p antisense or miRNA mimic into SW1116 and HCT116 cell lines. [score:1]
The effect of hsa-miR-574-5p antisense and miRNA mimics transfection on cell colony formation in SW1116 and HCT116 cell lines (*P < 0.01 vs. [score:1]
The effect of hsa-miR-574-5p antisense and miRNA mimics transfection on cell spheroid formation in SW1116 and HCT116 cell lines (*P < 0.01 vs. [score:1]
The effect of hsa-miR-574-5p antisense and miRNA mimics transfection on cell invasion in SW1116 and HCT116 cell lines (#P < 0.01 vs. [score:1]
The amplified PCR products of 3′UTR sequence of wild type MACC-1 or mutant MACC-1 containing the putative has-miR-574-5p binding site were transformed into 293 T cells by pGL3 vector. [score:1]
The mRNA level of hsa-miR-574-5p in HCT116 cells was higher than that in SW1116 cells (P < 0.01, Figure 2C). [score:1]
Moreover, hsa-miR-574-5p affected the colony formation, cell invasion and cell spheroid formation. [score:1]
The hsa-miR-574-5p was chosen for further analysis. [score:1]
Second, although the hsa-miR-574-5p may be the potential therapy for colorectal cancer liver metastasis therapy, the function of it in patients with colorectal cancer liver metastasis need further experiments to explore. [score:1]
We identified miRNAs that might regulate MACC-1 expression by bioinformatics analysis and further investigated the relationship of MACC-1 and hsa-miR-574-5p by luciferase reporter assay, quantitative RT-PCR and western blot. [score:1]
[1 to 20 of 45 sentences]
3
[+] score: 138
In this study, we provide evidence that X-ray -induced upregulation of miR-574-3p resulted in suppression of ERH protein expression and led to a delay in cell growth. [score:8]
miR-574-3p is downregulated in patients with bladder cancer [24], whereas it is upregulated in patients with hepatocellular carcinoma [25]. [score:7]
Using these transfection conditions, we utilized an mRNA array to identify 53 mRNAs that were downregulated by at least 0.5 fold (p ≤ 0.001) in cells overexpressing miR-574-3p compared to cells with miR-574-3p knocked down. [score:6]
qRT-PCR analysis revealed that the irradiation increased miR-574-3p expression in A549 (2.5-fold, p = 0.0190), ONS76 (1.3-fold, p = 0.0469), and SF126 (1.2-fold, p = 0.0115) cell lines, whereas expression was unaffected in C32TG (1.0-fold, P = 0.4331) cells. [score:5]
Among the 53 targets identified, 11 genes had the predicted target sequences for miR-574-3p in their 3′-UTR. [score:5]
Expression of miR-574-3p was significantly, although slightly, suppressed in the NB1RGB (0.9-fold, p = 0.0048) and HeLa (0.9 fold, p = 0.0377) cell lines. [score:5]
In this study, we found that X-ray irradiation of cells from human lung adenocarcinoma, brain medulloblastoma, and astrocytoma induced the expression of miR-574-3p, which, in turn, suppressed the production of the enhancer of rudimentary homolog (ERH) protein and delayed cell growth. [score:5]
To identify the target mRNA regulated by miR-574-3p, the expression profile of mRNA in A549 cells transfected with synthetic miR-574-3p was compared with that in cells transfected with miR-574-3p antagomirs. [score:5]
Because this miRNA displays differential expression regulation, we analyzed the response of miR-574-3p to X-irradiation in ONS-76 (brain medulloblastoma), SF126 (brain astrocytoma), C32TG (amelanotic melanoma), HeLa (cervical adenocarcinoma), and NB1RGB (normal skin fibroblast) cell lines. [score:4]
Therefore, neither the P53 nor the RB1 loci present a common feature in the three cell lines that showed irradiation -induced up-regulation of miR-574-3p. [score:4]
Expression Analysis of Transcripts Regulated by miR-574-3p. [score:4]
Therefore, the expression of miR-574-3p induced by 5-Gy of X-ray appears to be sufficient to delay growth in irradiated cells. [score:3]
Western blot analysis revealed that expression of the ERH protein was 0.68 fold lower in A549 cells transfected with the synthetic miR-574-3p than in the non -transfected cells (Figure 6). [score:3]
In contrast, the wild-type CDKN2A locus was reported to be present in the C32TG and HeLa cell lines, which do not show induction of miR-574-3p expression following irradiation [26– 28]. [score:3]
Although further studies are necessary to elucidate the precise mechanism of miR-574-3p and its target gene ERH, our findings lend important insights into the cellular responses to X-ray irradiation. [score:3]
Each of the remaining eight genes harbored a unique sequence in the 3′-UTR that is possibly targeted by miR-574-3p (Table 1). [score:3]
To test whether ERH expression is affected by miR-574-3p, the miRNA was transfected into A549 cells. [score:3]
Delay in Cell Growth by Overexpression of miR-574-3p. [score:3]
miR-574-3p Expression during Cellular Response to X-Ray Irradiation. [score:3]
Real-time monitoring of cell viability using an RT-CES instrument showed a significant delay in growth in the miR-574-3p -overexpressing cells (Figure 3A). [score:3]
To study the biological significance of miR-574-3p induction, synthetic miR-574-3p or locked nucleic acid (LNA) -modified oligonucleotides (antagomirs) targeting miR-574-3p were transfected into A549 cells. [score:3]
In this study, miR-574-3p expression was induced by X-ray irradiation in cells harboring a homozygous deletion of the CDKN2A locus. [score:3]
Prediction of miR-574-3p Targets in Silico. [score:3]
The irradiation -induced increase in miR-574-3p expression was further confirmed by qRT-PCR after 1, 2, and 3 h of exposure to 2, 5, and 20 Gy of X-irradiation (Figure 2). [score:3]
We found that the luciferase activity in A549 cells co -transfected with the synthetic miR-574-3p and the pMIR-ERH vector was significantly lower (0.84-fold, p = 0.0204) than that in the cells transfected with the pMIR-ERH vector, demonstrating that miR-574-3p bound to the target sequences (Figure 7B). [score:3]
Although further studies are necessary to elucidate the precise mechanism of miR-574-3p and its target gene ERH, our finding lends important insight to the cellular response to X-ray irradiation. [score:3]
We postulate that because ERH blocks the action of Ciz1, induction of miR-574-3p by DNA damage with subsequent reduction of ERH expression facilitates the formation of the CDK-cyclinE-p21 [Cip1/Waf1] complex. [score:3]
Next, we attempted to find common genetic features in cell lines showing induction of miR-574-3p expression. [score:3]
In this study, miR-574-3p expression was not induced in X-ray-irradiated cells harboring a normal CDKN2A locus. [score:3]
These data suggest that miR-574-3p could regulate ERH function. [score:2]
3.12.A549 cells were transfected with miRNA precursors or knockdown oligonucleotides for miR-574-3p (10 or 20 nM) or siRNA for ERH or negative control oligonucleotides (5 nM), as described above. [score:2]
Tatarano S. Chiyomaru T. Kawakami K. Enokida H. Yoshino H. Hidaka H. Nohata N. Yamasaki T. Gotanda T. Tachiwada T. Novel oncogenic function of mesoderm development candidate 1 and its regulation by MiR-574-3p in bladder cancer cell linesInt. [score:2]
A549 cells were transfected with miRNA precursors or knockdown oligonucleotides for miR-574-3p (10 or 20 nM) or siRNA for ERH or negative control oligonucleotides (5 nM), as described above. [score:2]
Among the four miRNAs, induction of miR-574-3p (1.67-fold, p = 0.0011) and miR-766 (1.54-fold, p = 0.0001) was confirmed by quantitative RT-PCR (qRT-PCR). [score:1]
To examine whether miR-574-3p could bind to the predicted sequence found in the 3′-UTR of the ERH mRNA, an 80-bp DNA fragment consisting of the four units of the predicted binding sequence (20 bp) of miR-574-3p was synthesized and cloned into the pMIR-REPORT Luciferase vector (Figure 7A). [score:1]
At 6 h after transfection of the constructs, the oligonucleotides, namely, the synthetic miR-574-3p or miR-574-3p antagomirs, were transfected at 10 nM using the LipoTrust EX Oligo reagent, according to the manufacturer’s protocol (Hokkaido System Science). [score:1]
To study the involvement of miR-574-3p in the growth delay induced by X-irradiation, the growth of A549 cells transfected with miR-574-3p antagomirs or synthetic miR-574-3p and subsequently irradiated with X-ray was observed. [score:1]
Binding of miR-574-3p to the 3′-UTR of ERH. [score:1]
In contrast, the growth delay induced by X-irradiation did not increase in cells transfected with synthetic miR-574-3p. [score:1]
The putative miR-574-3p recognition elements of the candidate genes were predicted using the miRanda algorithm [29, 30, 68]. [score:1]
To investigate the effect of miR-574-3p on the expression of the ERH protein, cells were co -transfected with the pMIR-ERH construct at 25 pM and the pGL4.75[hRluc/CMV] construct at 2.5 pM (Promega Corporation, Madison, WI, USA) using the FuGENE HD transfection reagent according to the manufacturer’s protocol (Roche Diagnostics). [score:1]
miR-574-3p was first identified in colorectal cancer cell lines [23]. [score:1]
Although homozygous deletion of the CDKN2A/P16 [INK4a] /P14 [ARF] locus simultaneously compromises the function of both P53 and RB1, we have not yet analyzed the association between deletion of the CDKN2A/P16 [INK4a] /P14 [ARF] locus and induction of miR-574-3p by X-ray irradiation. [score:1]
Because an interaction between miR-766 and its predictive target mRNA was not experimentally detected (data not shown), we focused on the characterization of miR-574-3p. [score:1]
At 36 h after X-irradiation, the number of cells in the miR-574-3p antagomirs group was higher than that in the mock -transfected group (1.3-fold, p = 0.0015) (Figure 4B). [score:1]
After transfection (24 h), the miR-574-3p expression level in each cell line was measured by qRT-PCR. [score:1]
The mature miRNA sequence of miR-574-3p was obtained from miRBase [66]. [score:1]
After a 3-h exposure to 2-Gy X-irradiation, the cells showed induction of miR-181d (2.51-fold, p = 0), miR-574-3p (2.27-fold, p = 2.4 × 10 [−34]), miR-197 (2.12-fold, p = 2.9 × 10 [−26]), and miR-766 (1.64-fold, p = 2.5 × 10 [−7]). [score:1]
The growth delay induced by X-irradiation was partially attenuated in cells transfected with miR-574-3p antagomirs (Figure 4A). [score:1]
This construct, named pMIR-ERH, or the pMIR-REPORT vector without the ERH sequence as a control, was co -transfected into A549 cells with either synthetic miR-574-3p or miR-574-3p antagomirs. [score:1]
To generate a reporter vector bearing the miRNA -binding sites, the putative miR-574-3p recognition sequence in the 3’-UTR region of the ERH mRNA was synthesized with four repetitions and inserted downstream of the firefly luciferase gene in the pMIR-REPORT Luciferase vector (Life Technologies), as described previously [71]. [score:1]
[1 to 20 of 51 sentences]
4
[+] score: 102
In previous studies, serum miR-574-3p expression was found to be up-regulated in patients with hepatocellular carcinoma and liver cirrhosis (22), and tissue miR-574-3p expression was up-regulated in endometriomas (23). [score:11]
The MESDC1 gene was the most down-regulated gene that had conserved target sites for miR-574-3p. [score:6]
Gene expression signatures of differentially down-regulated genes in miR-574-3p transfectants. [score:6]
In this study, we focused on MESDC1, a potential target gene of miR-574-3p, because it was listed at the top of down-regulated genes in miRNA transfectants. [score:6]
org and MicroCosm Target programs showed the eight genes had putative target sites for miR-574-3p in their 3′UTR (Table I). [score:5]
