sort by

29 publications mentioning hsa-mir-615

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-615. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 220
Other miRNAs from this paper: hsa-mir-483, hsa-mir-1207, hsa-mir-1266
Consistent with this hypothesis, overexpression of mouse HoxC5 is able to suppress hTERT expression in HeLa cells (Supplementary Fig.   12b), while overexpression of miR-615-3p or mouse HOXC5 in mouse cells does not affect the expression of mTERT (Supplementary Fig.   12c–n). [score:11]
In addition, overexpression of HOXC5 and miR-615-3p in human cancer cells significantly inhibits hTERT expression and suppresses cancer cell growth both in vitro and in vivo. [score:9]
As expected, we observed an increase in miR-615-3p levels in PC-3 cells transduced with lentivirus expressing mir- 615- 3p alone or co -expressing HOXC5 and mir- 615- 3p (Supplementary Fig.   14a), as well as increased HoxC5 levels in PC-3 cells transduced with lentivirus expressing HOXC5 alone or co -expressing HOXC5 and mir- 615- 3p (Supplementary Fig.   14b). [score:9]
In contrast, overexpression of HOXC5 significantly suppressed the ability of PC-3 cells to form colonies in vitro, and co -expression of HoxC5 and miR-615-3p further reduced the size of colonies without significantly affecting their number. [score:7]
miR-615-3p is a novel negative regulator of hTERT expressionMicroRNAs often regulate gene expression via 3′UTRs [29]. [score:7]
Taken together, these data suggest that miR-615-3p suppresses endogenous hTERT expression by targeting the 3′UTR of hTERT. [score:7]
HoxC5 inhibits the expression of hTERT in cancer cellsThe mir- 615 is located within intron 1 of the HOXC5 gene (Fig.   3a), and the transcription of HOXC5 is accompanied by the expression of miR-615 [34]. [score:7]
Our data indicated that miR-615-3p negatively regulates hTERT expression by targeting hTERT 3′UTR. [score:6]
Consistent with the observation that the expression of HOXC5 and miR-615 is co-regulated [34], we also observed strong positive correlation between the expression of HOXC5 and miR-615-3p (Fig.   7h–k) in THYM and TGCT. [score:6]
OE overexpression To further investigate the function of miR615-3p in regulating endogenous hTERT expression, we compared the expression profile of hTERT mRNA and miR-615-3p in NCI-60 cell lines. [score:5]
Further, transient transfection of the miR-615-3p hairpin inhibitor into these two cell lines led to a significant increase in hTERT mRNA expression and a corresponding increase in telomerase activity (Fig.   2d, e). [score:5]
In contrast, overexpression of miR-615-3p or mHOXC5 does not affect the expression endogenous mTERT in three different mouse cell lines (Supplementary Fig.   12c–n). [score:5]
These results suggest that miR-615-3p only plays a fine-tuning role 56, 57 in modulation of hTERT expression, while HoxC5 plays the key role in hTERT suppression. [score:5]
d, e Relative hTERT mRNA expression and telomerase activity in HOP-92 and RXF393 cells transiently transfected with control hairpin or miR-615-3p inhibitor. [score:5]
In addition, two of the miRNA hairpin inhibitors, targeting miR-483-3p and miR-615-3p, also dramatically increased endogenous hTERT mRNA levels and telomerase activity in HeLa cells (Fig.   1h, i). [score:5]
Our results indicate that both miR-615-3p and HoxC5, expressed from the same locus, repress hTERT expression during stem cell differentiation. [score:5]
Inactivation of miR-615 expression does not affect the expression of endogenous HOXC5 (Supplementary Fig.   5c, d). [score:5]
Further, overexpression of miR-615-3p and HoxC5 suppress cancer cell growth both in vitro and in vivo in mouse xenograft mo del. [score:5]
OE overexpressionTo further investigate the function of miR615-3p in regulating endogenous hTERT expression, we compared the expression profile of hTERT mRNA and miR-615-3p in NCI-60 cell lines. [score:5]
These results suggest that miR-615-3p negatively regulates hTERT by targeting this region within the 3′UTR. [score:4]
miR-615-3p is a novel negative regulator of hTERT expression. [score:4]
h Loss of endogenous miR-615-3p expression in two independent/Cas9 -mediated mir- 615- 3p knockout R KO cell lines. [score:4]
Interestingly, previous studies revealed that miR-615-3p level is low in pluripotent stem cells and increases dramatically upon differentiation 30, 31, which is directly opposite to hTert expression in differentiated cells. [score:4]
Together, our data suggest that miR-615-3p and HoxC5 form a feed-forward loop to negatively regulate hTERT mRNA expression, telomerase activity and telomere elongation. [score:4]
Fig. 2The miR-615-3p negatively regulates hTERT expression in cancer cells. [score:4]
To further confirm the function of miR-615-3p in the regulation of hTERT expression, we utilized the/Cas9 system to introduce small deletion in the region of the mir- 615 hairpin that is crucial for its maturation. [score:4]
Understanding how miR-615-3p and HoxC5 mediate the cell-specific repression of hTERT and its implication in telomerase activation in human cancers can provide new avenues and targets for anti-cancer therapy. [score:3]
Consistent with these results, overexpression of miR-615-3p further decreased Renilla/Firefly luciferase luminescence ratio in HeLa cells transfected with psiCHECK2-5′ + 3′UTR, but not psiCHECK2-5′ + 3′UTR-M2 (Supplementary Fig.   3a). [score:3]
We observed a significant reduction of hTERT mRNA levels and telomerase activity when miR-615-3p was overexpressed in these cell lines (Fig.   2f, g). [score:3]
We used miRWalk 2.0 [33] to identify potential miR-615-3p target site in the hTERT 3′UTR (Fig.   2a). [score:3]
As expected, R KO- KO-1 and R KO- KO-2 displayed loss of miR-615-3p expression (Fig.   2h), and increased hTERT mRNA levels and telomerase activity (Figs.   2i, j), relative to parental R KO cells. [score:3]
For quantification of miR-615-3p expression, total RNAs were isolated using Trizol (Thermo Scientific). [score:3]
Tumor growth curve (c) representing images (d), and tumor weight (e) showed growth of xenograft tumors in NSG mice injected with PC-3 cells expressing GFP, mir- 615- 3p, HOXC5 or both HOXC5 and mir-615-3p in vivo. [score:3]
Thus, miR-615-3p represses endogenous hTERT expression in various cancer cell lines. [score:3]
Fig. 4Expression of hTERT, miR-615-3p, HOXC5, PBX1–4, and MEIS1–3 in WA01 human ES cells upon neural induction. [score:3]
