sort by

42 publications mentioning bta-mir-26a-2

Open access articles that are associated with the species Bos taurus and mention the gene name mir-26a-2. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

[+] score: 44
The expression level of miR-26a in bovine MGT was down-regulated during lactation [7], which supports the present finding of a down-regulation of miR-26a in BMEC treated with DIP. [score:9]
Bioinformatic analysis using target genes of miR-21-5p, miR-26a, and miR-320a predicted that the molecular biological events with which the target genes of those miRNAs were associated are transcriptional regulation, protein phosphorylation, phosphate metabolic process, embryonic morphogenesis, tube development, and positive regulation of biosynthetic process. [score:8]
According to the results of our TargetScan analysis, a total of 1,617 bovine genes are predicted as the targets of significantly reduced miRNAs by DIP-treatment of BMEC (miR-21-5p, miR-26a, and miR-320a). [score:5]
These terms of biological process suggest that the down-regulations of miR-21-5p, miR-26a, and miR-320a in BMECs may have roles in the mammary gland differentiation and lactation of dairy cows. [score:4]
Intriguingly, according to the miRNA qPCR results, it is likely that most of cellular miRNAs including miR-21-5p, miR-26a, and miR-320a in BMEC culture are down-regulated after DIP treatment. [score:4]
In the qPCR analyses of 18 miRNAs that were abundant in milk, the expressions of miR-21-5p, miR-26a, and miR-320a were significantly lower in the DIP -treated cells than in the untreated cells. [score:3]
Quantitative polymerase chain reaction (qPCR) results showed that the expressions of miR-21–5p (P = 0.005), miR-26a (P = 0.016), and miR-320a (P = 0.011) were lower in the DIP -treated cells than in the untreated cells. [score:3]
The reduced expression of miR-26a in BMECs during differentiation could account for that in bovine MGT during lactation. [score:3]
The cellular expression of miR-21-5p, miR-25, miR-26a, miR-223, and miR-320a was lower in the DIP -treated BMECs than in the untreated BMECs (P = 0.005, = 0.059, = 0.016, = 0.054, and = 0.011, respectively), whereas that of the other miRNAs was not significantly changed by the treatment (Fig.   4a). [score:3]
The top 20 miRNAs in the milk exosome were let-7b (12.7 %), miR-200c (10.9 %), miR-26a (8.8 %), let-7c (7.5 %), let-7a-5p (6.3 %), miR-30a-5p (3.1 %), miR-320a (2.7 %), miR-103 (2.5 %), miR-107 (2.2 %), let-7d (1.9 %), miR-23-3p (1.6 %), miR-191 (1.6 %), miR-23a (1.6 %), miR-20a (1.5 %), miR-1777b (1.5 %), miR-151-5p (1.4 %), miR-24-3p (1.3 %), miR-320b (1.3 %), miR-200b (1.2 %), and miR-141 (1.2 %) (Fig.   2). [score:1]
Of those, miR-7b, miR-21-5p, miR-23-3p, miR-26a, miR-30a, miR-103, miR-107, miR-148a, miR-200c, and miR-320a were among the top 30 most abundant miRNAs in the milk. [score:1]
[1 to 20 of 11 sentences]
[+] score: 33
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-27a, hsa-mir-31, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-101-1, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-16-2, hsa-mir-192, hsa-mir-199a-1, hsa-mir-30c-2, hsa-mir-199a-2, hsa-mir-223, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-125b-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-140, hsa-mir-141, hsa-mir-152, hsa-mir-191, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-149, hsa-mir-150, hsa-mir-320a, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