These results suggest that MESDC1 protein has an oncogenic function in BC and is regulated by miR-574-3p expression. [score:4]
In conclusion, our results demonstrated that miR-574-3p was down-regulated in BC cell lines. [score:4]
In this study, we focused on miR-574-3p, which was selected from the 17 down-regulated miRNAs of BC in our previous study (16). [score:4]
In this study, there was no significant difference in miR-574-3p expression levels between clinical BCs and RNA obtained from the normal human bladders. [score:3]
These results suggested that restoration of miR-574-3p expression might induce cell apoptosis in BC. [score:3]
The mRNA expression levels of MESDC1 were markedly repressed in the miR-574-3p transfectants in comparison with the miR-control transfectants and the mocks (Fig. 3B). [score:3]
Target gene search for miR-574-3p. [score:3]
Confirmation of MESDC1 as a target of post-transcriptional repression by miR-574-3p. [score:3]
We found decreased cell proliferation, migration, and invasive activities, and increased cell apoptosis in miR-574-3p transfectants, suggesting that miR-574-3p is a candidate tumor suppressive miRNA in human BC. [score:3]
MESDC1 expression in BC cell lines and MESDC1 silencing by miR-574-3p transfection. [score:3]
Detection of miR-574-3p expression in clinical BCs and BC cell lines by quantitative stem-loop RT-PCR. [score:3]
We found no significant correlations between miR-574-3p expressions and pathological parameters. [score:3]
A total of 11 genes were down-regulated less than −2.0-fold in the miR-574-3p transfectants compared with the control transfectants (Table I). [score:3]
Therefore, we focused on MESDC1 as a promising candidate targeted by miR-574-3p. [score:3]
Further, we found that miR-574-3p targeting of MESDC1 plays an important role in cell viability, migration, invasion, and apoptosis in BC cell lines. [score:3]
To gain further insight into which genes were affected by miR-574-3p transfection, we performed gene expression analysis with miR-574-3p transfectants (BOY and T24). [score:3]
Quantitative stem-loop RT-PCR demonstrated that the expression level of miR-574-3p was significantly lower in BCs (n=24) than in the normal human RNAs (P=0.0128, Fig. 1A) and that it was markedly lower in the BC cell lines (Fig. 1B). [score:3]
MiR-574-3p as well as miR-218, a tumor suppressive miRNA (17), are located on chromosome 4p (4p14 and 4p15), which was a typical chromosomal loss region in BC cell lines in our previous study (18). [score:3]
We demonstrated that miR-574-3p bound to the conserved site in the 3′ untranslated region of MESDC1 mRNA in luciferase assays. [score:2]
We performed a luciferase reporter assay to determine whether MESDC1 mRNA has an actual target site for miR-574-3p. [score:2]
A future in vivo study would be helpful in clarifying the role of miR-574-3p in cancer development. [score:2]
Effect of miR-574-3p transfection on cell viability, migration, invasion activity, and cell apoptosis in BC cell lines. [score:1]
We performed gain-of-function studies using miR-574-3p -transfected BOY and T24. [score:1]
Mature miRNA molecules, Pre-miR™ (hsa-miR-574-3p, P/N: AM17100, Applied Biosystems) and negative control miRNA (P/N: AM17111, Applied Biosystems) were used in the gain-of-function experiments, whereas MESDC1 siRNA (Cat# HSS126949 and HSS126950, Invitrogen) and negative control siRNA (D-001810-10, Thermo Fisher Scientific, Waltham, MA, USA) were used in the loss-of-function experiments. [score:1]
However, tissue miR- 574-3p expression in various cancers had yet to be measured and previous studies did not address the functional role of miR-574-3p. [score:1]
The early apoptotic cell fractions (right lower quadrant) were greater in the miR-574-3p transfectants than in the mocks and the miR-control transfectants (relative to mock; BOY: 9.60±1.91, 1.00±0.25, and 0.71±0.15, respectively, P=0.0013; T24: 1.84±0.08, 1.00±0.22, and 0.65±0.11, respectively, P=0.0014) (Fig. 2D). [score:1]
[1 to 20 of 31 sentences]
5
[+] score: 84
MicroRNA mimics and hairpin inhibitors for microRNA-574-5p (hsa-miR-574-5p), microRNA-656 (hsa-miR-656), microRNA-877-5p (hsa-miR-877-5p), and microRNA-921 (hsa-miR-921), as well as mimic and inhibitor negative controls, were obtained from Dharmacon (Chicago, IL). [score:5]
In agreement with the pattern of inhibition of CBR1 protein expression in lymphoblastoid lines homozygous for the minor rs9024 A allele, miR-574-5p diminished CBR1 activity by 56% (p = 0.001) while miR-921 exerted no significant impact on CBR1 activity (p = 0.84) (Figure 4B). [score:5]
Hsa-miR-574-5p and hsa-miR-921 regulate CBR1 protein expression in human lymphoblastoid cell lines. [score:4]
U6-normalized expression levels of hsa-miR-574-5p were favorable compared to individual hsa-miR-15a expression levels in liver (3.8±0.3 relative fold) and heart (1.3±0.7 relative fold). [score:4]
G/G/A/A Bioinformatic predictions miR-574-5p miR-877-5p miR-921 miR-656 CHO cells 35% ↓/52% ↓ NC/NC 46% ↓/NC N/A/NC Lymphoblastoid protein 48% ↓/49% ↓ NC/NC 40% ↓/NC N/A/NC Lymphoblastoid activity 54% ↓/56% ↓ NC/NC 18% ↓/NC N/A/NC Although the SNP rs9024 does not directly alter the 3′-UTR target binding sites of hsa-miR-574-5p (position 120) or hsa-miR-921 (position 125) seed regions, it is notable that both binding sites are proximal to the polymorphic site at position 133 (Figure 1). [score:4]
Hsa-miR-574-5p is expressed in human liver and heart tissues. [score:3]
Hsa-miR-574-5p- and hsa-miR-921 -mediated regulation of CBR1 involves mRNA degradationTo elucidate the role of mRNA degradation in hsa-miR-574-5p- and hsa-miR-921 -mediated post-transcriptional regulation of CBR1, we conducted RNA degradation experiments. [score:3]
Our pilot work detecting the presence of miR-574-5p in liver and heart tissues suggests that there is significant interindividual variability in the expression of this miRNA in these tissues (Figure 6). [score:3]
We demonstrated that miR-574-5p and hsa-miR-921 both influence CBR1 protein expression in human cell lines with homozygosis for the major CBR1 1096G>A G allele (Figure 3A and Table 2). [score:3]
Lymphoblastoid cells homozygous for the major rs9024 G allele treated with hsa-miR-574-5p or hsa-miR-921 showed a 48% (p<0.0001) and 40% (p<0.05) reduction in CBR1 protein expression, respectively (Figure 3A). [score:3]
The lymphoblastoid cell line GM 10857 was co -transfected with hsa-miR-574-5p and hsa-miR-921 for 48 hours and then treated with actinomycin D, a potent de novo transcription inhibitor. [score:3]
Co-transfection of specific hairpin inhibitors for hsa-miR-574-5p was sufficient to significantly rescue the luciferase activities of the pCBR1-1096G and pCBR1-1096A constructs (Figure 2C and 2D). [score:3]
CHO-K1 cells were co -transfected with CBR1 3′-UTR luciferase reporter constructs (500 ng) plus internal control plasmid pRL-TK (50 ng) and 15 nM miRNA mimic (hsa-miR-574-5p, hsa-miR-656, hsa-miR-877-5p, or hsa-miR-921) in the presence or absence of 5 nM specific miRNA inhibitor using DharmaFECT Duo transfection reagent (Dharmacon). [score:3]
Free energy predictions from the PITA algorithm microRNA ▵G [duplex] ▵G [open] ▵▵G G A G A G A hsa-miR-574-5p −24.49 −24.49 −6.54 −5.41 −17.94 −19.07 hsa-miR-877-5p −19.4 −19.4 −12.75 −13.33 −6.64 −6.06 hsa-miR-921 −11.6 −5.8 −5.92 −8.04 −5.67 2.24 hsa-miR-656 N/A −10 N/A −5.05 N/A −4.94 ▵G values expressed in kcal/mol Potential miRNA binding sites on the 3′-UTR of CBR1 and their relative locations are indicated by shaded regions. [score:3]
Of note, in lymphoblastoid cells homozygous for the minor rs9024 A allele, treatment with miR-574-5p reduced CBR1 protein expression by 49% (p<0.0001), while miR-921 incubation had no significant effect (Figure 3B). [score:3]
Cells were co -transfected with 15 nM miRNA mimic (hsa-miR-574-5p, hsa-miR-656, hsa-miR-877, or hsa-miR-921) and miRNA mimic negative control in the presence or absence of 5 nM of specific miRNA inhibitor using the Neon transfection system (Invitrogen). [score:3]
miR-574-5p expression in human tissues. [score:3]
Importantly, hsa-miR-574-5p and hsa-miR-921 were co-expressed with CBR1 in human liver and heart tissue. [score:3]
Quantitative RT-PCR gene expression detection of hsa-miR-15a and hsa-miR-574-5p in total RNA isolated from 4 human liver and 4 heart samples showed that both miRNAs were present in all samples (Figure 6). [score:3]
Direct sequencing of real-time PCR products confirmed the specific amplification of our positive control hsa-miR-15a as well as hsa-miR-574-5p. [score:2]
To elucidate the role of mRNA degradation in hsa-miR-574-5p- and hsa-miR-921 -mediated post-transcriptional regulation of CBR1, we conducted RNA degradation experiments. [score:2]
On the other hand, co-transfection of hsa-miR-574-5p and hsa-miR-921 with pCBR1-1096A resulted in differential regulation of luciferase activity. [score:2]
Hsa-miR-574-5p- and hsa-miR-921 -mediated regulation of CBR1 involves mRNA degradation. [score:2]
0048622.g006 Figure 6 Relative miR-574-5p miRNA levels were determined with a comparative quantitation method in total RNA extracted from human heart and human liver samples. [score:1]
Relative miR-574-5p miRNA levels were determined with a comparative quantitation method in total RNA extracted from human heart and human liver samples. [score:1]
CBR1 activity was significantly decreased in lymphoblastoid cells transfected with hsa-miR-574-5p (0.83±0.34 nmol/min. [score:1]
The algorithms we used pinpointed hsa-miR-574-5p, hsa-miR-656, hsa-miR-877-5p, and hsa-miR-921 as the most viable candidates for interacting with the 3′-UTR of CBR1 (Figure 1). [score:1]
The results in CHO cells showed that hsa-miR-574-5p interacts with CBR1 3′-UTR constructs carrying the G or the A allele for rs9024 while hsa-miR-921 selectively binds only to the CBR1 3′-UTR construct carrying the G allele. [score:1]
Future work will attempt to characterize the extent of interindividual variability in the expression of hsa-miR-574-5p and hsa-miR-921 in human tissues in tandem with CBR1 1096G>A genotype and assess their combined impact on CBR1 phenotypic variability. [score:1]
It is possible that the proximity of hsa-miR-574-5p and hsa-miR-921 binding sites, 13 bp and 8 bp, respectively, upstream of the polymorphic site, is the underlying cause of the changes observed in free energy predictions between the two rs9024 variants of the CBR1 3′-UTR. [score:1]
Hsa-miR-574-5p and hsa-miR-921 bind differentially to CBR1 3′-UTR constructs. [score:1]
mg; 18% decrease; p = 0.29), whereas co-transfection of hsa-miR-574-5p (1.33±0.46 nmol/min. [score:1]
Bioinformatic predictions led us to examine hsa-miR-574-5p, hsa-miR-656, hsa-miR-877-5p, and hsa-miR-921 as prime CBR1 binding candidates. [score:1]
Relative CBR1 mRNA levels were determined with a comparative quantitation method in cells transfected with miRNA negative control (hsa-miR-NC), hsa-miR-574-5p, or hsa-miR-921. [score:1]
On the other hand, in cell lines homozygous for the minor A allele only hsa-miR-574-5p produced significant decreases in CBR1 protein levels (Figure 3B and Table 2). [score:1]
[1 to 20 of 35 sentences]
6
[+] score: 48