To study the potential role of miR-615-3p and HoxC5 in cancer cell proliferation, we transduced PC-3 cells with lentivirus expressing GFP, HOXC5, or mir- 615- 3p alone, or HOXC5 and mir- 615- 3p in combination. [score:3]
HOXC5 and miR-615-3p inhibit cancer cell growth. [score:3]
The mir- 615 is located within intron 1 of the HOXC5 gene (Fig.   3a), and the transcription of HOXC5 is accompanied by the expression of miR-615 [34]. [score:3]
However, we did not observe significant negative correlation between the expression of miR-615-3p and hTERT (Fig.   7g–j). [score:3]
The single-stranded oligo (5′-CGGCTGAAGGCTGAGTGTCCGGCTGAGGCCTGAGCGAGTGTCCAGCCAAGGGCTGAGTGTCCAGCACACCTGCCGTCTTCACTTCCCCACTCCGTGGCCGAGCCCTCCACCCCAGGGCCAGCTTTTCCTCACCAGGAGCCCGGCTTCCACTCCCCACATAGGAATAGTCCATCCCCAGATTCGCCATTGTTCACC-3′) is used as template for knockin mutation of miR-615-3p binding site in the hTERT 3′UTR. [score:3]
Other potential targets of miR-615-3p were predicted using the microT-CDS algorithm (Supplementary Table  1). [score:3]
The miR-615-3p hairpin region was subjected to potential sgRNA target search using the online software created by Feng Zhang’s group (http://crispr. [score:3]
HOXC5 and miR-615-3p inhibit cancer cell growthWe further analyzed genome-wide endogenous HoxC5 -binding sites using Genomic Regions Enrichment of Annotations Tool (GREAT) and uncovered an over-representation of GO terms pertaining to cellular differentiation, including the TGF-β pathway 50, 51 (Fig.   6f). [score:3]
b Schematic representation of mutations introduced at the predicted miR-615-3pbinding site in psiCHECK2-5′ + 3′UTR reporter vector. [score:2]
As shown in Supplementary Fig.   5a and 5b, clonal-derived R KO cells harboring biallelic deletions or mutations in the miR-615-3p -binding site displayed increased hTERT mRNA levels, but not in the cells harboring deletions outside the miR-615-3p -binding site. [score:2]
Here we have identified roles for HoxC5 and miR-615-3p in the negative regulation of hTERT in cancer cells and during differentiation of pluripotent stem cells. [score:2]
a Schematic representation of the predicted binding site of miR-615-3p within TERT 3′UTR across different species. [score:1]
Both miR-615-3p and Hox family proteins are well-conserved in mammals: human and mouse miR-615-3p have identical mature sequence and the identity between human and mouse HoxC5 is 99.5% (Supplementary Fig.   12a). [score:1]
Our data suggest that HoxC5 and miR-615-3p repress hTERT via an upstream enhancer region and 3′UTR, respectively. [score:1]
Reverse transcription of miR-615-3p and RNU6B (for normalization) was conducted using the TaqMan® MicroRNA reverse transcription kit (Thermo Scientific) followed by PCR using TaqMan® Fast Universal PCR Master Mix (2×), according to the manufacturer’s instructions. [score:1]
While HoxC5 and miR-615-3p are very well-conserved between human and mouse (identity = 99.5% and 100% respectively), the TERT 3′UTR and upstream enhancer regions are conserved in long-lived mammals such as chimpanzee and macaque, but not in short-lived mammals such as mouse and rat. [score:1]
TGCT testicular germ cell tumor; THYM thymoma We established xenograft mo dels to further validate the effects of miR-615-3p and HoxC5 on cancer cell growth in vivo. [score:1]
c miR-615-3p (d) and HOXC5 mRNA (e), during neural differentiation (passage 0–4) in WA01 cells was quantified by real-time RT-PCR as indicated. [score:1]
This BAC contains the 3′UTR and upstream enhancer regions that we identified, and we propose that mouse miR-615-3p and HoxC5 repress hTERT via these elements. [score:1]
Importantly, we observed a dramatic increase in both miR-615-3p (Fig.   4d and Supplementary Fig.   6c) and HOXC5 mRNA levels (Fig.   4e and Supplementary Fig.   6d), which plateaued around P2–P4. [score:1]
Here we show that the induction of HOXC5 and miR-615-3p during stem cell differentiation represses hTERT via transcriptional and post-transcriptional pathways, respectively. [score:1]
We found that HOP-92 and RXF393 cells displayed high levels of miR-615-3p but low levels of hTERT mRNA (Supplementary Fig.   3b). [score:1]
Scatterplots showing Spearman correlation between hTERT and HOXC5 (f, i); miR-615-3p and hTERT (g, j); HOXC5 and miR-615-3p (h, k) in THYM (top) and TGCT (bottom) cancer samples. [score:1]
In contrast, RPMI-8226, IGR-OV1 and HCC-2998 cells have low levels of miR-615-3p and high levels of hTERT mRNA (Supplementary Fig.   3b). [score:1]
TGCT testicular germ cell tumor; THYM thymomaWe established xenograft mo dels to further validate the effects of miR-615-3p and HoxC5 on cancer cell growth in vivo. [score:1]
The precursors of hsa-miR-615-3p plus upstream and downstream flanking sequences (total approximating 600 base pairs) were amplified from human genomic DNA isolated from WA01 cells. [score:1]
Flag-HOXC5, HOXC5 M1, HOXC5 M2, PBX1, PBX2, PBX3, PBX4, and V5-HOXC5, MEIS1, MEIS2, MEIS3, and GFP-miR-615-3p were constructed using pHR’CMVGFPIRESHygroWSin18 and HR’CMVGFPIRESPuro3WSin18 based lentivector [60]. [score:1]
[1 to 20 of 62 sentences]
2
[+] score: 190
Although the expression of Hoxc5 during axial patterning is likely to result in production of miR-615-3p and may account for some of the observed expression, axial Hox gene expression is initiated prior to E9.5 [47] and is unlikely to explain the upregulation of the miRNA in between E9.5 and E12.5. [score:10]
Expression of miR-615 can occur independently from Hoxc5Comparing the expression patterns of mir- 615 and those of Hoxc5 would help test whether expression of mir- 615 is solely driven by its host transcription unit, or whether there is independent regulation of this intronic miRNA. [score:8]
For each target above the cut-off, we ascertained expression levels in tissues known to express miR-615 (kidney, testis, ovary and cerebellum). [score:7]
miR-615-3p is also one of five Hox cluster miRNAs significantly upregulated in the prefrontal cortex in patients with Huntington’s Disease [45]. [score:6]
Finally, we carry out target predictions for the dominant 3p product of miR-615 and compare these to expression domains to suggest likely in vivo functions of this miRNA, and how these contributed to the evolution and development of mammals. [score:6]
There are no instances of HOXC5 expression without concurrent expression of miR-615 in all the cell lines surveyed. [score:5]
The observation that ovaries from newborn mice express miR-615-3p at a relatively high level [48] suggests that some of this may result from ovarian expression of miR-615. [score:5]