-101-2, hsa-mir-99b, hsa-mir-26a-2, hsa-mir-379, hsa-mir-423, hsa-mir-451a, hsa-mir-486-1, hsa-mir-496, hsa-mir-520a, hsa-mir-525, hsa-mir-518b, hsa-mir-516b-2, hsa-mir-516b-1, hsa-mir-516a-1, hsa-mir-516a-2, hsa-mir-92b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, bta-let-7f-2, bta-mir-101-2, bta-mir-103-1, bta-mir-16b, bta-mir-20a, bta-mir-21, bta-mir-27a, bta-mir-320a-2, bta-mir-125a, bta-mir-125b-1, bta-mir-199a-1, bta-mir-31, bta-mir-140, bta-mir-92a-2, bta-let-7d, bta-mir-132, bta-mir-191, bta-mir-192, bta-mir-22, bta-mir-23a, bta-mir-29c, bta-mir-423, bta-let-7g, bta-mir-24-2, bta-let-7a-1, bta-mir-150, bta-let-7f-1, bta-mir-30c, bta-let-7i, bta-mir-23b, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-125b-2, bta-mir-99b, hsa-mir-1249, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, bta-mir-101-1, bta-mir-133a-2, bta-mir-133a-1, bta-mir-141, bta-mir-152, bta-mir-16a, bta-mir-24-1, bta-mir-199a-2, bta-mir-223, bta-mir-26a-1, bta-mir-379, bta-mir-451, bta-mir-486, bta-mir-496, bta-mir-92a-1, bta-mir-92b, bta-mir-1249, bta-mir-320b, bta-mir-320a-1, hsa-mir-320e, hsa-mir-23c, hsa-mir-451b, bta-mir-149, hsa-mir-486-2
Interestingly, miR-26a has been shown to directly down-regulate IFN-β, a major cytokine involved in innate and adaptive immune responses, suggesting a potential role for this miRNA as an immuno-suppressor during early pregnancy [46]. [score:7]
RT-qPCR validation using the same plasma samples confirmed that miR-26a was differentially upregulated on Day 16 pregnant relative to non-pregnant heifers (1.7-fold; P = 0.043), whereas miR-1249 tended to be upregulated in Day 16 pregnant heifers (1.6-fold; P = 0.081). [score:7]
NP corresponds to plasma samples collected before insemination (Day 0) from the same animalsAlthough expressed ubiquitously, distinctly high levels of miR-26a have been reported in the embryo, the ovary, and immune-related tissues and cells such as the thymus and B/T cells of different species [42– 45]. [score:3]
NP corresponds to plasma samples collected before insemination (Day 0) from the same animals Although expressed ubiquitously, distinctly high levels of miR-26a have been reported in the embryo, the ovary, and immune-related tissues and cells such as the thymus and B/T cells of different species [42– 45]. [score:3]
Also, high plasma miR-26a levels have been associated with pre-eclampsia in humans [49]. [score:1]
These findings support the notion that miR-26a is involved in pregnancy, possibly by exerting immunomodulatory effects. [score:1]
Thus, from analyses in two independent groups of animals we concluded that the levels of miR-26a increase during early pregnancy in heifers. [score:1]
We have identified miR-26a as a potential circulating biomarker of early pregnancy. [score:1]
To more robustly validate the changes in miR-26a during early pregnancy, particularly as they were relatively small, we analysed plasma samples from a different, larger group of heifers during early pregnancy (Fig.   6c). [score:1]
Further validation in an independent group of heifers confirmed an increase in plasma miR-26a levels during early pregnancy, which was significant only on Day 24 (2.0-fold; P = 0.027). [score:1]
Additionally, recent studies in pig and goat have reported increasing levels of miR-26a in the conceptus and the ovary as early as Day 20 of pregnancy [47, 48]. [score:1]
On average, miR-26a levels were also higher on Day 16 (1.7-fold) although this difference did not reach significance (P = 0.118). [score:1]