miRNA Function (A animal studies, H human studies) References miR-17-92 cluster important in lung development and homeostasis (A)[69, 76, 77] miR-155 important for normal lung airway remo delling (A)[70] alteration of T-cell differentiation (A)[71] miR-26a highly expressed within bronchial and alveolar epithelial cells, important for lung development (H)[75] let-7 highly expressed in normal lung tissue, functions as a tumor suppressor in lung cells (H)[78] miR-29 functions as tumor suppressor in lung cells (H)[79] miR-15, miR-16 function as tumor suppressor genes (H)[80, 81] miR-223 control of granulocyte development and function (A)[82] miR-146a/b central to the negative feedback regulation of IL-1β -induced inflammation (H)[83, 84] miR-200a, miR-223 contribution to the extreme virulence of the r1918 influenza virus (A)[85] miR-17 family, miR-574-5p, miR-214 upregulated at the onset of SARS infection (A, H)[86]Two miRNAs, miR-146a and miR-146b, have been shown to play central role in the negative feedback regulation of IL-1β -induced inflammation; the mechanism is down-regulation of two proteins IRAK1 and TRAF6 involved in Toll/interleukin-1 receptor (TIR) signalling [83, 84]. [score:22]
miRNA Function (A animal studies, H human studies) References miR-17-92 cluster important in lung development and homeostasis (A)[69, 76, 77] miR-155 important for normal lung airway remo delling (A)[70] alteration of T-cell differentiation (A)[71] miR-26a highly expressed within bronchial and alveolar epithelial cells, important for lung development (H)[75] let-7 highly expressed in normal lung tissue, functions as a tumor suppressor in lung cells (H)[78] miR-29 functions as tumor suppressor in lung cells (H)[79] miR-15, miR-16 function as tumor suppressor genes (H)[80, 81] miR-223 control of granulocyte development and function (A)[82] miR-146a/b central to the negative feedback regulation of IL-1β -induced inflammation (H)[83, 84] miR-200a, miR-223 contribution to the extreme virulence of the r1918 influenza virus (A)[85] miR-17 family, miR-574-5p, miR-214 upregulated at the onset of SARS infection (A, H)[86] Two miRNAs, miR-146a and miR-146b, have been shown to play central role in the negative feedback regulation of IL-1β -induced inflammation; the mechanism is down-regulation of two proteins IRAK1 and TRAF6 involved in Toll/interleukin-1 receptor (TIR) signalling [83, 84]. [score:22]
MiR-17 family, miR-574-5p and miR-214 were upregulated at the onset of SARS infection: these miRNAs may help the virus to evade the host immune system and are responsible for effective transmission at the initial stage of viral infection [86]. [score:4]
[1 to 20 of 3 sentences]
7
[+] score: 47
Finally, only one of predicted and differentially expressed was up-regulated (miR-574-3p). [score:6]
In contrast to SERCA2, which was down-regulated, both miR-574-3p and -5p showed up-regulation in infarcted tissue compared to corresponding remote myocardium as well as to healthy human hearts. [score:6]
Ten miRNAs were used for further in silico validation: one predicted by using above programs with elevated expression in microarray analysis (hsa-miR-574-3p; miRBase accession number: MIMAT0003239) and nine up-regulated in microarray analysis but not predicted by the algorithms used (hsa-miR-122, hsa-miR-199a-3p, hsa-miR-140-3p, hsa-miR-320a, hsa-miR-320b, hsa-miR-320c, hsa-miR-320d, hsa-miR-483-5p, hsa-miR-574-5p; miRBase accession numbers: MIMAT0000421, MIMAT0000232, MIMAT0004597, MIMAT0000510, MIMAT0005792, MIMAT0005793, MIMAT0006764, MIMAT0004761, MIMAT0004795, respectively). [score:6]
Although is hard to predict, which miRNA is involved in SERCA2 regulation, since the differentially expressed miRNA can be also from non-cardiomyocytes, we identified some good candidate miRNAs, which could be involved in the SERCA2 regulation (miR-199a for SERCA2b, miR-140 for both isoforms, and miR-574 for SERCA2a). [score:5]
In addition to miR-122, which was specifically expressed on present microarrays compared to our previous study [11] and is according to recent report down-regulated in plasma of patients with MI [27], miR-574 and miR-140 have not been yet described as involved in cardiovascular pathology. [score:5]
3121-142no −20.3−8.2−3.0789-810Partially (1, 3–6, 8) miR-574-3p−22.9−8.2−6.5347-368No −21.2−2.7−11.396-117no miR-574-5p−21.7−8.6−8.0263-285No −23.4−4.9−3.5479-501No −18.2−3.3−3.512-34No −20.5−9.00.3797-819Partially (1–5, 7) miR-140-3p−19.9−8.2−6.5348-368yes −20.5−9.9−3.5484-504No   −19.7 −8.7 0.3 799-819 noUsing criteria postulated by Zhao et al. (2005) [18], we predicted binding sites in 3´-UTR of SERCA2b and SERCA2a mRNA for up-regulated miRNAs. [score:4]
3121-142no −20.3−8.2−3.0789-810Partially (1, 3–6, 8) miR-574-3p−22.9−8.2−6.5347-368No −21.2−2.7−11.396-117no miR-574-5p−21.7−8.6−8.0263-285No −23.4−4.9−3.5479-501No −18.2−3.3−3.512-34No −20.5−9.00.3797-819Partially (1–5, 7) miR-140-3p−19.9−8.2−6.5348-368yes −20.5−9.9−3.5484-504No   −19.7 −8.7 0.3 799-819 no Using criteria postulated by Zhao et al. (2005) [18], we predicted binding sites in 3´-UTR of SERCA2b and SERCA2a mRNA for up-regulated miRNAs. [score:4]
The best candidate is miR-574-3p, which was also predicted to target SERCA2 in our previous study [11]. [score:3]
Free-energy of binding and flanking regions (RNA22, RNAfold) was calculated for 10 up-regulated miRNAs from microarray analysis (miR-122, miR-320a/b/c/d, miR-574-3p/-5p, miR-199a, miR-140, and miR-483), and nine miRNAs deregulated from microarray analysis were used for validation with qPCR (miR -21, miR-122, miR-126, miR-1, miR-133, miR-125a/b, and miR-98). [score:3]
miR-574-3p was also predicted to target ATP2A2 in our previous study, and has been elevated in infarcted compared to healthy adult hearts [11]. [score:2]
In case of SERCA2a, 16 binding sites were predicted for hsa-miR-574-5p. [score:1]
In case of SERCA2b, 13 binding sites were predicted for hsa-miR-320a/b, 12 for hsa-miR-320c/d, 15 for hsa-miR-574-5p and 20 for hsa-miR-122. [score:1]
1−12.3−11.4508-526partially (1–4, 7–8) −19.2−6.4−5.3714-732no miR-483-5p−24.7−9.8−6.8122-143no −24.1−7.6−6.3708-729no miR-574-3p−27.8−8.6−5.3725-746yes −32.5−7.3−9.737-58partially (2–5, 7–13) miR-574-5p−22.7−7.3−11.0465-487yes −25.6−14.5−14.1664-686no −30.2−12.5−0.3740-762no −22.9−8.0−12.3413-435no −21.6−7.8−11. [score:1]
[1 to 20 of 13 sentences]
8
[+] score: 45
RT-qPCR was performed on 5 differentially expressed miRNAs (3 upregulated: miR-466, miR-574-3p, miR-3613-3p; and 2 downregulated: miR-1, miR-26a-5p) to confirm the microarray data. [score:9]
The miRNAs hsa-miR-1 and hsa-miR-26a-5p were predicted by 5 target prediction databases; hsa-miR-574-3p was predicted from 4 target prediction databases, and hsa-miR-466 and hsa-miR-3613-3P were predicted from 2 target prediction databases (Table 3). [score:7]
According to the RT-qPCR data, hsa-miR-466, hsa-miR-574-3p, and hsa-miR-3613-3p were upregulated in the LAAs of the AF group relative to the NSR, while hsa-miR-1 and hsa-miR-26a-5p were downregulated. [score:7]
Finally, we selected 5 miRNAs for further analysis: 3 were upregulated in the AF group relative to the NSR (hsa-miR-466, hsa-miR-574-3p, and hsa-miR-3613-3p), and 2 were downregulated (hsa-miR-1 and hsa-miR-26a-5p). [score:7]
To determine the probable biological function of the differentially expressed miRNAs, we predicted the putative targets and pathways of 5 validated miRNAs (hsa-miR-1, hsa-miR-26a-5p, hsa-miR-466, hsa-miR-574-3p, and hsa-miR-3613-3p) using the miRFocus database. [score:5]
The expression levels of miR-574-3p and miR-3613-3p were not significantly correlated with LA size. [score:3]
Our study found that the expression levels of three validated miRNAs (miR-1, miR-26a-5p, miR-466) correlated with LA size, while those of two others (miR-574-3p, miR-3613-3p) did not. [score:3]
However, although the expression levels of miR-574-3p and miR-3613-3p in LAAs significantly differed between NSR and AF patients, they were not significantly correlated with LA size (r = 0.54; P = 0.07 and r = 0.56; P = 0.06, respectively; Figure 6). [score:3]
Previously, the miR-466, miR-574, and miR-3613 have not been described as participating in cardiovascular pathology. [score:1]
[1 to 20 of 9 sentences]
9
[+] score: 34
For H1N1 infected cells, miR-23a, miR-574-3p and miR-574-5p were down-regulated (>=2-fold, p<0.05) at this time point. [score:4]
84uphsa-miR-574-3p1.77down   hsa-miR-19a2.32downhsa-miR-5722.92uphsa-miR-574-5p2.41down   hsa-miR-21*3.23downhsa-miR-574-3p3.75up      hsa-miR-301a2.32downhsa-miR-574-5p2.083up      hsa-miR-30e2.24downhsa-miR-629*2.85up      hsa-miR-7203.39downhsa-miR-6382.19up         hsa-miR-6634.52up         hsa-miR-9392.32up         hsa-miR-100*3.47down         hsa-miR-12603.09down         hsa-miR-12803.01down         hsa-miR-1414.5down         hsa-miR-21*4down         hsa-miR-2212.72down                   hsa-miR-455-3p 2.16 downAmong the listed profiles of differentially down-regulated miRNA as compared with non-infected control cells, it was found that miR-574-5p was down regulated (>2-fold, p<0.05) in H5N1 infected cells at 3-hour post-infection. [score:4]
At 6-hour post-infection, miR-126, miR-20a*, miR-362-5p, miR-378, miR-454, and miR574-5p were found to be down-regulated (>2-fold, p<0.05) in H5N1 infected cells. [score:4]
84uphsa-miR-574-3p1.77down   hsa-miR-19a2.32downhsa-miR-5722.92uphsa-miR-574-5p2.41down   hsa-miR-21*3.23downhsa-miR-574-3p3.75up      hsa-miR-301a2.32downhsa-miR-574-5p2.083up      hsa-miR-30e2.24downhsa-miR-629*2.85up      hsa-miR-7203.39downhsa-miR-6382.19up         hsa-miR-6634.52up         hsa-miR-9392.32up         hsa-miR-100*3.47down         hsa-miR-12603.09down         hsa-miR-12803.01down         hsa-miR-1414.5down         hsa-miR-21*4down         hsa-miR-2212.72down                   hsa-miR-455-3p 2.16 down Among the listed profiles of differentially down-regulated miRNA as compared with non-infected control cells, it was found that miR-574-5p was down regulated (>2-fold, p<0.05) in H5N1 infected cells at 3-hour post-infection. [score:4]
At 18 and 24-hour post-infection, miR-923, miR-1246, miR-574-3p, and miR-663 were up-regulated (>3-fold, p<0.05) in H5N1 infected cells. [score:4]
At the same time point (6-hour), miR-15a*, miR-1825, miR-183*, miR-34b, miR-494, and miR-574-5p were found to be down-regulated (>1.5-fold, p<0.05) in H1N1 infected cells. [score:4]
It was found that six miRNAs (miR-21*, miR-100*, miR-141, miR-1274a, miR-1274b and miR-574-3p) were initially up-regulated at 3 hours post-infection. [score:4]
We found that miR-21*, miR-100*, miR-141, miR-574-3p, miR-1274a and miR1274b were differentially expressed in response to influenza A virus infection. [score:3]
As a summary, miR-1246, miR-663 and miR-574-3p were up-regulated (>3-fold, p<0.05) at 24-hour post-infection with subtype H5 as compared with non-infected control cells. [score:3]
[1 to 20 of 9 sentences]
10
[+] score: 29
At 14 weeks from injection and in the presence of tumor, miR-205-5p was significantly downregulated and miR-214 and miR-574-3p were upregulated. [score:7]
The miRNA pattern of expression remained similar to previous experiments with increased levels of mir-214, miR-335-5p, and miR-574-3p in the diseased state. [score:5]
Both miR-335-5p and miR-574-3p have been reported to be important in bone and cartilage development and differentiation through the regulation of the Wnt pathway and SOX9 expression, respectively 21, 22. [score:5]