Dominance of the 3p arm is observed in all cases where we have observed expression of mir- 615, hence we undertook target prediction analysis for miR-615-3p against all known human cDNAs (Additional file 9: Supplement S9). [score:5]
We also find that GO terms associated with regulation of growth and development are overrepresented by in a high stringency target prediction dataset for miR-615-3p. [score:5]
This observation, coupled with the high expression of miR-615-3p in the mouse embryo, suggests a potential role for miR-615-3p in the regulation of growth and development during embryogenesis. [score:5]
Identifying likely targets for miR-615, integrated with the expression pattern data presented above, would contribute to our understanding of how this miRNA contributes to eutherian biology and evolution. [score:5]
Out of the 36 cell lines and tissue types used to survey miR-615 expression, 34 also had available RNA-seq data (Additional file 5: Supplement S5), which we analysed to study expression of HOXC5. [score:5]
While the observation that miR-615 is strongly upregulated in goat ovaries during pregnancy [27] is striking, these data come from a single biological replicate and should be interpreted with caution. [score:4]
miR-615 is also amongst the 10 miRNAs which are most upregulated upon differentiation of human embryonic stem cells [46]. [score:4]
Our analysis of data from Chiang et al. indicates that whole-body expression of miR-615 increases throughout mouse embryonic development and persists in the newborn [21]. [score:4]
Target prediction data support the involvement of miR-615 in growth and developmental pathways. [score:4]
Minimum free energies for all species tested are listed in Additional file 4 Using small RNA deep sequencing data from the ENCODE project [26] obtained through the UCSC Genome Browser [17], we analysed miR-615 expression in 36 human cell lines and tissues (Additional file 5: Supplement S5). [score:3]
10.1186/s13227-015-0027-1 PITA prediction targets for miR-615-3p. [score:3]
We found evidence for simultaneous expression of both miR-615 and HOXC5 in several datasets, such as the adipose-derived hMSC-AT mesenchymal stem cell line and NHDF human dermal fibroblasts. [score:3]
However, it is notable that in many of the cell lines where miR-615 is found, including the lymphoblastoid cell line GM12878 and the leukaemia-derived K562 cell line, there is little to no expression of HOXC5. [score:3]
Fig.  4 Inferred position of the mir-615 promoter based on EST, CAGE, H3K4 trimethylation and DNase I hypersensitivity dataThe strongest indication of an independent promoter for mir- 615 comes from 5′ cap analysis of gene expression (CAGE) data, which identify potential initiation sites within the HOXC5 locus through the detection of 5′ capped RNA transcripts. [score:3]
Candidate targets for miR-615-3p. [score:3]
Our analysis of existing small RNA sequencing data in the mouse (obtained from [21]) reveals that miR-615 expression is detected in whole mouse embryos (Additional file 7: Supplement S7). [score:3]
Known tissues in which miR-615 expression is conserved in more than one eutherian species include the cerebellum, kidney and gonads. [score:3]
miR-615 is expressed in the majority of these datasets. [score:3]
Expression of miR-615 can occur independently from Hoxc5. [score:3]
Fig.  4 Inferred position of the mir-615 promoter based on EST, CAGE, H3K4 trimethylation and DNase I hypersensitivity data The strongest indication of an independent promoter for mir- 615 comes from 5′ cap analysis of gene expression (CAGE) data, which identify potential initiation sites within the HOXC5 locus through the detection of 5′ capped RNA transcripts. [score:3]
Target prediction for hsa-miR-615 was run using the downloadable executable for the PITA prediction algorithm [23] on all human cDNAs downloaded from Ensembl BioMart (genome assembly: GRCh38.p2). [score:3]
It is likely that in these contexts, miR-615-5p is acting as a tumour suppressor [36, 43] through interfering with the insulin- like growth factor 2 (IGF2) transcript. [score:3]
10.1186/s13227-015-0027-1 GO terms identified in the miR-615-3p target prediction dataset. [score:3]
A minority of cell lines lacked expression of miR-615, notably those with immune-related functions (CD14+, CD34+ and CD20+) as well as H1 embryonic stem cells, H1-neurons and HAoEC. [score:3]
miR-615 expression in mammalian cell lines and adult tissues. [score:3]
These data indicate that miR-615 is expressed in kidneys, cerebellum, testis and ovary (Additional file 6: Supplement S6B). [score:3]
In all cases where miR-615 is expressed, the miR-615-3p product is dominant. [score:3]
Using other deposited raw sequencing data sets, we then analysed the expression of miR-615 in five organs (cerebellum, cerebral cortex, heart, testis and kidney) in human and mouse [1], as well as ovary in goats [27] and sheep [28]. [score:3]
Using a data mining approach combining epigenetic studies with RNAseq and CAGE tag data, we show that miR-615 can be expressed under the control of a Hox gene promoter, as well as independently from its host gene transcript. [score:3]
Gao W, Gu Y, Li Z, Cai H, Peng Q, Tu M, Kondo Y, Shinjo K, Zhu Y, Zhang J, Sekido Y, Han B, Qian Z, Miao Y. miR-615-5p is epigenetically inactivated and functions as a tumor suppressor in pancreatic ductal adenocarcinoma. [score:3]
A study on the embryonic gonads of the sheep (Ovis aries) lends some weight to the hypothesis that miR-615 may be involved in gonadal differentiation [28], since the miRNA is identified as expressed at significantly higher levels (fold change ≥2) in ovaries at early gestation (42 days) than in mid-gestation. [score:3]
Another possibility is that miR-615 is involved in the modulation of embryonic growth; studies on human cancer cell lines have implicated this miRNA in the regulation of cell growth, proliferation and migration [36, 43]. [score:2]
The lack of either the stabilising mutations, or the lack of suitable selection pressure after the emergence of such a structure, would explain the absence of functional miR-615 in marsupials. [score:2]
To determine whether miR-615 is present in other amniotes, we searched for its precursor gene sequence in the genomes of other eutherians, plus a marsupial (Mono delphis domestica), a monotreme (Ornithorhynchus anatinus) and three non-mammalian vertebrates (chicken Gallus gallus, anole lizard Anolis carolinensis and zebrafish Danio rerio). [score:1]
Candidate miR-615 precursors fulfil structural and energetic criteria only in Eutheria. [score:1]