Specifically, we identified an increase (up to 2-fold) in the levels of miR-26a during Days 16 to 24 of pregnancy. [score:1]
For 9 of these differences (Fig.   6a) the results of qPCR were consistent with those obtained by PCR array or sequencing although significance was only obtained for miR-26a; an increase in the levels of this miRNA was significant on Day 16 (NP vs P16, 1.7 fold, P = 0.043) but not on Day 24 (1.7 fold, P = 0.208 Fig.   6b). [score:1]
b RT-qPCR data plots (with mean ± SEM) for selected comparisons between pregnant and non-pregnant groups including the two differences in miRNA abundance that were significant (miR-26a, * indicates P < 0.05) or tended to be significant (miR-1249, NP vs P16, P < 0.1). [score:1]
In summary, our results identify miR-26a as a novel candidate biomarker of early pregnancy in cattle. [score:1]
c RT-qPCR data plots (with mean ± SEM) obtained from an independent group of heifers and which confirms an increase in plasma miR-26a levels during early pregnancy. [score:1]
[1 to 20 of 17 sentences]
[+] score: 28
14/26s highly expressed in the HM fraction (let-7d-5p, miR-103a-3p, miR-142-3p, miR-17-5p, miR-18a-5p, miR-196a-5p, miR-20a-5p, miR-24-1-5p, miR-26a-5p, miR-301a-3p, miR-30b-5p, miR-34b-5p, miR-34c-5p, miR-378a-3p) and 7/14s highly expressed in the LM fraction (miR-10b-5p, miR-122-5p, miR-1-3p, miR-184, miR-486-5p, miR-7-5p, miR-99b-5p) were predicted to target 327 and 281 experimentally observed genes, respectively. [score:7]
According to previous results, miR-17-5p, miR-26a-5p up-regulation enhances AKT pathway activation by PTEN suppression and promotes cancer [61, 62]. [score:6]
Dysregulation of miR-17-5p, miR-26a-5p, miR-486-5p, miR-122-5p, miR-184 and miR-20a-5p was found to target three pathways (PTEN, PI3K/AKT and STAT). [score:4]
Differents, including miR10b, miR-26, miR-34c and miR-99a, were also seen to change their expression level in underfed animals, and these variations were postulated to cause reduction in spermatozoa quality by disruption to Sertoli cell function and to increase germ cell apoptosis [55]. [score:3]
Conversely, bta-miR-26a, bta-miR-24 and bta-miR-100 showed an opposite expression in our samples with respect to what previously described in literature [26, 27, 55]. [score:3]
PTEN could be targeted by the simultaneous action of miR-17-5p, miR-26a-5p, miR-486-5p. [score:3]
Among these pathways, “PTEN Signaling” was regulated by miR-17-5p, miR-26a-5p and miR-486-5p, “PI3K/AKT Signaling” by 122-5p and miR-184 and “STAT3 Pathway” by miR-20a-5p (Fig.   4). [score:2]
[1 to 20 of 7 sentences]
[+] score: 26
qRT-PCR was performed to quantify expression of miR-93, miR-103, miR-26a, miR-191, miR-23b, Let-7a and U6 for bovine samples and miR-21, miR-26a, miR-93, miR-103, miR-148a, miR-182 and miR-191 for porcine oocytes. [score:3]
In these samples, expression of miR-26a, miR-191, miR-93 and miR-103 were most similar. [score:3]
The combination of miR-93 and miR-103 is optimal for normalizing miRNA expression for qPCR experiments on bovine oocytes and preimplantation embryos; the preferred combination for porcine oocytes is miR-26a, miR-191 and miR-93. [score:3]
In bovine samples, the expression of miR-23b, miR-26a, miR-93, miR-103, miR-191, Let-7a and the nuclear RNA U6 was examined. [score:3]
In porcine samples, normalization was performed using the relative expression of miR-26a, miR-191 and miR-93 (Fig.   4). [score:3]