Three of the four miRNAs (miR-205-5p-5p, miR-214, and miR-335-5p) were validated in an independent set of diseased and wild-type mice to be statistically significant (P < 0.05) using a two-sample, two-tailed Student’s t-test comparing the 2 [−ΔCq] values of the two groups MicroRNA-574-3p was not statistically significant in final statistical analysis, but was included in simultaneous studies based on preliminary results (P =  0.15) (Fig. 1). [score:3]
The levels of miR-205-5p, miR-574-3p, and miR-214 were significant from baseline at the time of tumor development (14 week time point). [score:2]
Areas under the curve (AUCs) were 0.70 (95% CI 0.576–0.827), 0.80 (95% CI 0.699–0.909), 0.78 (95% CI 0.661–0.898), and 0.88 (95% CI 0.794–0.957) for miR-205-5p, miR-214, miR-335-5p, and miR-574-3p, respectively. [score:1]
As shown in Figure 5A, the areas under the curves (AUCs) were 0.70 (95% CI 0.576–0.827), 0.8 0(95% CI 0.699–0.909), 0.78 (95% CI 0.661–0.898), and 0.88 (95% CI 0.794–0.957) for miR-205-5p, miR-214, miR-335-5p, and miR-574-3p, respectively. [score:1]
The ΔCq cut-points were 8.34 for miR-205-5p, 10.31 for miR-214, 9.78 for miR-335-5p and 6.08 for miR-574-3p. [score:1]
Therefore, we monitored the levels of miR-205-5p, miR-214, miR-335-5p, and miR-574-3p prior to and serially after transplantation of OS cells. [score:1]
Finally, miR-574-3p has recently been reported to play an important role in maintaining mesenchymal stem cell multipotency, which is of interest for OS, as it is thought that the mesenchymal stem cell is the cell of origin in OS 22. [score:1]
Four miRNAs (miR-205-5p-5p, miR-214, miR-335-5p, and miR-574-3p) were chosen as candidate miRNAs based on reports in published literature, the presence of a conserved known human homologue, and the fold change in the global qPCR analysis. [score:1]
While our study is the first report of plasma miR-205-5p, miR-214, miR-335-5p, and miR-574-3p to be used as biomarkers, the literature supports that each of these miRNAs may have an important biologic function in OS. [score:1]
[1 to 20 of 12 sentences]
11
[+] score: 28
Other miRNAs from this paper: hsa-mir-27a, hsa-mir-221, hsa-mir-331, hsa-mir-339, hsa-mir-744
In fact, the complexity of this regulatory network may explain some unexpected results of our experiments, like a net increase in NGF expression following overexpression of a miRNA predicted to target the same gene (e. g., miR-574), or measurable inhibitory effects by miRNAs whose sequence shows no obvious homology with any neurotrophic gene (e. g., miR-331). [score:8]
Also, NGF protein was upregulated by miR-574 and TrKA was downregulated by miR-331. [score:7]
In contrast, the low-affinity p75 [NTR] receptor gene was not affected by miR-221, but was downregulated by miR-453 and upregulated by miR-574. [score:7]
However, our data also show significant RSV -induced changes in other miRNAs able to modify the expression of neurotrophic factors and receptors (e. g., miR-574, miR-453), which may also have biological significance and therapeutic potential. [score:3]
From this dataset, we identified 6 Homo sapiens (hsa)-miRNAs targets that were significantly affected by RSV and were also holding a high degree of homology to the mRNA sequences encoding neurotrophic factors or receptors: miR-27a, miR-221, miR-339-5p, miR-453, miR-574, and miR-744 (Table 1). [score:3]
[1 to 20 of 5 sentences]
12
[+] score: 24
Among these AF -associated miRNAs, 22 were up-regulated and 20 were down-regulated (Table  3 and Figure  3B) Table 3 miRNA expression differences between AF-LAA and SR-LAA miRNA SR-LAA signal AF-LAA signal Log 2 (AF-LAA/SR-LAA) P -valueUp-regulated (n = 22*)hsa-miR-3613-3p29430633.381.07E-02hsa-miR-49429618812.675.89E-02hsa-miR-3591-3p53920691.947.14E-02hsa-miR-4485802841.835.03E-02hsa-miR-574-3p4478135161.592.41E-02hsa-miR-466118333431.502.31E-02hsa-miR-44923348341.322.73E-02hsa-let-7d-3p1463441.239.94E-02hsa-miR-4707-5p3878571.152.92E-02hsa-miR-4534791721.126.66E-02hsa-miR-3940-5p3978031.025.71E-02hsa-miR-31781853741.011.97E-02hsa-miR-15b-5p3837230.923.04E-02hsa-miR-21-5p4428190.894.66E-02hsa-miR-3196138324770.841.34E-02hsa-miR-1307-3p821450.835. [score:12]
Among these AF -associated miRNAs, 22 were up-regulated and 20 were down-regulated (Table  3 and Figure  3B) Table 3 miRNA expression differences between AF-LAA and SR-LAA miRNA SR-LAA signal AF-LAA signal Log 2 (AF-LAA/SR-LAA) P -valueUp-regulated (n = 22*)hsa-miR-3613-3p29430633.381.07E-02hsa-miR-49429618812.675.89E-02hsa-miR-3591-3p53920691.947.14E-02hsa-miR-4485802841.835.03E-02hsa-miR-574-3p4478135161.592.41E-02hsa-miR-466118333431.502.31E-02hsa-miR-44923348341.322.73E-02hsa-let-7d-3p1463441.239.94E-02hsa-miR-4707-5p3878571.152.92E-02hsa-miR-4534791721.126.66E-02hsa-miR-3940-5p3978031.025.71E-02hsa-miR-31781853741.011.97E-02hsa-miR-15b-5p3837230.923.04E-02hsa-miR-21-5p4428190.894.66E-02hsa-miR-3196138324770.841.34E-02hsa-miR-1307-3p821450.835. [score:12]
[1 to 20 of 2 sentences]
13
[+] score: 23
Interestingly, alterations in the expression of miR-574-5p have been found to be associated with a variety of diseases, including cardiovascular diseases. [score:7]
In the present study, we systematically determined the expression levels of plasma miRNAs in CAD patients, and our data firstly identified two plasma miRNAs (miR-206 and miR-574-5p) which significantly up-regulated in CAD patients compared with control subjects. [score:5]
The expression of these two miRNAs (miR-206 and miR-574-5p) remained significantly up-regulated in the CAD patients compared with the healthy controls (Figures 3A and 3B). [score:5]
Boštjančič et al. [34] found that both miR-574-3p and miR-574-5p showed up-regulation in infarcted heart tissue compared with corresponding remote myocardium in human myocardial infarction, as well as to healthy human hearts. [score:3]
Initially, miR-574-5p was thought to be hosted by the first intron of the gene encoding Noxp20 on human chromosome 4 [33]. [score:1]
We obtained the following AUC values: miR-206, 0.607 (95% CI, 0.508–0.706) and miR-574-5p, 0.696 (95% CI, 0.609–0.787) respectively (Figures 4A and 4B). [score:1]
In human, the miR-574 gene is intronic. [score:1]
[1 to 20 of 7 sentences]
14
[+] score: 20
Comparison of the expression of regulated miRNAs and their cognate-predicted targets in our arrays revealed significant anti-correlation only for specific regulated miRNAs, which we grouped into two: miRNAs that are enriched in the embryonic liver, including miR-106a, miR-18a and miR-574-3p, and miRNAs that are enriched in the adult liver, including let-7a and c, miR-23b and miR-22. [score:7]
The best score was obtained for 3 miRNA seeds, corresponding to miRNAs that are expressed higher in the embryonic liver (miR-106a, miR-18a and miR-574-3p), and for which the predicted targets expression displays a negative correlation. [score:7]
In summary, the miRNA seeds that achieved the best scores in terms of anti-correlation with their predicted target genes are presented, and correspond to miRNAs let-7a, let-7b, let-7c, miR-22, and miR-23b, for adult liver-enriched miRNAs (Table 2), and miR-106a, miR-18a and miR-574-3p, for embryonic liver-enriched miRNAs (Table 3). [score:3]
As for the possible roles of these miRNAs during liver development; while miR-574-3p's role has not yet been studied, miR-106a and miR-18a belong to the oncogenic clusters, miR-106a-363 and miR-17-92, and may regulate cell cycle and apoptosis in the embryonic liver. [score:3]
[1 to 20 of 4 sentences]
15
[+] score: 20
Among those significantly differentially expressed miRNAs, five downregulated (miR-26b-5p, miR-200c-3p, miR-203a, miR-223-3p, miR-363-3p) and three upregulated (miR-328, miR-574-3p, miR-1825) miRNAs were selected as a result of detailed literature search for further confirmation with qRT-PCR. [score:9]
For top 10 upregulated microRNAs (hsa-miR-197-3p, hsa-miR-574-3p, hsa-miR-885-5p, hsa-miR-483-3p, hsa-miR-1281, hsa-miR-328, hsa-miR-4254, hsa-miR-4290, hsa-miR-1825, hsa-miR-766-3p), we included those have been shown to be deregulated in cancer, and have either expression data or functional studies in stem cells. [score:7]
However, expression levels of miR-223-3p, miR-328, and miR-574-3p were not significantly different between CD133 [+] vs. [score:3]
Only hsa-miR-574-3p, hsa-miR-328, and hsa-miR-1825 met these criteria. [score:1]
[1 to 20 of 4 sentences]
16
[+] score: 19
In order to further understand the role of aberrant miRNAs in physiological functions and biologic processes in arsenite -induced neoplastic transformation cells, 11 downregulated miRNAs (miR-197-3p, miR-192-5p, miR-127-3p, miR-139-5p, miR-490-3p, miR-196b-5p, miR-125a-3p, miR-298, miR-542-3p, miR-15b-5p, and miR-33b-5p) and six upregulated miRNAs (miR-200b-3p, miR-106b-5p, miR-574-5p, miR-320d, miR-200c-3p, and miR-141-3p) (Table S2) were selected, and their target genes were predicted with the TargetMiner, miRDB, and TarBase databases. [score:11]
Among the 191 dysregulated miRNAs, seventeen miRNAs (downregulation miRNAs: miR-197-3p, miR-192-5p, miR-127-3p, miR-139-5p, miR-490-3p, miR-196b-5p, miR-125a-3p, miR-298, miR-542-3p, miR-15b-5p, miR-33b-5p; upregulation miRNAs: miR-200b-3p, miR-106b-5p, miR-574-5p, miR-320d, miR-200c-3p, miR-141-3p, Table S2) were selected for bioinformatics analysis. [score:8]
[1 to 20 of 2 sentences]
17
[+] score: 19
Specifically, two miRNAs (miR-18a-5p and miR-574-3p) were upregulated in the Mn [2+] -induced NPA mo del, while let-7e-5p was downregulated and miR-205-5p was upregulated in the chlorpromazine -induced NPA mo del. [score:10]
In the lupus-like disease produced by Mn [2+] -induced NPA, miR-18a-5p and miR-574-3p exhibited increased expression. [score:5]
The remaining six deregulated miRNAs: let-7e-5p, miR-18a-5p, miR-23b-3p, miR-205-5p, miR-207, and miR-574-3p, which are specific to each of our murine lupus-like mo dels, highlight some differences between them, but also show roles on inflammation and immune disease. [score:4]
[1 to 20 of 3 sentences]
18
[+] score: 18
Six of these miRNAs miR-16, miR-302d-3p, miR-378e, miR-570–3p, miR-574-5p, miR-579; were down-regulated and one was up-regulated miR-25-3p in T1DM plasma-derived exosome samples compared to the control (p value < 0.05) (Figs  2B and 3). [score:6]
We identified and confirmed that of the seven miRNAs whose levels change in plasma exosomes from T1DM subjects, 6 which were lower in T1DM patients (miR-16, miR-302d-3p, miR-378e, miR-570-3p, miR-574-5p, and miR-579) and 1 upregulated (miR-25-3p) several appear to play important roles in diabetes. [score:4]
At the same time, decreased plasma miR-574 expression has been linked to diabetic nephropathy and type 2 diabetes patients 30, 31. [score:3]
Furthermore, miR-16, miR-570, miR-574 and miR-579 have been found in extracellular vesicles released from human pancreatic islets [18]. [score:1]
From those, all followed the same tendency in both techniques but only 3 microRNAS, miR-16-5p, miRNA-302d-3p, miR-574-5p, shown to be significant by qRT-PCR. [score:1]
Interestingly, when examining the level of the miRNA in plasma exosomes in T1DM and control subjects, only miR-16-5p, miR-574-5p and miR-302d-3p were significantly higher in plasma exosomes from controls than those from T1DM (p-value < 0.05 and p-value < 0.01) (Fig.   4). [score:1]
To validate the RNA sequencing data, we performed a qRT-PCR analysis of hsa-let-7, hsa-miR-631, RNU6, hsa-miR-16-5p, hsa-miR-25-3p, hsa-miR-302d-3p, hsa-miR-378e, hsa-miR-570-3p, hsa-miR-574-5p, and hsa-miR-579. [score:1]
miR-574 has been found in T1DM subjects with autoantibodies [29]. [score:1]
[1 to 20 of 8 sentences]
19
[+] score: 18