It is therefore likely that marsupials lack the ability to generate mature miR-615. [score:1]
The presence of functional miR-615 in eutherians and its absence from marsupials could be explained by either the acquisition of mir- 615 on the lineage leading to the Eutheria following its divergence from marsupials, or through acquisition of the miRNA in a common therian ancestor followed by its lineage-specific loss in marsupials. [score:1]
Black squares represent miRBase entries for miR-615 or published deep sequencing data. [score:1]
Fig.  2Part of a Hoxc5 intronic alignment across tetrapods corresponding to the eutherian mir-615 region, extracted from an alignment of Hoxc5 loci including exons. [score:1]
Fig.  5Hypothetical scenarios for the origin of miR-615. [score:1]
It has been reported that most miRNA promoters are located within 500 bp upstream of the pre-miRNA sequence [35], suggesting the putative miR-615 specific promoter lies close to the start of the intron or in the first coding exon of HOXC5. [score:1]
This analysis reveals that all the eutherian mir- 615 orthologues are likely to produce functional pre-miR-615. [score:1]
We thus argue there are two modes of miR-615 production. [score:1]
Taken together, these data suggest that miR-615 is generated both from transcription of HOXC5 and from its own promoter. [score:1]
Analysis of aligned eutherian pre-miR-615 structures using RNAz is strongly supportive of the existence of a conserved fold (Additional file 3: Supplement S3B). [score:1]
However, the involvement of miR-615 in non-pathologic biological processes is currently unknown. [score:1]
It is therefore not implausible that miR-615, newly emergent in the ancestral therian lineage, was captured by selection and retained in only in the eutherian lineage but not in Metatheria. [score:1]
The observed sequence-level similarity between the corresponding Hoxc5 intronic regions in marsupials and eutherians, with a precise stem-loop structure present in eutherians but not marsupials, presents a strong case for the evolution of miR-615 through intronic exaptation. [score:1]
Fig.  3Predicted secondary structures for example miR-615 precursors in marsupials and the four major eutherian clades. [score:1]
Several studies have explored the roles of miR-615 in the context of human pathologies [36, 42– 45]. [score:1]
b Origin in the ancestral therian lineage followed by secondary loss in Metatheria Although we favour the above mo del as the most likely mode of origin of miR-615, we note that the predicted secondary structure of the homologous region in the Hoxc5 intron of modern marsupials resembles an approximate hairpin more than a completely random fold (Fig.   3). [score:1]
Data for American pika (Ochotona princeps), lesser Egyptian jerboa (Jaculus jaculus) and common shrew (Sorex araneus) were obtained by running BLASTn using the hsa-miR-615 sequence against draft genome assemblies for these species. [score:1]
10.1186/s13227-015-0027-1 (A) Read counts for miR-615 mature products in the GM12878 and K562 cell lines, as generated by the miRDeep2 quantifier. [score:1]
Although miR-615 was not detected in whole mouse testis, it is present in the Sertoli cells and spermatocytes (see [1], Additional file 6: Supplement S6B). [score:1]
Putative functions for miR-615. [score:1]
Structural criteria for the annotation of functional miR-615 are: stable hairpin structure with <−18 kcal/mol free energy, at least 18 paired bases on the main stem and the absence of large internal loops and bulges in mature regions. [score:1]
b Origin in the ancestral therian lineage followed by secondary loss in MetatheriaAlthough we favour the above mo del as the most likely mode of origin of miR-615, we note that the predicted secondary structure of the homologous region in the Hoxc5 intron of modern marsupials resembles an approximate hairpin more than a completely random fold (Fig.   3). [score:1]
miR-615 is reported as being restricted to either mammals or amniotes [11] but current literature lacks a detailed analysis of its evolutionary history. [score:1]
A possible mo del for the origin of miR-615, involving eutherian-specific origin via intronic exaptation, is shown in Fig.   5a. [score:1]
There is no evidence for antisense transcription of miR-615 in any of the samples. [score:1]
However, in the two marsupials analysed minimum folding energy (MFE) for the putative pre-miR-615 homologues (−39.40 kcal/mol in M. eugenii and −42.60 kcal/mol in S. harrisii) are higher than those observed for all eutherian miR-615 precursors (mean MFE −59.40 kcal/mol). [score:1]
Origins of eutherian mir- 615. miR-615 as a mo del for understanding intronic miRNA evolution. [score:1]
10.1186/s13227-015-0027-1 miR-615-3p read counts in mouse small RNA libraries as reported in the dataset of Chiang et al. (2010), refer to [21]. [score:1]
We demonstrate using sequence analysis and structural prediction that miR-615 is a eutherian-specific miRNA, although a similar sequence exists in extant marsupials that may have a low probability of miRNA processing. [score:1]
However, the regions corresponding to the mature miR-615 products differ slightly from the corresponding eutherian versions. [score:1]
[1 to 20 of 72 sentences]
3
[+] score: 124
Three of the miRNAs, miR-196a-5p (mean control expression = 1.47; mean HD expression = 27.49), miR-196b-5p (mean control expression = 2.49; mean HD expression = 11.01) and miR-615-3p (mean control expression = 1.09, mean HD expression = 6.66), had near zero expression levels in all nine control samples. [score:15]
Four (miR-10b-5p, miR-196a-5p, miR-196b-5p and miR-615-3p) of the five differentially expressed miRNAs are related to Hox cluster genes as follows: (1) these four are located in intergenic regions of the Hox clusters, (2) eleven Hox genes are validated targets of these four miRNAs, (3) Hox genes adjoining differentially expressed miRNAs are differentially expressed and (4) multiple Hox cluster genes are differentially expressed in HD versus control brains (Table 4 ). [score:11]
miR-10b-5p, miR-1247-5p, miR-196a-5p, miR-196b-5p, and miR-615-3p were identified as differentially expressed in Huntington's disease prefrontal cortex compared to non-neurological disease controls by Illumina miRNA-sequencing. [score:6]
1004188.g001 Figure 1 miR-10b-5p, miR-1247-5p, miR-196a-5p, miR-196b-5p, and miR-615-3p were identified as differentially expressed in Huntington's disease prefrontal cortex compared to non-neurological disease controls by Illumina miRNA-sequencing. [score:6]