Stepwise removal to determine the optimum number of reference miRNAs identified miR-93 and miR-103 as the most stably expressed in bovine samples and miR-26a, miR-191 and miR-93 in porcine samples. [score:3]
Different letters above bars (a,b,c,d) indicate values that differ significantly (p < 0.05) Fig. 4Relative expression of porcine miRNAs after normalization with miR-26a, miR-191 and miR-93. [score:3]
miR-21 miR-26a miR-93 miR-103 miR-148 miR-182 miR-191 coeff. [score:1]
miR-23b miR-26a miR-93 miR-103 miR-191 Let-7a U6 coeff. [score:1]
In porcine samples, the miRNAs identified as fluctuating least in bovine samples, namely miR-26a, miR-93, miR-103 and miR-191 were examined together with miR-21, miR-148a, and miR-182. [score:1]
In porcine samples, miR-93, miR-26a, miR-191 and miR-103 had the highest r and r [2] values (Tables  3, 4). [score:1]
In porcine samples, miR-26a and miR-191 had the lowest M values, followed by miR-93 (Fig.   1b). [score:1]
[1 to 20 of 12 sentences]
[+] score: 22
Four of the seven miRNAs, miR-143, miR-101, miR-30c and miR-26a, have been shown in previous studies to regulate insulin signalling and lipid metabolism and to be involved in diabetes [43– 46], and thus they may play important roles regulating changes in maternal metabolism occurring early during pregnancy. [score:3]
Six miRNAs (let-7c, let-7f, miR-101, miR-143, miR-30c and miR-26a) were expressed in many different body tissues including the uterus and the placenta, with no particular tissue being clearly enriched for any particular miRNA (Fig 3), overall consistent with data from human tissues [55, 56]. [score:3]
Finally, miR-101, miR-205 and miR-26a are known regulators of angiogenesis [51– 54], a key process during development of foeto-placental and maternal tissues during pregnancy. [score:3]
Reduced miR26a and miR26b expression contributes to the pathogenesis of osteoarthritis via the promotion of p65 translocation. [score:3]
In addition, miR-26a and let-7f have been shown to regulate macrophage- and T-cell -mediated immunity [47– 50] which would be consistent with a role in establishing maternal immuno-tolerance, a key function during early pregnancy. [score:2]
Shedding light on miR-26a: Another key regulator of angiogenesis in diabetic wound healing. [score:2]
Although miR-26 has also been shown to play different roles presumably unrelated to pregnancy [62– 64], the robust (3-fold) increase in plasma miR-26 levels between Days 8 and 0 of pregnancy suggest that miR-26a could be potentially used as a diagnostic biomarker as early as the first week of pregnancy, which could significantly facilitate reproductive management of modern dairy herds. [score:1]
We identified and removed one outlier value for each of miR-101, miR-26a and let-7f on Day 8, and miR-19a on Day 0. Analyses of the remaining data showed a significant effect of Day of pregnancy (P < 0.05) for all 7 miRNAs (Fig 4). [score:1]
Specifically, we identify a subset of miRNAs (let-7f, let-7c, miR-30c, miR-101, miR-26a, miR-205 and miR-143), the levels of which increase distinctly in circulation (up to 6-fold) in Day 60 pregnant relative to non-pregnant (Day 0) cows, and which provide novel molecular candidates involved in the establishment of pregnancy in cattle. [score:1]
Mycobacterium tuberculosis decreases human macrophage IFN-gamma responsiveness through miR-132 and miR-26a. [score:1]