The expression of CCNB1 (cyclin B1) that activates CDK1 driving G2/M-phase progression [67], of CDCA8 (borealin) that is required for the proper segregation of chromosomes during mitosis [68] and of NUSAP1 that is selectively expressed in proliferative cells and is a positive regulator of mitosis by acting on microtubules organization [69] were significantly inversely correlated to mmu-miR-574-5p expression. [score:8]
Primers were designed for several miRNAs undergoing regulation at, at least, two time-points (such as mmu-miR-146b, -29c…) and for miRNAs selected on the basis of their abundancy (such as mmu-let-7b, mmu-miR-21, -145…), the magnitude of the observed regulations (such as mmu-miR-574-5p, -672…) and the potential significance of their mRNA targets (see below). [score:4]
Transient transfection analysis for luciferase reporter expression with Arid4b, Il-6 or Lpin2 3′UTR in the presence of miR-223; with Gmnn, Nola2 or Ube2c 3′UTR in the presence of miR-483; with Dera or Nusap1 3′UTR in the presence of miR-574-5p; with Cd3g or Phb2 3′UTR in the presence of miR-672; and with Fst, Ctse or Cdca8 3′UTR in the presence of miR-690. [score:3]
These correlations reinforce the hypothesis that cell proliferation predominates at the early stages of asthma development rather than in the late stage and might probably partly be under miRNA control, especially through mmu-miR-574-5p regulation. [score:3]
[1 to 20 of 4 sentences]
20
[+] score: 17
The same pattern of regulation was observed for miR-574-3p and-5p, which were downregulated specifically in LCLs from non-SOD1 cases. [score:5]
Conversely, robust downregulation of both strands of miR-132 and miR-574 are found only in LCLs derived from patients with likely TDP-43 pathology, but not in LCLs carrying a mutation in SOD1. [score:5]
While dysregulation of miR-143-5p/3p seems to be a common feature of ALS pathology, downregulation of miR-132-5p/3p and miR-574-5p/3p was evident in sporadic, TARDBP, FUS and C9ORF72, but not SOD1 mutant patients. [score:5]
Also here, lack of statistical significance for both strands of miR-574 in TARDBP mutant LCLs is due to a small sample number available and results showed a strong trend (p ≤ 0.09). [score:1]
Hence, while a decrease of both strands of miR-143 seems to be a common feature of ALS patient derived LCLs, reduced levels of both strands of miR-132 and miR-574 accompany ALS cases with TDP-43 and/or FUS pathology. [score:1]
[1 to 20 of 5 sentences]
21
[+] score: 16
They found that upregulation of miR-499a-5p is a common feature of all placental insufficiencies such as preeclampsia (n = 80), gestational hypertension (n = 35), and FGR (n = 35); in addition, they demonstrated an upregulation of miR-1-3p in FGR pregnancies with abnormal umbilical fetal flows (n = 19); finally, they found downregulation of a series of miRNAs (miR-16-5p, miR-26a-5p, miR-100-5p, miR-103a-3p, miR-122-5p, miR-125b-5p, miR-126-3p, miR-143-3p, miR-145-5p, miR-195-5p, miR-199a-5p, miR-221-3p, miR-342-3p, and miR-574-3p) in FGR requiring the delivery before 34 weeks of gestation. [score:10]
Last year, Hromadnikova's group investigated maternal blood levels of specific miRNAs involved in cardiovascular and cerebrovascular diseases, finding a downregulation of miR-100-5p, miR-125b-5p, and miR-199a-5p in 39 patients with gestational hypertension, in 68 with preeclampsia, and in 33 with fetal growth restriction compared with 55 healthy controls; in addition, they showed downregulation of miR-17-5p, miR-146a-5p, miR-221-3p, and miR-574-3p only in FGR pregnancies [46]. [score:6]
[1 to 20 of 2 sentences]
22
[+] score: 15
Modulation of pulmonary miRNAs targeting p53 (miR-138 and miR-376c) and apoptosis (miR-98 and miR-350) is consistent with the notion that AMPK is involved in the p53 -mediated cell cycle arrest and apoptosis 2. Several miRNAs upregulated in the lung of metformin -treated mice, including miR-30b, miR-138, miR-239a, miR-342, and miR-574, are involved in stress response and inflammation and target NF κB or Tlr9 (Toll-like receptor). [score:8]
In addition, metformin modulated the expression of a number of miRNAs (let-7f, miR-30b, miR-362, miR-376c, miR-466h, miR-490, and miR-574) involved in the regulation of the cell cycle, which is a crucial mechanism in the AMPK -mediated activity of this drug 42. [score:4]
01 Stress response, cell proliferation miR-542 ↓2.60 NA miR-574 ↑2.09 Inflammation (Tlr9 activation), cell proliferation, apoptosis miR-669j ↑3.12 NA miR-672 ↑2.40 NA miR-674 ↑2.19 NA miR-744 ↑4.35Oncogene (Tgf) suppression miR-873 ↑2.53 ↑3.22 NA miR-1930 ↑3.31 NA miR-1934 ↑2.17 ↑3.27 NA miR-1942 ↑2.49 NA miR-3064 ↑2.50 NA miR-3065 ↑3.20 NA miR-3069 ↑2.98 NA miR-3071 ↑3.51 NA miR-3073 ↓2.78 NA miR-3092 ↑3.48 NA miR-3093 ↑3.28 NA miR-3109 ↓2.07 NAAll reported variations were statistically significant (P < 0.05). [score:3]
[1 to 20 of 3 sentences]
23
[+] score: 14
Significant levels of miR-574-5p are expressed in lung, heart, and liver tissue [31], and radiation/LPS could also be stimulating the releases of extracellular vesicles from those organs, contributing to the observed increase in plasma levels on day 1. miR-146a is another molecule that exhibited significant plasma response after radiation as well as LPS treatment. [score:3]
It is interesting to note that miR-574-5p expression levels were significantly changed in both LPS and WBI samples. [score:3]
Based on this analysis, hsa-miR-574-5p and hsa-miR-150-5p show significant dose response to WBI. [score:1]
Moreover, multiple GU repeats present in the miR-574-5p sequence makes it a stronger agonist for TLR7/8 signaling [44]. [score:1]
For example, the relative abundance of miR-574-5p significantly increases with dose on day 1 (p-value < 0.005), but does not show significant changes in abundance at day 3 or 7. On the other hand, miR-150-5p shows a dose -dependent decrease in abundance in all days, with strong decreases occurring in day 3 and 7 (Fig 3A). [score:1]
Circulating miR-574-5p could also be of viral origin, and the kinetics and response indicate possible nucleic acid -mediated activation of toll-like receptor signaling [43]. [score:1]
Another major outcome from the current study is the discovery of miR-574-5p as a novel early response biomarker, with clear dose response detectable at 24 h. A similar increase in circulating miR-574-5p abundance was observed in NHPs exposed to bacterial endotoxin LPS as well, suggesting that the plasma response here was associated with acute inflammatory response as a cause or effect. [score:1]
These sequences, miR-1-5p, miR-146a-5p, miR-150-5p, miR-206, miR-342-3p, miR-574-5p, and miR-1283, had time- and dose-specific changes in abundance (Fig 6A). [score:1]
One-way ANOVA of the dose response of each sequence on each day suggests that miR-150-5p and miR-574-5p are sensitive to radiation (Fig 6A). [score:1]
LPS treatment caused significant increase in abundance of miR-146a-5p, miR-574-5p and decreased abundance of miR-1-3p, miR-133a-3p, miR-206, and miR-365a-3p/365b-3p. [score:1]
[1 to 20 of 10 sentences]
24
[+] score: 14
Other miRNAs from this paper: hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-98, hsa-mir-99a, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-196a-1, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-196a-2, hsa-mir-199a-2, hsa-mir-210, hsa-mir-181a-1, hsa-mir-214, hsa-mir-222, hsa-mir-223, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-140, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-146a, hsa-mir-150, hsa-mir-186, hsa-mir-188, hsa-mir-195, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-363, hsa-mir-302c, hsa-mir-370, hsa-mir-373, hsa-mir-374a, hsa-mir-328, hsa-mir-342, hsa-mir-326, hsa-mir-135b, hsa-mir-338, hsa-mir-335, hsa-mir-345, hsa-mir-424, hsa-mir-20b, hsa-mir-146b, hsa-mir-520a, hsa-mir-518a-1, hsa-mir-518a-2, hsa-mir-500a, hsa-mir-513a-1, hsa-mir-513a-2, hsa-mir-92b, hsa-mir-614, hsa-mir-617, hsa-mir-630, hsa-mir-654, hsa-mir-374b, hsa-mir-301b, hsa-mir-1204, hsa-mir-513b, hsa-mir-513c, hsa-mir-500b, hsa-mir-374c
Out of the 114 differentially expressed miRNAs, the only 10 upregulated miRNAs in SzS samples were miR-145, miR-574-5p, miR-200c, miR-199a*, miR-143, miR-214, miR-98, miR-518a- 3p, and miR-7. The aberrant expression of MYC in SzS was found to correlate with the set of miRNAs including miR-30, miR-22, miR-26a, miR-29c, miR-30, miR-146a, and miR-150 which were downregulated. [score:11]
A 9-miRNA signature (hsa-miR-146b-5p, hsa-miR-146a, hsa-miR-21, hsa-miR-155, hsa-miR-500, hsa-miR-222, hsa-miR-363, hsa-miR-574-3p, and hsa-miR-574-5p) from study by Malumbres et al. [48] can precisely differentiate the DLBCL into ABC or GCB subtypes, and expression of some of these miRNAs correlated with clinical outcome. [score:3]
[1 to 20 of 2 sentences]
25
[+] score: 11
control Expression in case group 1 hsa-mir-1290 0.26 down 2 hsa-mir-342-5p 0.22 down 3 hsa-mir-1224-5p 0.23 down 4 hsa-mir-345 0.38 down 5 hsa-mir-1228 0.38 down 6 hsa-mir-1249 0.32 down 7 hsa-mir-1826 0.26 down 8 hsa-miR-1306 0.38 down 9 hsa-miR-188-5p 0.43 down 10 hsa-miR-320a 0.48 down 11 hsa-miR-320c 0.26 down 12 hsa-miR-365 0.31 down 13 hsa-miR-423-5p 0.35 down 14 hsa-miR-483-5p 0.25 down 15 hsa-miR-634 0.31 down 16 hsa-miR-671-5p 0.23 down 17 hsa-miR-939 0.24 down 18 hsa-miR-1246 2.22 up 19 hsa-miR-150 10.41 up 20 hsa-miR-574-5p 8.04 up Table 3 MiRNAs Target Gene Symbol hsa-miR-345PUM2, PPP2R3A, BCAT1, ZFHX4, CHSY3, ARNT, SHE, SLC7A5, SOS1,. [score:5]
control Expression in case group 1 hsa-mir-1290 0.26 down 2 hsa-mir-342-5p 0.22 down 3 hsa-mir-1224-5p 0.23 down 4 hsa-mir-345 0.38 down 5 hsa-mir-1228 0.38 down 6 hsa-mir-1249 0.32 down 7 hsa-mir-1826 0.26 down 8 hsa-miR-1306 0.38 down 9 hsa-miR-188-5p 0.43 down 10 hsa-miR-320a 0.48 down 11 hsa-miR-320c 0.26 down 12 hsa-miR-365 0.31 down 13 hsa-miR-423-5p 0.35 down 14 hsa-miR-483-5p 0.25 down 15 hsa-miR-634 0.31 down 16 hsa-miR-671-5p 0.23 down 17 hsa-miR-939 0.24 down 18 hsa-miR-1246 2.22 up 19 hsa-miR-150 10.41 up 20 hsa-miR-574-5p 8.04 up Table 3 MiRNAs Target Gene Symbol hsa-miR-345PUM2, PPP2R3A, BCAT1, ZFHX4, CHSY3, ARNT, SHE, SLC7A5, SOS1,. [score:5]
hsa-miR-574-5pFOXP2, UBE2Q1, VGLL4, ARGLU1, YME1L1, CSDA, KCNMA1, SLC7A5,. [score:1]
[1 to 20 of 3 sentences]
26
[+] score: 10
Maternal probiotic supplementation was associated with upregulation of let-7d-3p and downregulation of miR-574-3p, miR-340-5p and miR-218-5p, although the estimated FDR for each is 0.818 (Table 2). [score:7]
Maternal probiotic ingestion was associated with four differentially expressed miRNAs with low abundance (miR-574-3p, let-7d-3p, miR-340-5p and miR-218-5p). [score:3]
[1 to 20 of 2 sentences]
27
[+] score: 10
severe (p<0.05) cfa-let-7d, cfa-miR-101, cfa-miR-10a, cfa-miR-1296, cfa-miR-1306, cfa-miR-1307, cfa-miR-130a, cfa-miR-136, cfa-miR-17, cfa-miR-181b, cfa-miR-196b, cfa-miR-197, cfa-miR-215, cfa-miR-22, cfa-miR-30d, cfa-miR-33b, cfa-miR-497, cfa-miR-503, cfa-miR-574, cfa-miR-628, cfa-miR-676Comparing the miRNA differential expression analyses between disease states obtained by RT-qPCR and RNAseq, we observed discordances between the two methods. [score:5]
severe (p<0.05) cfa-let-7d, cfa-miR-101, cfa-miR-10a, cfa-miR-1296, cfa-miR-1306, cfa-miR-1307, cfa-miR-130a, cfa-miR-136, cfa-miR-17, cfa-miR-181b, cfa-miR-196b, cfa-miR-197, cfa-miR-215, cfa-miR-22, cfa-miR-30d, cfa-miR-33b, cfa-miR-497, cfa-miR-503, cfa-miR-574, cfa-miR-628, cfa-miR-676 Comparing the miRNA differential expression analyses between disease states obtained by RT-qPCR and RNAseq, we observed discordances between the two methods. [score:5]