Five of these, miR-10b-5p, miR-196a-5p, miR-196b-5p, miR-615-3p and miR-1247-5p, were up-regulated in HD at genome-wide significance (FDR q-value<0.05), and three of these five, miR-196a-5p, miR-196b-5p and miR-615-3p, were expressed at near zero levels in the control brains. [score:6]
miR-196a-5p, miR-196b-5p and miR-615-3p were essentially not expressed in control samples, while the mean HD expression was 27.49, 11.01 and 6.66 respectively. [score:5]
Information on experimentally validated miRNA targets of miR-10b-5p, miR-196a-5p and miR-615-3p were extracted from the miRWalk “Validated Targets” module [30]. [score:5]
22 differential expressed targets of miR-10b-5p, miR-196a, miR-196b, miR-1247 and miR-615-3p. [score:5]
miR-10b-5p, miR-196a-5p, miR-196b-5p and miR-615-3p expression is related to Hox cluster gene expression. [score:5]
After correcting for multiple comparisons, targets of miR-10b-5p, miR-196a, miR-196b and miR-615-3p shared significant overlap in 33 biological functions; the top three functional categories were “ Cell Death and Survival,” (Benjamini-Hochberg adjusted p-value, range = 3.5e-07–1.5e-04), “ Nervous System Development and Function” (range = 1.5e-07–1.5e-03) and “ Cellular Assembly and Organization” (range = 2.5e-05–1.7e-03). [score:4]
Using pathway analysis, we showed that miR-10b-5p, miR-196a-5p, miR-196b-5p and miR-615-3p targeted genes are predicted to be involved in apoptosis as well as nervous system development and function. [score:4]
HOXC6 (FDR-adjusted q-value = 1.27e-02) immediately upstream of miR-615 was also up-regulated. [score:4]
Four of the five up-regulated miRNAs showed association to clinical features of HD (CAG repeat size, age of motor onset and age at death for miR-10b-5p; CAG repeat size and age at onset for miR-196a-5p, age at onset for miR-196b-5p and age at death for miR-615-3p). [score:4]
Seed sequences differ for miR-10b-5p (ACCCUGU), miR-615-3p (CCGAGCC) and miR-1247-5p (CCCGUCC) suggesting these miRNA have different targets, while miR-196a-5p and miR-196b-5p share a seed sequence (AGGUAGU) and only differ by a single base difference in mature miRNA sequence. [score:3]
In neuroblastoma SH-SY5Y cell lines, miR-10a, miR-10b and miR-615-5p expression levels significantly increased during all-trans-retinoic-acid (ATRA) treatment, indicating miR-10a/b and miR-615-5p may have a role in neurodifferentiation [44]. [score:3]
Among the twelve HD samples, the levels of four out of the five significantly differentially expressed miRNAs (miR-10b-5p, miR-196a-5p, miR-196b-5p, miR-615-3p) were strongly correlated with each other, (Spearman r range 0.71–0.88; p range 0.0002–0.01). [score:3]
mRNA targets of miR-10b-5p, miR-196a-5p, miR-196b-5p and miR-615-3p may have similar functions. [score:3]
Due to the near zero level of expression in controls, it was not possible to assess the relationship of miR-196a-5p, mir-196b-5p and miR-615-3p to age at death, but miR-10b-5p was not correlated with age at death in controls. [score:3]
Differentially expressed miRNA data trended as non-normally distributed in HD (miR-10b-5p, p = 0.04; miR-196a-5p, p = 0.05; miR-615-3p, p = 0.06), but not in controls (miR-10b-5p, p = 0.71; miR-196a-5p and miR-615-3p were essential zero). [score:3]
Expression of miR-10b-5p, miR-196a-5p, miR-196b-5p and miR-615-3p are correlated. [score:3]
The miRWalk database contained 84 unique targets for miR-10b-5p, 80 for miR-196a, 40 for miR-196b, two for miR-1247 and twelve for miR-615-3p. [score:3]
The essentially null level of expression in controls prevented meaningful assessment of the relationship of miR-196a-5p, miR-196b-5p and miR-615-3p with clinical variables, in particular age at death, or sample variables, post-mortem interval (PMI), or RIN/RQN. [score:3]
Age at death was significantly related to miR-615-3p expression (β = −0.03, p-value = 0.0045) and age at onset was associated with miR-196b-5p (β = −0.04, p-value = 9e-04). [score:3]
miR-10b-5p shared eleven targets with miR-196a-5p (HOXB8, COX8A, HOXA10, NPC1, FLT3, AKT1, NPM1, DROSHA, AGO2, NFYC, PAX7), and one with miR-615-3p (MAPK8). [score:3]
Four out of five miRNA (miR-10b-5p, miR-196a-5p, miR-196b-5p, miR-615-3p) were confirmed as significantly increased in expression in HD (Table S4). [score:3]
Because age at death represents the lifetime exposure of the individual to the effects of the HD gene, we hypothesize that the association of miR-10b-5p and miR-615-3p with age at death may represent the lifetime exposure to the effects of the HD mutation. [score:2]
miR-10b-5p, miR-196a-5p, miR-196b-5p and miR-615-3p have overlapping biological functions. [score:1]
miR-10b-5p, miR-196a-5p, miR-196b-5p and miR-615-3p implicate Hox cluster genes. [score:1]
Because the values of miR-615-3p and miR-196a-5p were essentially zero in the control samples, correlations among the miRNAs were not performed for controls. [score:1]
According to the miRNA search program “PubmiR,” [37] miR-196b-5p, miR-1247-5p and miR-615-3p have not been previously reported in HD miRNA studies. [score:1]
Because of gene duplication, miR-196a is derived from both the HOXB and HOXC clusters; miR-10b is located in the HOXD cluster and miR-615 is found in the HOXC cluster [31], [32]. [score:1]
miR-10b-5p, miR-196a-5p, miR-196b-5p and miR-615-5p are related to HD pathogenesis. [score:1]
[1 to 20 of 32 sentences]
4
[+] score: 61
For our gene targeting experiments, we focused mainly on the inactivation of miR615-3p, but has also investigated the effect of the genome targeting on miR615-5p expression. [score:5]
org) 19 to search for CRISPR single guide RNA (sgRNA) targets in exon 2 and 4 of ATRX gene and the region encoding miR615-3p in MIR615 gene and ultimately chose two and four targets, respectively, which we named sgATRX-E2, sgATRX-E4 and sgMIR615-3p-T1, -T2, -T3 and -T4. [score:5]
We first cultured HCT116 cells and co -transfected them with pCas9WT-2A-GFP plasmid and individual sgRNA expression plasmids targeting ATRX exon 4 (sgATRX-E4), TP53 exon 4 (sgTP53E4.1 and sgTP53E4.2) and MIR615 region encoding miR615-3p (sgMIR615-3p-T1 to -T4). [score:5]
In addition, the expression of a known target of miR615-3p, AKT2, was examined using quantitative RT-PCR (e) and Western blot analysis (f). [score:5]
Due to their complementary nature and mutual requirement for maturation, we expected that the mutation of miR615-3p will adversely affect the expression of miR615-5p as well. [score:4]
All three clones showed significant increase in AKT2 mRNA expression (Fig. 5e) and protein level (Fig. 5f) when compared to wildtype parental cells, indicating successful targeting of the MIR615 gene. [score:4]
In agreement to that, we observed a similarly drastic decrease in miR615-5p expression in the three mutant clones examined (Fig. 5d). [score:3]
Genotyping of MIR615-3p -targeted clones via fluorescent PCR-capillary gel electrophoresis. [score:3]
MIR615 gene (specifically the region encoding miR615-3p) was targeted using CRISPR/Cas9 system in HCT116 cells. [score:3]
Similarly for TP53- and MIR615-3p -targeted clones, samples were mixed with SDS loading dye and heated at 95 °C for 10 minutes and centrifuged at top speed for a minute and loaded onto a 10% polyacrylamide gel. [score:3]
Exon 2 and 4 of human ATRX gene and miR615-3p-encoding region of MIR615 were subjected to potential sgRNA target search using the online software created by Feng Zhang’s group (http://tools. [score:3]
In contrast, all sgRNAs targeting TP53 and MIR615-3p displayed high cutting efficiency (Fig. 2b,c). [score:3]
ATRX sgRNAs (sgATRX-E2 and -E4) and MIR615 sgRNA (sgMIR615-3p-T1, -T2, -T3 and -T4) expression plasmids were constructed by cloning U6 promoter-sgRNA-TTT [(as used by Mali et al. 30] into pBluescript SK (-) vector (see Supplementary Figure S1 for schematic). [score:3]
In accordance to this, we found that 70.8% of clones examined were mutated on at least one allele (Supplementary Table 1) and all the clones we analysed via qRT-PCR showed at least seven-fold decrease in miR615-3p expression level (Fig. 5b; and data not shown). [score:3]
Crude lysates were centrifuged to remove cell debris and the clarified lysates were used directly for immunoblotting (TP53 clones, and MIR615-3p clones probing for Akt2) or for immunoprecipitation prior to blotting (ATRX clones). [score:2]
We also investigated the effects of miR615-3p mutation on a known target— AKT2 24. [score:2]
Specific regions of ATRX (a), TP53 (b) and MIR615 (c) genes were targeted using CRISPR/Cas9 system (top) and the efficiency of the sgRNA used were examined via SURVEYOR assay (bottom). [score:2]
We examined ATRX, TP53 and MIR615 in near-diploid HCT116 colorectal carcinoma cells for this purpose. [score:1]
Lastly, the MIR615 gene encodes two microRNAs—miR615-5p and miR615-3p—and has been implicated in prostate and colon cancer 18. [score:1]
Lastly, we interrogated the efficacy of the fluorescent capillary electrophoresis technique to genotype a bi-allelic non-coding RNA gene, MIR615, specifically the region encoding miR615-3p. [score:1]
[1 to 20 of 20 sentences]
5
[+] score: 23
Other miRNAs from this paper: mmu-mir-34c, hsa-mir-34c, mmu-mir-615
The last group (“up”) consisted of the nine top genes detected as up-regulated in the sperm of DEHP exposed mice (Rbp2, mir615, C1qtnf5, Gzmk, Gm8994, Gm6329, Fbxw15, 231002L09Rik and 1700044K03Rik). [score:4]
Nine of the 10 top up-regulated genes identified by Jensen-Shannon distance estimates (Gm6329, Gm8994, Gzmk, C1qntf5, Fbxw15, mir615, Rbp2, 231002L09Rik and 1700044K03Rik) reached statistical significance (Fig 4E). [score:4]
It is noteworthy that among these 10 top up-regulated genes, one microRNA (mir615) was detected by Jensen-Shannon distance estimates. [score:4]
We identified Gzmk, encoding Granzyme K serine protease usually detected in cytoplasmic granules in both cytotoxic T-lymphocytes and natural killer cells, C1qtnf5 (bicistronic with Mfrp) involved in cell adhesion, as well as non-coding RNA 1700044K03Rik of an unknown function, whereas mir615 (overlapping Hoxc5) RNA expression was significantly dysregulated, but lacked promoter methylation data (Fig 4E & 4F). [score:4]
Red dots and bars represent nine upregulated genes in the sperm of DEHP exposed mice (Rbp2, mir615, C1qtnf5, Gzmk, Gm8994, Gm6329, Fbxw15, 231002L09Rik, and 1700044K03Rik). [score:4]
Promoter methylation of mir-615 was absent in the MBD-seq database. [score:1]
The Hox cluster microRNA miR-615: a case study of intronic microRNA evolution. [score:1]
These genes were not reported as involved in sperm physiology, except for mir615, which is putatively involved in gonadal differentiation [54]. [score:1]
[1 to 20 of 8 sentences]
6
[+] score: 16
After all the analysis, six out of 9 miRNAs remained significantly and more than 1.5 fold upregulated (miR340*, miR615-5p, miR545:9.1, miR451, miR454* and miR624*) and 1 out of 5 miRNA remained significantly and more than 1.5 fold downregulated (miR-1280) in both analyses (figure 2). [score:7]
Six platelet microRNAs were significantly upregulated (miR340*, miR451, miR454*, miR545:9.1. miR615-5p and miR624*) and one miRNA (miR1280) was significantly downregulated in patients with CAD as compared to healthy controls. [score:6]
MiR615-5p and the only downregulated miRNA, miR1280, could not be validated, since the PCR primers for these particular miRNAs did not appear to amplify a specific product. [score:3]
[1 to 20 of 3 sentences]
7
[+] score: 14
Other miRNAs from this paper: hsa-mir-1178, hsa-mir-4499, hsa-mir-5571
The expression of miR-615-5p, miR-1178-5p, and miR-5571-3p was also decreased after Ara-C treatment, suggesting that the expression of these miRNAs is also down-regulated by DNA damage. [score:8]
Strikingly, treatment of cells with the Pol III inhibitor resulted in significant down-regulation of only four miRNAs: miR-615-5p, miR-1178-5p, miR-4499, and miR-5571-3p (Fig. 7, A and B). [score:6]
[1 to 20 of 2 sentences]
8
[+] score: 13
Suppression of the essential molecules in VEGF signaling pathway, such as phospholipase C gamma 1 (PLCG1) possibly targeted by val-miR615 and val-miR1086, tyrosine-protein kinase Src possibly targeted by val-miR834 and val-miR1086, may block the angiogenic activity of tumor tissue, resulting in tumor vascular regression and anti-tumor effects. [score:7]
The putative inhibition of ERK and IKK by val-miR615 and val-miR834 might restore the impaired INSR singling. [score:3]
For example, runt related transcription factor 1 (RUNX1) and lysine methyltransferase 2A (MLL1) are essential for chromosomal translocations in acute myeloid leukemia [52, 53], which were predicted as targets of val-miR1086, val-miR765, val-miR615; and val-miR834 val-miR765, val-miR550, val-miR1127, val-miR954, val-miR1086, val-miR421, respectively. [score:3]
[1 to 20 of 3 sentences]
9
[+] score: 13