[1 to 20 of 2 sentences]
28
[+] score: 10
In two additional studies by Chiyomaru et al., GEN was able to up-regulate miR-574-3p [102] and down-regulated the lncRNA HOTAIR (HOX antisense intergenic RNA) [103] in cell culture. [score:7]
miR-574-3p targets include the GTPase RAC1, epidermal growth factor receptor (EGFR) and the HAT p300. [score:3]
[1 to 20 of 2 sentences]
29
[+] score: 9
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-26a-1, hsa-mir-29a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-99a, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-197, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-10a, hsa-mir-34a, hsa-mir-182, hsa-mir-199a-2, hsa-mir-205, hsa-mir-210, hsa-mir-221, hsa-mir-223, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-23b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-140, hsa-mir-142, hsa-mir-143, hsa-mir-125b-2, hsa-mir-134, hsa-mir-146a, hsa-mir-150, hsa-mir-206, hsa-mir-155, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-101-2, hsa-mir-130b, hsa-mir-26a-2, hsa-mir-361, hsa-mir-362, hsa-mir-363, hsa-mir-376c, hsa-mir-371a, hsa-mir-375, hsa-mir-376a-1, hsa-mir-378a, hsa-mir-342, hsa-mir-151a, hsa-mir-324, hsa-mir-335, hsa-mir-345, hsa-mir-423, hsa-mir-483, hsa-mir-486-1, hsa-mir-146b, hsa-mir-202, hsa-mir-432, hsa-mir-494, hsa-mir-495, hsa-mir-193b, hsa-mir-497, hsa-mir-455, hsa-mir-545, hsa-mir-376a-2, hsa-mir-487b, hsa-mir-551a, hsa-mir-571, hsa-mir-576, hsa-mir-606, hsa-mir-628, hsa-mir-629, hsa-mir-411, hsa-mir-671, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-889, hsa-mir-876, hsa-mir-744, hsa-mir-885, hsa-mir-920, hsa-mir-937, hsa-mir-297, hsa-mir-1233-1, hsa-mir-1260a, hsa-mir-664a, hsa-mir-320c-2, hsa-mir-2861, hsa-mir-378b, hsa-mir-1260b, hsa-mir-378c, hsa-mir-1233-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-664b, hsa-mir-378j, hsa-mir-486-2
It has been shown that circulating serum miR-297 is upregulated in non-surviving sepsis patients when compared to survivors, whereas miR-574-5p is downregulated. [score:6]
In addition, the combination of sepsis stage, sequential organ failure assessment (SOFA) score and miR-574-5p expression was identified as an excellent predictor for patient survival from sepsis (166). [score:3]
[1 to 20 of 2 sentences]
30
[+] score: 9
Of the 186 miRNAs the expression of which was altered, nine were up-regulated at both time points (miR-125a-3p, miR-297c, miR-421, miR-452, miR-483, miR-574-3p, miR-574-5p, miR-669a, miR-720) and 11 were down-regulated at both time points (let-7g, miR-107, miR-10a, miR-15a, miR-15b, miR-199b*, miR-26a, miR-29c, miR-324-5p, miR-331-3p, miR-342-3p). [score:9]
[1 to 20 of 1 sentences]
31
[+] score: 9
lncRNA acting as ceRNA Competing protein coding gene Shared miRNA ceRNA score Reference HULC (Highly Upregulated in Liver Cancer) PRKACB miR-372 0.026 (p-value = 0.001) [20] lincRNA MD1 MAML1 miR-133 0.022 (p-value = 0.02) [21] H19 Targets of hsa-let-7 Let-7 - [22] Linc-RoR (Regulator of Reprogramming) SOX2 and NANOG miR-145 0.038 (p-value = 0.008) [36] PTCSC3 Targets of miR-574-5p in thyroid cancer cell line miR-574-5p - [37] Users can browse for ceRNA candidates for a protein coding gene (by gene symbol, gene id or refseq accession) and/or lncRNA gene (by gene name, ensemble gene id or ensemble transcript id) and/or miRNA name. [score:9]
[1 to 20 of 1 sentences]
32
[+] score: 9
In prostate cancer cells, genistein inhibits invasion and migration by its down-regulation of miR-151 [29] and up-regulation of miR-574-3p [30]. [score:9]
[1 to 20 of 1 sentences]
33
[+] score: 9
Oncogenic miRNA hsa-miR-574 is upregulated and tumor suppressor miRNAs such as hsa-let-7i, hsa-miR-34a, hsa-miR-185 and hsa-miR-31 are downregulated (Zhao et al., 2015). [score:9]
[1 to 20 of 1 sentences]
34
[+] score: 9
LncRNAs functioning as ceRNAs can be also observed in: mouse and human myoblasts, where the large intergenic non-coding RNA (lincRNA) called linc-MD1 controls muscle differentiation by targeting miR-133 and miR-135 to regulate the expression of MAML1 and MEF2C [74]; human embryonic stem cells, where linc-RoR competes with the transcription factors NANOG, OCT4, SOX2 for binding to miR-145 regulating cell pluripotency and self-renewing [75]; human thyroid cancer, where the thyroid-specific lncRNA PTCSC3 targets miR-574-5p [76]; human embryonic kidney 293 (HEK293) cells, where the lncRNA H19 modulates the let-7 miRNAs family availability causing precocious muscle differentiation [77]. [score:9]
[1 to 20 of 1 sentences]
35
[+] score: 8
The regulatory roles of miRNA include the upregulation of mir574-3p in prostate cancer (24) and the extreme downregulation of miR-23a in gastric cancer (25). [score:8]
[1 to 20 of 1 sentences]
36
[+] score: 8
Here, we intended to identify suitable MREs for bladder cancer specific adenovirus -mediated TRAIL expression from the miRNAs with downregulated expression in bladder cancer, including miR-1 [18- 21], miR-99a [22], miR-100 [23], miR-101 [24, 25], miR-125b [23, 26, 27], miR-133a [18, 20, 21, 23, 28- 30], miR-143 [22, 23, 31- 33], miR-145 [21, 23, 29- 31, 34], miR-195-5p [35], miR-199a-3p [36], miR-200 [37, 38], miR-203 [39, 40], miR-205 [37], miR-218 [21, 41], miR-490-5p [42], miR-493 [43], miR-517a [44], miR-574-3p [45], miR-1826 [46] and let-7c [42]. [score:8]
[1 to 20 of 1 sentences]
37
[+] score: 8
The study revealed that 10 dysregulated miRNA signature among which hsa-miR-1271-5p and hsa-miR-574-3p were down-regulated; and hsa-miR-182-5p, hsa-miR-183-5p, hsa-miR-96-5p, hsa-miR-182-3p, hsa-miR-141-5p, hsa-miR-15b-5p, hsa-miR-130b-5p, and hsa-miR-135b-3p were overexpressed in ovarian cancer tissues. [score:7]
Some characteristics of these miRNAs, including fold change between cancer and normal tissues together with the t-test p-values and FDR-adjusted p-values, are presented in Table 2. The 10 miRNAs included miR-1271-5p and miR-574-3p, which had significantly lower expression (P values are presented in Table 2) levels in the ovarian cancer group (C group) than in the normal group. [score:1]
[1 to 20 of 2 sentences]
38
[+] score: 7
FOXN3 is a direct target of and is downregulated by miR-574-5p to promote the progression of human lung cancer [18]. [score:7]
[1 to 20 of 1 sentences]
39
[+] score: 7
Eight miRNAs (miR-183, miR-193a-5p, miR-222, miR-516b, miR-524-5p, miR-601, and miR-629, 99b) were upregulated and five miRNAs (miR-124, miR-32, miR-574-5p, miR-744, and miR-96) were downregulated. [score:7]
[1 to 20 of 1 sentences]
40
[+] score: 7
The results of microarray and bioinformatics analyses demonstrate that miR-574-3p, which is upregulated in the area of myocardial infarcted, is a putative candidate miRNA that targets SERCA2a, but the authors suggest that further study (as opposed to immediate retesting) is necessary to confirm the relationship between miR-574-3p and SERCA2a [73]. [score:6]
3.2.6. miR-574-3p. [score:1]
[1 to 20 of 2 sentences]
41
[+] score: 6
We also found that genistein down-regulates the RAC1 and EP300 genes that are important regulators of VEGF -mediated angiogenesis [23], [24] and the EGFR gene by up -regulating miR-574-3p [25]. [score:6]
[1 to 20 of 1 sentences]
42
[+] score: 6
Other miRNAs from this paper: hsa-mir-34a, hsa-mir-1246, hsa-mir-3646, hsa-mir-3658, hsa-mir-4438
From several differentially expressed miRNAs obtained from the microarray, we selected 5 upregulated miRNAs (has-miR-3646, has-miR-3658, has-miR-4438, miR-1246, and has-miR-574-3p) for RT-qPCR validation. [score:6]
[1 to 20 of 1 sentences]
43
[+] score: 6
Seven miRNAs (mmu-miR-574-5p, mmu-miR-466i-5p, mmu-miR-342-3p, mmu-let7i-5p, mmu-miR-34a-5p, mmu-miR-188-5p and mmu-miR-5119) were upregulated and the other five (mmu-miR-378a-3p, mmu-miR-202-3p, mmu-miR-378b, mmu-miR-378d and mmu-miR-212-3p) were downregulated in the CCl [4] group compared with the control (Fig. 1a,b). [score:6]
[1 to 20 of 1 sentences]
44
[+] score: 6
Higher expression of miR-574-3p was associated with non-relapse and favorable overall survival, which was a predictor for clinical outcome in patients with esophageal cancer after surgery [18]. [score:3]
A microarray analysis has ever identified miR-574-3p, miR-106b, miR-1303, miR-1203, miR-1909, miR-204, miR-371-3p and miR-886-3p, which were differentially expressed between the patients with and without tumor relapse after surgery. [score:3]
[1 to 20 of 2 sentences]
45
[+] score: 6
Moreover, hsa-miR-574-5p was found to negatively regulate MACC-1 (metastasis associated in colon cancer 1) expression to inhibit colorectal cancer liver metastasis [19]. [score:6]
[1 to 20 of 1 sentences]
46
[+] score: 6
Several laboratories have shown that miRNAs directly inhibit EGFR or/and c-Met expression, such as miR-7, miR-146a, miR-574-3p, miR-34a, miR-130a and miR-1/206 (42– 47). [score:6]
[1 to 20 of 1 sentences]
47
[+] score: 6
Other bone miRNAs, miR-631 and miR-574-5p 1, 9, were also tested in order to preclude a non-specific phenomenon related to a general upregulation of gene expression. [score:6]
[1 to 20 of 1 sentences]
48
[+] score: 5
Thus, it is not surprising that the maximal AUC between all cancer and non-cancer diseases computed for hsa-miR-574-5p was just 0.63 and is thus substantially smaller than the AUCs for the comparison of diseases versus healthy control samples. [score:5]
[1 to 20 of 1 sentences]
49
[+] score: 5
The ISH probes used for nucleolar miRNAs were: hsa-miR-191 with a sequence 5′DigN-cag ctg ctt ttg gga ttc cgt tg-3′; hsa-miR-193b with a sequence 5′DigN-agc ggg act ttg agg gcc agt t-3′; hsa-miR-484 with a sequence 5′DigN-atc ggg agg gga ctg agc ctg a-3′; and hsa-miR-574-3p with a sequence 5′DigN-tgt ggg tgt gtg cat gag cgt g-3′. [score:1]
0070869.g003 Figure 3(A) Localisation of miR-193b, miR-484 and miR-574-3p is examined in lung cancer cells H1299, liver cancer cells Huh7, RPE cells, human adult fibroblast AG06858 and primary mouse adult fibroblast. [score:1]
Nucleolar location of mature miR-191, miR-193b, miR-484 and miR-574-3p in HeLa cells. [score:1]
Four nucleolar microRNAs; miR-191, miR-193, miR-484, miR-574-3p, are examined for their nucleolar location. [score:1]
Four nucleolar miRNAs; miR191, miR-484, miR-574-3p and miR-193b, were tested in our ISH experiments, and all four miRNAs exhibit strong nucleolar localisation (Figure 2A). [score:1]
[1 to 20 of 5 sentences]
50
[+] score: 5
We found that of these 10 selected miRNAs only miR-548a-5p and miR-574-3p were differentially expressed between seronegative subjects (Ab [−]) and seropositive subjects (Ab [+]) with statistical significance (p < 0.05). [score:3]
This analysis included miR-184, miR-548a-5p, miR-574-3p, miR-616, miR-1233, miR-642, miR-140-3p, miR-517b, miR-10b and miR-380-3p (Figure  3, Tables  3 and 4 and Additional file 3: Table S3). [score:1]
For miR-574-3p the difference between both groups is statistically significant (p = 0.028) but since the fold change is only 1.36 this difference is unlikely to be biologically significant. [score:1]
[1 to 20 of 3 sentences]
51
[+] score: 5
Other miRNAs from this paper: hsa-mir-31, hsa-mir-372, hsa-mir-455
Compared with lncRNA HULC, lncRNA PTCSC3 is a newly identified noncoding RNA that is dramatically downregulated in thyroid cancers and has been studied as a tumor suppressor that competes with endogenous RNA for miR-574-5p (Fan et al., 2013). [score:5]