Nevertheless, not all the miRNA regulations supported the inhibition, such as HCV -induced increase in miR-146a-5p expression both promotes viral infection and is relevant for pathogenesis of liver disease [30]; the low level of miR-615-5p increased the expression of RAB24 and facilitated HCC growth and metastasis in vitro and in vivo [31]; miR-31-5p was significantly upregulated for CIMP high colon carcinomas [32]. [score:13]
[1 to 20 of 1 sentences]
10
[+] score: 12
miR-588 but not miR-615-5p also suppressed hPGRN expression in stable cell lines (data not shown), indicating that multiple miRNAs may be potential targets for therapeutic manipulation of hPGRN levels. [score:7]
Two other miRNAs, miR-588 and miR-615-5p, were predicted to target hPGRN mRNA by more than two target prediction programs. [score:5]
[1 to 20 of 2 sentences]
11
[+] score: 10
The hsa-miR-98 and hsa-miR-375 miRNAs were upregulated, whilst hsa-miR-7-5p, hsa-miR-615-3p and hsa-miR-577 were downregulated. [score:7]
The expression levels of 5 randomly selected miRNAs: hsa-miR-7-5p, hsa-miR-615-3p, hsa-miR-577, hsa-miR-98 and hsa-miR-375, were compared. [score:2]
The log [2] (MN/NC) values of hsa-miR-7-5p, hsa-miR-615-3p and hsa-miR-577 were −5.06, −2.40 and −1.12, respectively. [score:1]
[1 to 20 of 3 sentences]
12
[+] score: 9
Our analysis confirms the upregulation of miR-10b-5p, miR-196a-5p, miR-196b-5p, miR-615-3p and miR-1247-5p in HD. [score:4]
Hoss and colleagues [9] related five upregulated miRNAs (miR-10b-5p, miR-196a-5p, miR-196b-5p, miR-615-3p and miR-1247-5p) located in the HOX gene cluster to HD pathogenesis. [score:4]
931.210.0052-miR-615-3p0.005.45Inf0.0065[9]miR-196b-5p1.0910.179.330.0134[9]miR-127-3p175251.70224611.391.280.0194-miR-208b75.76112.901.490.0217-miR-302a-5p2.676.932.600.0451-miR-2682-5p212.76299.861.410.0451-miR-30a-5p171969.53228298.921.330.0451[8]miR-770-5p333.36445.551. [score:1]
[1 to 20 of 3 sentences]
13
[+] score: 8
We observed large ΔΔG [total] of about −5 kcal/mol for the allele mutation G>A, indicating a substantial enhancement of the potential of the hybridization between IMPDH1 and miR-615-3p and potential decrease of IMPDH1 expression level. [score:4]
miR-615-3p was found to be expressed in colorectal cells (48). [score:3]
For example, the SNP rs2228075 (G>A) in CDS of gene IMPDH1 is upstream of an miR-615-3p binding site identified by CLASH. [score:1]
[1 to 20 of 3 sentences]
14
[+] score: 7
As PPARγ enhances phagocytosis (73), the indirect effect of miR-615-3p expression is to enhance the phagocytic capacity of MΦs. [score:4]
miR-615-3p enhances the phagocytic capacity of MΦs by targeting ligand -dependent nuclear receptor corepressor (LCoR), which is a corepressor of peroxisome proliferator-activated receptor γ (PPARγ) (72). [score:3]
[1 to 20 of 2 sentences]
15
[+] score: 6
Meanwhile, we obtained a list of miRNAs including miR-671, miR-615, miR-20a, miR-17 and miR-196a through the gene-miRNA targets function of miRWalk 2.0, which were predicted to regulate the expression of UBE2C. [score:6]
[1 to 20 of 1 sentences]
16
[+] score: 6
However, only miR-663 could be regulated by DNA methylation, and the expression levels of miR-369, miR-615, and miR-410 were not regulated by DNA methylation in K562 cells [26]. [score:5]
Previous evidence also shows that CpG islands in the upstream regions of 18 pre-miRNAs are methylated after 5-azacytidine treatment, including miR-663, miR-369, miR-615 and miR-410. [score:1]
[1 to 20 of 2 sentences]
17
[+] score: 6
Among these nine miRNAs, miR-615, miR-193b and miR-346 were upregulated after inhibition of uc. [score:6]
[1 to 20 of 1 sentences]
18
[+] score: 5
They characterized low expression of hsa-miR-592 and high expression of hsa-miR-10b-5p and hsa-miR-615-3p were associated with tumors located in the right colon relative to the left colon and rectum and high expression of hsa-miR-615-3p [14]. [score:5]
[1 to 20 of 1 sentences]
19
[+] score: 3
Other miRNAs from this paper: hsa-mir-21, hsa-mir-34a, hsa-mir-324, hsa-mir-193b
Equally, we found that ZIKV genomic regions can potentially bind the hsa-mir-615-3p and hsa-miR-193b-3p human miRNAs, which target the WD Repeat Domain 62 (WDR62 or MCHP2), also related to MCHP when mutated. [score:3]
[1 to 20 of 1 sentences]
20
[+] score: 3
For example, one TF gene, CTCF, controls the expression of HOXC5, which is the host gene of miR-615-3p 45, 46 while miR-615-3p interacts with CTCF transcript in CALSH experiment [21]. [score:3]
[1 to 20 of 1 sentences]
21
[+] score: 3
et al., [118], applying a specific selection approach on miRNA expression by microarray data, identified a distinct signature comprising 4 miRNAs (hsa-let-7a-5p, hsa-let-7b-5p, hsa-miR-125a-5p and hsa-miR-615-5p) that was confirmed by quantitative real-time PCR (qRT-PCR) and was present in an age- and sex-matched cohort of GBM patients, obtained from The cancer genome atlas (TCGA), who received standard-of-care treatment. [score:3]
[1 to 20 of 1 sentences]
22
[+] score: 3
Further analysis using DIANA LncBase V2 experimental module 51 led to identification of 4 (miR-10b-5p, miR-125a-5p, miR-4325 and miR-615-5p) differentially expressed miRNAs which can interact with lncRNA Xist. [score:3]
[1 to 20 of 1 sentences]
23
[+] score: 3
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-26b, hsa-mir-29a, hsa-mir-30a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, mmu-let-7g, mmu-let-7i, mmu-mir-15b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-130a, mmu-mir-138-2, mmu-mir-181a-2, mmu-mir-182, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-10a, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-181a-1, mmu-mir-297a-1, mmu-mir-297a-2, mmu-mir-301a, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, mmu-mir-106a, mmu-mir-106b, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-138-2, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-138-1, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-26b, mmu-mir-29a, mmu-mir-29c, mmu-mir-34a, rno-mir-301a, rno-let-7d, rno-mir-344a-1, mmu-mir-344-1, rno-mir-346, mmu-mir-346, rno-mir-352, hsa-mir-181b-2, mmu-mir-10a, mmu-mir-181a-1, mmu-mir-29b-2, mmu-mir-138-1, mmu-mir-181b-1, mmu-mir-181c, mmu-mir-125b-1, hsa-mir-106b, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-30e, hsa-mir-362, mmu-mir-362, hsa-mir-369, hsa-mir-374a, mmu-mir-181b-2, hsa-mir-346, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-10a, rno-mir-15b, rno-mir-26b, rno-mir-29b-2, rno-mir-29a, rno-mir-29b-1, rno-mir-29c-1, rno-mir-30c-1, rno-mir-30e, rno-mir-30b, rno-mir-30d, rno-mir-30a, rno-mir-30c-2, rno-mir-34b, rno-mir-34c, rno-mir-34a, rno-mir-106b, rno-mir-125a, rno-mir-125b-1, rno-mir-125b-2, rno-mir-130a, rno-mir-138-2, rno-mir-138-1, rno-mir-181c, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-181a-1, hsa-mir-449a, mmu-mir-449a, rno-mir-449a, mmu-mir-463, mmu-mir-466a, hsa-mir-483, hsa-mir-493, hsa-mir-181d, hsa-mir-499a, hsa-mir-504, mmu-mir-483, rno-mir-483, mmu-mir-369, rno-mir-493, rno-mir-369, rno-mir-374, hsa-mir-579, hsa-mir-582, hsa-mir-652, hsa-mir-449b, rno-mir-499, hsa-mir-767, hsa-mir-449c, hsa-mir-762, mmu-mir-301b, mmu-mir-374b, mmu-mir-762, mmu-mir-344d-3, mmu-mir-344d-1, mmu-mir-673, mmu-mir-344d-2, mmu-mir-449c, mmu-mir-692-1, mmu-mir-692-2, mmu-mir-669b, mmu-mir-499, mmu-mir-652, mmu-mir-615, mmu-mir-804, mmu-mir-181d, mmu-mir-879, mmu-mir-297a-3, mmu-mir-297a-4, mmu-mir-344-2, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-493, mmu-mir-504, mmu-mir-466d, mmu-mir-449b, hsa-mir-374b, hsa-mir-301b, rno-mir-466b-1, rno-mir-466b-2, rno-mir-466c, rno-mir-879, mmu-mir-582, rno-mir-181d, rno-mir-182, rno-mir-301b, rno-mir-463, rno-mir-673, rno-mir-652, mmu-mir-466l, mmu-mir-669k, mmu-mir-466i, mmu-mir-669i, mmu-mir-669h, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-466j, mmu-mir-1193, mmu-mir-767, rno-mir-362, rno-mir-504, rno-mir-582, rno-mir-615, mmu-mir-3080, mmu-mir-466m, mmu-mir-466o, mmu-mir-466c-2, mmu-mir-466b-4, mmu-mir-466b-5, mmu-mir-466b-6, mmu-mir-466b-7, mmu-mir-466p, mmu-mir-466n, mmu-mir-344e, mmu-mir-344b, mmu-mir-344c, mmu-mir-344g, mmu-mir-344f, mmu-mir-374c, mmu-mir-466b-8, hsa-mir-466, hsa-mir-1193, rno-mir-449c, rno-mir-344b-2, rno-mir-466d, rno-mir-344a-2, rno-mir-1193, rno-mir-344b-1, hsa-mir-374c, hsa-mir-499b, mmu-mir-466q, mmu-mir-344h-1, mmu-mir-344h-2, mmu-mir-344i, rno-mir-344i, rno-mir-344g, mmu-let-7j, mmu-mir-30f, mmu-let-7k, mmu-mir-692-3, rno-let-7g, rno-mir-15a, rno-mir-762, mmu-mir-466c-3, rno-mir-29c-2, rno-mir-29b-3, rno-mir-344b-3, rno-mir-466b-3, rno-mir-466b-4
1Proliferation, Invasion, Tumor suppression [63– 66] miR-344 ↓2.0 ↓3.2 NA miR-346 ↓2.4Proliferation [67, 68] miR-362 ↓2.3Proliferation, Invasion, Apoptosis [69– 76] miR-369 ↓2.8 ↓2.6 ↓2.1Aerobic glycolysis [77] miR-374 ↑3.0 ↓2.2 NA miR-449 ↑2.7 ↑2.4Proliferation [78– 81] miR-463 ↓2.7 NAmiR-466 [°] ↑2.4 ↑2.1 ↓3.5 NA miR-483 ↓3.2Apoptosis [82] miR-493 ↑2.1 ↓2.2Proliferation [83– 85] miR-499a ↓5.0 ↑2.3Proliferation [86] miR-504 ↓2.6 ↑2.0Proliferation, Apoptosis [87, 88] miR-579 ↑2.8 NAmiR-582 [^] ↑2.4Proliferation [89] miR-615 ↓2.1Proliferation, Invasion [90, 91] miR-652 ↑2.4Proliferation, EMT [92, 93] miR-669b ↓2.1 NA miR-669h ↓3.6 ↑2.3 NA miR-669i ↓2.3 NA miR-669k ↓7.2 ↓5. [score:3]
[1 to 20 of 1 sentences]
24
[+] score: 3
Most of the miRNAs deregulated by aberrant patterns of histone modification in cancer cells are silenced, but some miRNAs, such as miR-224, miR-615 and miR-155, are activated by histone modification. [score:2]
Similarly, a study in prostate cancer cells identified miR-615 as an epigenetically activated miRNA by DNA methylation loss and H3K9 acetylation gain [37]. [score:1]
[1 to 20 of 2 sentences]
25
[+] score: 2
In addition to those hub miRNAs, we found hub miRNAs with no previous association in breast cancer, including miR-615-3p, miR-1, miR-484, miR-192-5p and miR-324-5p. [score:1]
Our further analysis detected substantial involvement of the miRNAs miR-324, miR-93, miR-615 and miR-1 in breast cancer, which was not known previously. [score:1]
[1 to 20 of 2 sentences]
26
[+] score: 1
A recent study has described a group of six miRNAs (miR-155, miR-708, miR-615, miR-375, miR-124a and miR-9) co-occupied simultaneously by the ESC transcription factors OCT4, SOX2, NANOG and TCF3 and by the Polycomb group proteins. [score:1]
[1 to 20 of 1 sentences]
27
[+] score: 1
Other miRNAs from this paper: hsa-mir-196a-1, hsa-mir-196a-2, hsa-mir-196b
Three of the five miRNAs (miR-196a-5p, miR-196b-5p and miR-615-3p) have near zero levels in the control which suggested their potential as a biomarker for HD [17]. [score:1]
[1 to 20 of 1 sentences]
28
[+] score: 1
Other miRNAs from this paper: hsa-mir-17, hsa-mir-28, hsa-mir-223, hsa-mir-127, hsa-mir-188, hsa-mir-194-1, hsa-mir-155, hsa-mir-194-2, hsa-mir-30e, hsa-mir-362, hsa-mir-363, hsa-mir-367, hsa-mir-379, hsa-mir-196b, hsa-mir-450a-1, hsa-mir-431, ssc-mir-28, hsa-mir-493, hsa-mir-512-1, hsa-mir-512-2, hsa-mir-500a, hsa-mir-501, hsa-mir-502, hsa-mir-450a-2, hsa-mir-513a-1, hsa-mir-513a-2, hsa-mir-506, hsa-mir-508, hsa-mir-509-1, hsa-mir-532, hsa-mir-660, bta-mir-127, bta-mir-30e, bta-mir-17, bta-mir-450a-2, bta-mir-532, bta-mir-363, bta-mir-660, hsa-mir-891a, hsa-mir-892a, hsa-mir-509-2, hsa-mir-450b, hsa-mir-892b, hsa-mir-708, hsa-mir-509-3, hsa-mir-1285-1, hsa-mir-1285-2, hsa-mir-1248, ssc-mir-17, bta-mir-155, bta-mir-188, bta-mir-194-2, bta-mir-196b, bta-mir-223, bta-mir-28, bta-mir-362, bta-mir-367, bta-mir-379, bta-mir-431, bta-mir-493, bta-mir-500, bta-mir-502a-1, bta-mir-502a-2, bta-mir-502b, bta-mir-615, bta-mir-708, bta-mir-1248-1, bta-mir-1248-2, ssc-mir-450a, bta-mir-2320, bta-mir-1388, bta-mir-194-1, bta-mir-450a-1, eca-mir-30e, eca-mir-367, eca-mir-684, eca-mir-196b, eca-mir-615, eca-mir-708, eca-mir-194-1, eca-mir-493a, eca-mir-17, eca-mir-1248, eca-mir-28, eca-mir-127, eca-mir-379, eca-mir-431, eca-mir-493b, eca-mir-155, eca-mir-194-2, eca-mir-188, eca-mir-223, eca-mir-362, eca-mir-363, eca-mir-450a, eca-mir-450b, eca-mir-450c, eca-mir-500-1, eca-mir-500-2, eca-mir-501, eca-mir-502, eca-mir-508, eca-mir-509a, eca-mir-532, eca-mir-660, ssc-mir-30e, ssc-mir-196b-1, ssc-mir-450b, ssc-mir-127, ssc-mir-532, ssc-mir-708, ssc-mir-1285, ssc-mir-500, hsa-mir-514b, ssc-mir-363-1, ssc-mir-450c, hsa-mir-500b, ssc-mir-194b, ssc-mir-155, ssc-mir-362, bta-mir-3601, ssc-mir-615, ssc-mir-2320, bta-mir-450b, ssc-mir-194a, ssc-mir-196b-2, ssc-mir-363-2, ssc-mir-493, hsa-mir-892c, eca-mir-1388, eca-mir-514b, eca-mir-506a, eca-mir-509b, bta-mir-194b, ssc-mir-1388, ssc-mir-223, ssc-mir-660, bta-mir-194b-2, bta-mir-1949
Sometimes these duplicated annotations were found twice on the same chromosome in close proximity (for example mir-196b twice on the same strand, and both mir-615 and mir-194 twice, once on each strand) and sometimes they were found both on the assembled chromosomes and within the unplaced contigs (for example mir-127, mir-155). [score:1]
[1 to 20 of 1 sentences]
29
[+] score: 1
MNPT) miR-449a# 3.92 miR-32 3.49 miR-548c-5p 2.71 miR-562 2.56 miR-103-as 2.53 miR-512-3p 2.41 miR-200c* 2.33 miR-147b 2.24 miR-770-5p 2.09 miR-518c* 2.00 miR-517b 1.88 miR-182 1.79 miR-615-3p 1.70 miR-496 1.59 miR-1200 1.58 miR-375 1.54 miR-551a 1.53 *Passanger strand. [score:1]
[1 to 20 of 1 sentences]