[1 to 20 of 1 sentences]
52
[+] score: 5
Global microRNA expression analysis demonstrated that the expression of seven microRNAs, including miR-378, miR-689 miR-21, miR-574-5P, miR-696 miR-370 miR-21, that were significantly altered during liver regeneration [16] were not altered during the hepatic differentiation of hUC-MSCs in our study. [score:5]
[1 to 20 of 1 sentences]
53
[+] score: 5
Interestingly, the recently identified miR-574-5p, which is associated with the neuronal inhibition by APP, [19] is also included in both of the two data sets of our ChIP-seq miRNAs (Supplementary Tables S1 and S2). [score:3]
However, the direct binding of AICD to the genomic region surrounding miR-574 remains to be determined. [score:2]
[1 to 20 of 2 sentences]
54
[+] score: 5
Other miRNAs from this paper: hsa-mir-210
In addition, the functional analysis of the DICER rs1057035 SNP, which resides in the 3′UTR of DICER, has revealed that targeting of has-miR-574-3p to DICER was differentially affected by the type of DICER rs1057035 allele and that the DICER rs1057035 variant C allele led to reduced expression of Dicer [34]. [score:5]
[1 to 20 of 1 sentences]
55
[+] score: 5
CUR inhibited the expression of miR-125-5p, miR-574-3p and miR-210 in undifferentiated nasopharyngeal carcinoma (NPC). [score:5]
[1 to 20 of 1 sentences]
56
[+] score: 4
Other miRNAs from this paper: hsa-mir-21, hsa-mir-107
In prostate cancer, urine exosomal miR-107 and miR-574-3p are upregulated [22]. [score:4]
[1 to 20 of 1 sentences]
57
[+] score: 4
Ample evidence shows that altered miRNA expression result in the initiation, promotion, and progression of NSCLC, such as miRNA-21 [9], miRNA-205 [10], miR-1254 and miR-574-5p [11]. [score:3]
In addition, miR-494, miR-101, miR-1254, miR-574-5p, miR-143 and miR-181a were demonstrated to be involved in NSCLC [23– 25]. [score:1]
[1 to 20 of 2 sentences]
58
[+] score: 4
We found that 86.11% (31 of 36) of the relative real-time RT-PCR results were consistent with those obtained in the microRNA microarray analysis in terms of direction of regulation at one or more time points except the results of miR-574-3p in BJ501-infected lung on 2 dpi, miR-1 in PR8-infected lung on 2 dpi, miR-1 in BJ501-infected lung on 5 dpi, miR-133a in PR8-infected lung on 2 dpi and miR-133b in PR8-infected lung on 2 dpi (Figure 5). [score:3]
Nine microRNAs (miR-1, miR-1187, miR-133a, miR-133b, miR-155, miR-2137, miR-223, miR-30d and miR-574-3p) were selected for validation. [score:1]
[1 to 20 of 2 sentences]
59
[+] score: 4
Other miRNAs from this paper: hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3
One newly evidence also showed that upregulation of miRNA-574-5p was critical for TLR9 signaling enhanced tumor progression of human lung cancer [10]. [score:4]
[1 to 20 of 1 sentences]
60
[+] score: 4
The microRNA profile in these male brains included significant downregulation of miR-322, miR-574, and miR-873, showing similarity to control female brains [65]. [score:4]
[1 to 20 of 1 sentences]
61
[+] score: 4
For example, in previous lung cancer studies, levels of miR-1254, miR-574-5p, miR-486, miR-30d, miR-1, and miR-499 expression were significantly dysregulated in early-stage lung cancer [7], [30]. [score:4]
[1 to 20 of 1 sentences]
62
[+] score: 4
Nineteen of the downregulated miRNAs in chronic patients were found to be associated with carcinogenesis in various organs and tissues, such as miR-1207 [40], miR-3162-5p [41, 42], miR-3196 [43, 44], miR-371b-5p [45], miR-574-5p [46, 47], miR-1225-5p [48], miR-4485 [49], miR-572 [50], miR-4299 [51], miR-3679-5p [52], miR-3940-5p [53], miR-638 [54, 55], miR-1202 [56], miR-5787 [57], miR-1973 [58], miR-4532 [59], miR-1275 [60], miR-4728-5p [61], and miR-1915-3p [62]. [score:4]
[1 to 20 of 1 sentences]
63
[+] score: 3
83 *** hsa-mir-346 7.13 *** 69.13 *** hsa-mir-361-3p 4.51 *** 9.6 *** hsa-mir-483-3p 3.56 *** 68.61 *** hsa-mir-486-5p 2.85 *** 34.48 *** hsa-mir-574-3p 2.61 *** 43.22 *** hsa-mir-629* 16.62 *** 67.23 *** hsa-mir-885-5p 4.75 *** 43.73 *** Inhibited differentiation & high cell count hsa-mir-193b 38.04 *** 102.74 * Hits of functional screen Relative percentage of myotubes 1, % of control p value, Mann Whitney test Relative cell count 2, % of control p value, Mann Whitney test hsa-mir-369-3p 61.75 *** 103.6 * hsa-mir-381 61.75 *** 105.31 * hsa-mir-886-5p 38.04 *** 112.86 *** hsa-mir-940 21.37 *** 112.35 *** Enhanced differentiation hsa-mir-98 104.51 * 87.82 *** High cell count hsa-mir-631 92.63 ** 103.43 *** 1see Material and Methods; 2 *: p<0.05; **: p<0.01; *** p<0.005; − = not significant. [score:3]
[1 to 20 of 1 sentences]
64
[+] score: 3
Mmu-miR-574-5p, mmu-miR-1187 and mmu-Mir-466i-5p are miRNAs identified in mice. [score:1]
Has-miR-574-5p is a miRNA identified in humans. [score:1]
Figure 5 Alignment of tgo-miR-574 sequence with homologues from other organisms. [score:1]
[1 to 20 of 3 sentences]
65
[+] score: 3
34 hsa-miR-335 −0.35hsa-miR-345 [44], [53], [71] 1.16 hsa-miR-363 0.99 hsa-miR-371-5p 0.55 hsa-miR-421 0.50 hsa-miR-483-5p 1.33 hsa-miR-494 0.87 hsa-miR-505* −0.40 hsa-miR-513a-5p 1.06 hsa-miR-513b 1.19 hsa-miR-513c 1.22 hsa-miR-551b −0.40 hsa-miR-574-5p 0.97hsa-miR-630 [68], [73] 0.96 hsa-miR-769-5p −0.34 hsa-miR-801 0.66 hsa-miR-873 −0.64 hsa-miR-877* 0.72 hsa-miR-923 0.89 hsa-miR-940 0.49 hsa-miR-95 −0.44 hsa-miR-99a −0.64Irradiated and non-irradiated PBL of the same donors were incubated in static gravity (1 g) for 4 and 24 h, and miRNA expression profile was analyzed at the end of each incubation time. [score:3]
[1 to 20 of 1 sentences]
66
[+] score: 3
The 96 differentially expressed microRNAs of this study included microRNAs such as miR-17 [9] and miR-574-5p [62], but not miR-27b [8] or miR-155 [11], serum or plasma levels for all of which have been associated with presence of lung cancer. [score:3]
[1 to 20 of 1 sentences]
67
[+] score: 3
Additionally, prior studies from various mo dels of retinal degeneration identified over 300 differentially expressed miRNAs 63– 90, a total of 16 common miRNAs were identified (miR-1187, miR-125b-5p, miR-331-3p, miR466d-3p, miR-467f, miR-542-3p, miR-574-5p, miR654-3p, miR669h-3p, miR-882, miR-342-3p, miR-466a-5p, miR-466d-5p, miR-706, miR-345-3p, miR532-5p). [score:3]
[1 to 20 of 1 sentences]
68
[+] score: 3
Post-transcriptionally, PHF6 mRNA is targeted by as many as 25 microRNAs, including miR-20a, miR-26a, miR-128, and miR-574 [20, 24, 25]. [score:3]
[1 to 20 of 1 sentences]
69
[+] score: 3
miRNA Fold change at 3 dpi Fold change at 5 dpi mmu-miR-466h-3p NS (Not significant) 14.311053 mmu-miR-346-5p NS 3.4766614 mmu-miR-877-3p NS 3.416667 mmu-miR-7a-5p NS 2.1413074 mmu-miR-5107-5p NS −2.047792 mmu-miR-3473a −2.2872427 −2.1317267 mmu-miR-150-5p NS −2.1770155 mmu-miR-3473b −3.2475147 −2.282881 mmu-miR-721 NS −2.6864858 mmu-miR-669b-5p NS −2.9408455 mmu-miR-709 NS −3.0065749 mmu-miR-669n NS −3.0094464 mmu-miR-468-3p NS −3.40051 mmu-miR-466m-5p NS −4.33538 mmu-miR-32-3p NS −4.5324426 mmu-miR-466h-5p NS −4.9673104 mmu-miR-3082-5p NS −6.01648 mmu-miR-466i-5p NS −7.6776285 mmu-miR-1187 NS −8.772696 mmu-miR-574-5p NS −9.259378 To confirm the validity of the differentially expressed miRNAs that had been identified by microarray analysis, we performed real-time PCR on all 20 of these miRNAs using the polyA tailing technique. [score:3]
[1 to 20 of 1 sentences]
70
[+] score: 3
Furthermore, luciferase activity assay showed that rs1057035 variant C allele led to significantly lower expression levels of DICER as compared to the T allele, which may be due to the higher inhibition of hsa-miR-574-3p on DICER mRNA. [score:3]
[1 to 20 of 1 sentences]
71
[+] score: 3
There are 6 miRNAs common to the three LIM1863-dervided EVs - let-7a-3p*, let-7f-1-3p*, miR-451a, miR-574-5p*, miR-4454 and miR-7641 and 6 exosome miRNAs that enable discrimination between sMVs (miR-320a/b/c/d, miR-221-3p, and miR-200c-3p); we also report one miRNA (miR-98-5p) observed in sMVs but not in A33- or EpCAM-Exos. [score:1]
Overall, in the enriched 63 miRNA dataset we observe 12 certain miRNA* sequences, three of which (let-7a-3p*, let-7f-1-3p*, miR-574-5p*), are highly represented in all EV subpopulations (Table 2 ). [score:1]
There are only 6 miRNA sequences common to all three EV subtypes, including three ‘passenger strand’ miRNAs (miRNA* sequences) (miR-451a, miR-4454, miR-7641, let-7a-3p*, let-7f-1-3p* and miR-574-5p*). [score:1]
[1 to 20 of 3 sentences]
72
[+] score: 3
In addition, expression patterns of miR-574-3p, miR-574-5p, miR-744*, miR-30a, miR-30d, miR-205 and miR-532-3p are also inconsistent with our results 29. [score:3]
[1 to 20 of 1 sentences]
73
[+] score: 2
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-20a, hsa-mir-21, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-99a, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-106a, hsa-mir-16-2, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-10a, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-204, hsa-mir-205, hsa-mir-181a-1, hsa-mir-216a, hsa-mir-217, hsa-mir-223, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-142, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-146a, hsa-mir-149, hsa-mir-150, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-181b-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-200a, hsa-mir-101-2, hsa-mir-26a-2, hsa-mir-365a, hsa-mir-365b, hsa-mir-370, hsa-mir-375, hsa-mir-378a, hsa-mir-148b, hsa-mir-335, hsa-mir-133b, hsa-mir-451a, hsa-mir-146b, hsa-mir-494, hsa-mir-193b, hsa-mir-181d, hsa-mir-92b, hsa-mir-605, hsa-mir-33b, hsa-mir-378d-2, hsa-mir-216b, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-378b, hsa-mir-378c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-451b, hsa-mir-378j
These 12 microRNAs (let-7a-5p, miR-182-5p, miR-191-5p, miR-200c-3p, miR-21-5p, miR-25-3p, miR27b-3p, miR-30a-5p, miR-30c-2-5p & -1-5p, miR-30d-5p, miR-375-3p, and miR-574-3p) [51] are all immune-related and they regulate immune response genes and proteins [140]. [score:2]
[1 to 20 of 1 sentences]
74
[+] score: 2
The results showed that miR-574 did not affect HCC cell migration (Supplementary Figure 1A). [score:1]
Notably, six miRNAs (miR-489, miR-194–3p, miR-200a-3p, miR-30e-3p, miR-192, and miR-574–3p) were identically decreased in both our microarrays and The Cancer Genome Atlas (TCGA) dataset (Supplementary Table 1, Figure 1B). [score:1]
[1 to 20 of 2 sentences]
75
[+] score: 2
miRNA Sequence miR-574-5pUGA GUGUGUGUGUGUGA GUGUGU miR-941CACCCGGCU GUGUGCACAU GUGC miR-3149UUU GUAUGGAUAU GUGUGUGUAU miR-1238-5p GUGA GUGGGAGCCCCA GUGUGUG miR-545-3pUCAGCAAACAUUUAU UGUGUGC miR-2278GAGAGCA GUGUGUGUUGCCUGG miR-3148UGGAAAAAACUG GUGUGUGCUU let-7b-5pUGAG GUA GUAG GUU GUGUG GUU miR-493-3pUGAAG GUCUACU GUGUGCCAGG miR-1180UUUCCGGCUCGC GUGG GUGUGU miR-539-5pGGAGAAAUUAUCCUUG GUGUGU miR-32-3pCAAUUUA GUGUGUGUGAUAUUU miR-206UGGAAU GUAAGGAA GUGUGUGG miR-1299UUCUGGAAUUC UGUGUGAGGGA miR-3911U GUGUGGAUCCUGGAGGAGGCA miR-297AUGUAU GUGUGCAU GUGCAUG miR-610UGAGCUAAAU GUGUGCUGGGA miR-1228-5p GUGGGCGGGGGCAG GUGUGUG miR-595GAA GUGUGCC GUG GUGUGUCU miR-4455AGG GUGUGUGUGUUUUU miR-3650AG GUGUGUCU GUAGA GUCC miR-147a GUGUGUGGAAAUGCUUCUGC miR-660-3pACCUCCU GUGUGCAUGGAUUAInterestingly, most of the trinucleotide repeats contain base “U” and “G”, although it can be noticed that this type of SSR is less represented. [score:1]
miRNA Sequence miR-574-5pUGA GUGUGUGUGUGUGA GUGUGU miR-941CACCCGGCU GUGUGCACAU GUGC miR-3149UUU GUAUGGAUAU GUGUGUGUAU miR-1238-5p GUGA GUGGGAGCCCCA GUGUGUG miR-545-3pUCAGCAAACAUUUAU UGUGUGC miR-2278GAGAGCA GUGUGUGUUGCCUGG miR-3148UGGAAAAAACUG GUGUGUGCUU let-7b-5pUGAG GUA GUAG GUU GUGUG GUU miR-493-3pUGAAG GUCUACU GUGUGCCAGG miR-1180UUUCCGGCUCGC GUGG GUGUGU miR-539-5pGGAGAAAUUAUCCUUG GUGUGU miR-32-3pCAAUUUA GUGUGUGUGAUAUUU miR-206UGGAAU GUAAGGAA GUGUGUGG miR-1299UUCUGGAAUUC UGUGUGAGGGA miR-3911U GUGUGGAUCCUGGAGGAGGCA miR-297AUGUAU GUGUGCAU GUGCAUG miR-610UGAGCUAAAU GUGUGCUGGGA miR-1228-5p GUGGGCGGGGGCAG GUGUGUG miR-595GAA GUGUGCC GUG GUGUGUCU miR-4455AGG GUGUGUGUGUUUUU miR-3650AG GUGUGUCU GUAGA GUCC miR-147a GUGUGUGGAAAUGCUUCUGC miR-660-3pACCUCCU GUGUGCAUGGAUUA Interestingly, most of the trinucleotide repeats contain base “U” and “G”, although it can be noticed that this type of SSR is less represented. [score:1]
[1 to 20 of 2 sentences]
76
[+] score: 2
It is important to note that Othumpangat et al. (2012) also identified miR-574 (repressed −0.5-fold relative to mock-infected cells) as a regulator of NGF, although its impact on virus replication was not studied. [score:2]
[1 to 20 of 1 sentences]
77
[+] score: 2
06 hsa-miR-595 5.29 hsa-miR-92b −9.97 hsa-miR-601 5.88 hsa-miR-765 4.47 hsa-miR-98 5.05 hsa-miR-99a 6.41 TGF-β -treated hsa-miR-20b −1.29 hsa-let-7a 1.38 hsa-miR-221 −1.25 hsa-let-7d 1.43 hsa-miR-605 −4.64 hsa-let-7e 2 hsa-miR-638 −1.40 hsa-miR-125a-5p 2.87 hsa-miR-663 −2.06 hsa-miR-146a 2.72 hsa-miR-720 −2.40 hsa-miR-21 1.14 hsa-miR-23a 1.20 hsa-miR-23b 1.14 hsa-miR-30c 1.89 hsa-miR-483-5p 1.38 hsa-miR-574-5p 2.23 hsa-miR-99b 1.63 10.1371/journal. [score:1]
06 hsa-miR-595 5.29 hsa-miR-92b −9.97 hsa-miR-601 5.88 hsa-miR-765 4.47 hsa-miR-98 5.05 hsa-miR-99a 6.41 TGF-β -treated hsa-miR-20b −1.29 hsa-let-7a 1.38 hsa-miR-221 −1.25 hsa-let-7d 1.43 hsa-miR-605 −4.64 hsa-let-7e 2 hsa-miR-638 −1.40 hsa-miR-125a-5p 2.87 hsa-miR-663 −2.06 hsa-miR-146a 2.72 hsa-miR-720 −2.40 hsa-miR-21 1.14 hsa-miR-23a 1.20 hsa-miR-23b 1.14 hsa-miR-30c 1.89 hsa-miR-483-5p 1.38 hsa-miR-574-5p 2.23 hsa-miR-99b 1.63 10.1371/journal. [score:1]
[1 to 20 of 2 sentences]
78
[+] score: 1
Specifically, miR-574-3p and miR-18b ranked high in both comparisons. [score:1]
[1 to 20 of 1 sentences]
79
[+] score: 1
Other miRNAs from this paper: hsa-mir-105-1, hsa-mir-105-2, hsa-mir-126, hsa-mir-660
Functional classification of these biomarkers includes growth and proliferation (Ki-67, survivin, NGAL), invasion and metastasis (p53, MMP-9, SK1, DcR3, COX2, EZH2, microRNAs miR-105, and miR126), epithelial–mesenchymal transition (EMT) (WNT5A/B, Pea3), immune response (PD-L1), therapy resistance (HER2Δ16, pSTS3, KLK10), survival (miR-574-3p, miR-660-5p, PIWIL3, PIWIL4), and many others (35). [score:1]
[1 to 20 of 1 sentences]
80
[+] score: 1
miRNA name Nuclear %Conservation [∗] hsa-miR-768-5pˆ 94.17 n/a hsa-miR-768-3pˆ 93.71 n/a hsa-miR-1299 93.17 No (hsa, ptr, ppy) hsa-miR-297 92.72 Yes hsa-miR-663b 92.17 No (hsa, ptr, ppy, oga, bta) hsa-miR-647 89.19 No (hsa, ppy) hsa-miR-595 88.09 No (hsa, ptr, mml, ppy) hsa-miR-921 83.82 No (hsa, ppy, efu)hsa-miR-593 [∗] 80.62 No (hsa, ptr, mml, ppy) hsa-miR-1183 78.28 No (hsa, ptr, ppy)hsa-miR-664 [∗] 75.44 Yes hsa-miR-1275 73.87 No (hsa, ptr, ppy) hsa-miR-574-5p 71.94 Yes [∗] Species identifiers: hsa, Homo sapiens; ptr, Pan troglodytes; mml, Macaca mulatta; ppy, Pongo pygmaeus; efu, Eptesicus fuscus; Bta, Bos Taurus; oga, Otolemur garnettii. [score:1]
[1 to 20 of 1 sentences]
81
[+] score: 1
Other miRNAs from this paper: hsa-mir-96, hsa-mir-10a, hsa-mir-183
Connections to the epigenetic machinery are further suggested by the identification of five age -modified CpG sites in genes encoding microRNAs: three age-methylated sites in MIR219-2, MIR183/MIR96 and MIRLET7A3/ MIRLET7B and two age-demethylated sites in MIR10A and MIR574 (Additional file 1). [score:1]
[1 to 20 of 1 sentences]
82
[+] score: 1
miRNA △△Ct2 [−] [△△Ct] hsa-miR-1290 −10.05 1063.66 hsa-miR-1275 −9.36 655.36 hsa-miR-1260 −9.25 609.09 hsa-miR-574-3p −4.49 22.48 hsa-miR-454 −4.45 21.93 hsa-miR-148a −4.38 20.85 hsa-miR-539 −4.36 20.57 hsa-miR-223 −4.27 19.29 hsa-miR-142-5p −4.27 19.26 hsa-miR-485-3p −4.21 18.56 hsa-miR-548c-5p −4.13 17.56 hsa-miR-17 −4.12 17.41 hsa-miR-484 −4.10 17.17 hsa-miR-652 −4.09 17.01 hsa-miR-660 −4.07 16.78 hsa-miR-20b −4.06 16. [score:1]
[1 to 20 of 1 sentences]
83
[+] score: 1
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-21, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-30a, hsa-mir-31, hsa-mir-98, hsa-mir-99a, hsa-mir-101-1, hsa-mir-16-2, hsa-mir-192, hsa-mir-197, hsa-mir-199a-1, hsa-mir-208a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-187, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-211, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-138-2, hsa-mir-140, hsa-mir-142, hsa-mir-143, hsa-mir-144, hsa-mir-145, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-138-1, hsa-mir-146a, hsa-mir-200c, hsa-mir-155, hsa-mir-128-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-101-2, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-99b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-375, hsa-mir-328, hsa-mir-337, hsa-mir-338, hsa-mir-339, hsa-mir-384, hsa-mir-424, hsa-mir-429, hsa-mir-449a, hsa-mir-485, hsa-mir-146b, hsa-mir-494, hsa-mir-497, hsa-mir-498, hsa-mir-520a, hsa-mir-518f, hsa-mir-499a, hsa-mir-509-1, hsa-mir-582, hsa-mir-606, hsa-mir-629, hsa-mir-449b, hsa-mir-449c, hsa-mir-509-2, hsa-mir-874, hsa-mir-744, hsa-mir-208b, hsa-mir-509-3, hsa-mir-1246, hsa-mir-1248, hsa-mir-219b, hsa-mir-203b, hsa-mir-499b
Of most interest are miRNAs: let-7f, let-7i, miR-24, miR-26b, miR-27a, miR-221, miR-30b, miR-337, miR-339-5p, miR-453, miR-520a, miR-574, and miR-744. [score:1]
[1 to 20 of 1 sentences]
84
[+] score: 1
Monitoring urinary levels of miR-107 and miR-574-3p could also be relevant in PCa diagnosis [94]. [score:1]
[1 to 20 of 1 sentences]
85
[+] score: 1
These effects are related to the ability of PTCSC3 to bind hsa-miR-574-5p as ceRNA [62]. [score:1]
[1 to 20 of 1 sentences]
86
[+] score: 1
However, it has also been reported that UG repeats are neither necessary nor sufficient for TDP-43 binding (159) and that TDP-43 cannot bind to UG repeats in the dsRNA region of pre-miR-574. [score:1]
[1 to 20 of 1 sentences]
87
[+] score: 1
The relatively abundant miR-152, miR-195, miR-16, miR-30c, miR-223, miR-126, miR-574-3p, miR-21, and miR125b were found to be the most repressed by the bacteria (Table 1). [score:1]
[1 to 20 of 1 sentences]
88
[+] score: 1
In a study of Tan et al. identified miR-574-5p in serum provided high diagnostic accuracy for chronic hepatitis B with persistently normal alanine aminotransferase [74]. [score:1]
[1 to 20 of 1 sentences]
89
[+] score: 1
Previous studies have identified various miRNAs in NSCLC patients, including Let-7a, miR-145-3p, miR-30d, miR-499, miR-374a, miR-1254, miR-574-5p, miR-126, miR-210, miR-21 and so on [8]. [score:1]
[1 to 20 of 1 sentences]
90
[+] score: 1
After a series of selection processes independently with enter method and conditional forward method in conditional logistic regression, we found nine statistically significant miRNAs in enter method, namely, miR574-3p, miR422a, miR490-3p, miR-374b, miR-133a, let7g, miR-378*, miR-9* and miR-378i. [score:1]
[1 to 20 of 1 sentences]
91
[+] score: 1
miRNAs were normalized to the average of three different miRNAs miR-147, miR-574-3p and miR-1469. [score:1]
[1 to 20 of 1 sentences]
92
[+] score: 1
miR-1254 and miR-574-5p Serum-Based microRNA Biomarkers for Early-Stage Non-small Cell Lung Cancer. [score:1]
[1 to 20 of 1 sentences]
93
[+] score: 1
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-mir-18a, hsa-mir-21, hsa-mir-23a, hsa-mir-26a-1, hsa-mir-30a, hsa-mir-99a, hsa-mir-103a-2, hsa-mir-103a-1, mmu-mir-1a-1, mmu-mir-23b, mmu-mir-30a, mmu-mir-99a, mmu-mir-126a, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-138-2, hsa-mir-192, mmu-mir-204, mmu-mir-122, hsa-mir-204, hsa-mir-1-2, hsa-mir-23b, hsa-mir-122, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-138-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-126, hsa-mir-138-1, mmu-mir-192, mmu-let-7a-1, mmu-let-7a-2, mmu-mir-18a, mmu-mir-21a, mmu-mir-23a, mmu-mir-26a-1, mmu-mir-103-1, mmu-mir-103-2, hsa-mir-1-1, mmu-mir-1a-2, mmu-mir-26a-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-138-1, hsa-mir-26a-2, hsa-mir-376c, hsa-mir-381, mmu-mir-381, mmu-mir-133a-2, rno-let-7a-1, rno-let-7a-2, rno-mir-9a-1, rno-mir-9a-3, rno-mir-9a-2, rno-mir-18a, rno-mir-21, rno-mir-23a, rno-mir-23b, rno-mir-26a, rno-mir-30a, rno-mir-99a, rno-mir-103-2, rno-mir-103-1, rno-mir-122, rno-mir-126a, rno-mir-133a, rno-mir-138-2, rno-mir-138-1, rno-mir-192, rno-mir-204, mmu-mir-411, hsa-mir-451a, mmu-mir-451a, rno-mir-451, hsa-mir-193b, rno-mir-1, mmu-mir-376c, rno-mir-376c, rno-mir-381, hsa-mir-652, hsa-mir-411, bta-mir-26a-2, bta-mir-103-1, bta-mir-16b, bta-mir-18a, bta-mir-21, bta-mir-99a, bta-mir-126, mmu-mir-652, bta-mir-138-2, bta-mir-192, bta-mir-23a, bta-mir-30a, bta-let-7a-1, bta-mir-122, bta-mir-23b, bta-let-7a-2, bta-let-7a-3, bta-mir-103-2, bta-mir-204, mmu-mir-193b, mmu-mir-574, rno-mir-411, rno-mir-652, mmu-mir-1b, hsa-mir-103b-1, hsa-mir-103b-2, bta-mir-1-2, bta-mir-1-1, bta-mir-133a-2, bta-mir-133a-1, bta-mir-138-1, bta-mir-193b, bta-mir-26a-1, bta-mir-381, bta-mir-411a, bta-mir-451, bta-mir-9-1, bta-mir-9-2, bta-mir-376c, bta-mir-1388, rno-mir-9b-3, rno-mir-9b-1, rno-mir-126b, rno-mir-9b-2, hsa-mir-451b, bta-mir-574, bta-mir-652, mmu-mir-21b, mmu-mir-21c, mmu-mir-451b, bta-mir-411b, bta-mir-411c, mmu-mir-126b, rno-mir-193b, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
Two orthologous miRNAs (bta-miR-574-3p and -652) were detected more than two times and in at least two different tissues but were not mapped to the bovine genome (ucsc_btau4) (Additional file 3). [score:1]
[1 to 20 of 1 sentences]
94
[+] score: 1
Examples include, but not limited to, mir-574-3p and prostate cancer [38], mir-23a and gastric cancer [39], mir-21 and colon cancer [40]. [score:1]
[1 to 20 of 1 sentences]
95
[+] score: 1
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-92a-1, hsa-mir-93, hsa-mir-98, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-192, hsa-mir-196a-1, hsa-mir-197, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-182, hsa-mir-183, hsa-mir-196a-2, hsa-mir-205, hsa-mir-181a-1, hsa-mir-221, hsa-mir-222, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-137, hsa-mir-140, hsa-mir-141, hsa-mir-143, hsa-mir-145, hsa-mir-152, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-146a, hsa-mir-150, hsa-mir-194-1, hsa-mir-206, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-128-2, hsa-mir-194-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-200a, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-26a-2, hsa-mir-372, hsa-mir-374a, hsa-mir-375, hsa-mir-328, hsa-mir-133b, hsa-mir-20b, hsa-mir-429, hsa-mir-449a, hsa-mir-486-1, hsa-mir-146b, hsa-mir-494, hsa-mir-503, hsa-mir-628, hsa-mir-630, hsa-mir-449b, hsa-mir-449c, hsa-mir-708, hsa-mir-301b, hsa-mir-1827, hsa-mir-486-2
Not only, miR-1254 and miR-574-5p increased serum levels were able to discriminate early-stage NSCLC samples from controls with over 70% sensitivity and specificity, in two separate cohorts [211]. [score:1]
[1 to 20 of 1 sentences]
96
[+] score: 1
Peng et al. constructed a serum ncRNA panel (miR-1254, miR-485-5p, miR-574-5p, and lncRNA MALAT1), and tested whether the ncRNA panel could distinguish NSCLC patient samples from controls. [score:1]
[1 to 20 of 1 sentences]