Significantly, an increase in plasma levels of miR-26a was identified as early as Day 8, much earlier than previously reported for any miRNA during pregnancy in any species, suggesting one of the biological role of this miRNA may be in the very initial stages of pregnancy, providing a potential unique diagnostic biomarker of early pregnancy. [score:1]
Remarkably, however, mean levels of miR-26a were distinctly increased as early as Day 8 (3.1-fold; P = 0.046), resulting from a net increase in miR-26a levels (ranging from 1.3- to 11.7-fold) in 8 of 10 animals between Days 0 and 8. In addition, levels of miR-101 tended to increase (2.3-fold, P = 0.069) on Day 16 relative to Day 8 with no further elevation in mean levels of that miRNA up to Day 60 (Fig 4). [score:1]
[1 to 20 of 12 sentences]
[+] score: 20
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-mir-18a, hsa-mir-21, hsa-mir-23a, hsa-mir-26a-1, hsa-mir-30a, hsa-mir-99a, hsa-mir-103a-2, hsa-mir-103a-1, mmu-mir-1a-1, mmu-mir-23b, mmu-mir-30a, mmu-mir-99a, mmu-mir-126a, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-138-2, hsa-mir-192, mmu-mir-204, mmu-mir-122, hsa-mir-204, hsa-mir-1-2, hsa-mir-23b, hsa-mir-122, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-138-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-126, hsa-mir-138-1, mmu-mir-192, mmu-let-7a-1, mmu-let-7a-2, mmu-mir-18a, mmu-mir-21a, mmu-mir-23a, mmu-mir-26a-1, mmu-mir-103-1, mmu-mir-103-2, hsa-mir-1-1, mmu-mir-1a-2, mmu-mir-26a-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-138-1, hsa-mir-26a-2, hsa-mir-376c, hsa-mir-381, mmu-mir-381, mmu-mir-133a-2, rno-let-7a-1, rno-let-7a-2, rno-mir-9a-1, rno-mir-9a-3, rno-mir-9a-2, rno-mir-18a, rno-mir-21, rno-mir-23a, rno-mir-23b, rno-mir-26a, rno-mir-30a, rno-mir-99a, rno-mir-103-2, rno-mir-103-1, rno-mir-122, rno-mir-126a, rno-mir-133a, rno-mir-138-2, rno-mir-138-1, rno-mir-192, rno-mir-204, mmu-mir-411, hsa-mir-451a, mmu-mir-451a, rno-mir-451, hsa-mir-193b, rno-mir-1, mmu-mir-376c, rno-mir-376c, rno-mir-381, hsa-mir-574, hsa-mir-652, hsa-mir-411, bta-mir-103-1, bta-mir-16b, bta-mir-18a, bta-mir-21, bta-mir-99a, bta-mir-126, mmu-mir-652, bta-mir-138-2, bta-mir-192, bta-mir-23a, bta-mir-30a, bta-let-7a-1, bta-mir-122, bta-mir-23b, bta-let-7a-2, bta-let-7a-3, bta-mir-103-2, bta-mir-204, mmu-mir-193b, mmu-mir-574, rno-mir-411, rno-mir-652, mmu-mir-1b, hsa-mir-103b-1, hsa-mir-103b-2, bta-mir-1-2, bta-mir-1-1, bta-mir-133a-2, bta-mir-133a-1, bta-mir-138-1, bta-mir-193b, bta-mir-26a-1, bta-mir-381, bta-mir-411a, bta-mir-451, bta-mir-9-1, bta-mir-9-2, bta-mir-376c, bta-mir-1388, rno-mir-9b-3, rno-mir-9b-1, rno-mir-126b, rno-mir-9b-2, hsa-mir-451b, bta-mir-574, bta-mir-652, mmu-mir-21b, mmu-mir-21c, mmu-mir-451b, bta-mir-411b, bta-mir-411c, mmu-mir-126b, rno-mir-193b, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
The expression analysis of selected miRNAs using qRT-PCR also showed that miR-26a and -99a were highly expressed in all tissues, while miR-122 and miR-133a were predominantly expressed in liver and muscle, respectively. [score:7]
The expression profiles of the 11 miRNAs across 11 tissues confirmed that miR-26a and -99a expressed at high levels in all tissues, while miR-122 and -133a exclusively expressed in liver and muscle, respectively. [score:7]
The higher expression level of three conserved miRNAs (miR-26a, -99a and -150) in all tested bovine tissues suggest that these miRNA may be more relevant to the highly conserved biological process in mammalians. [score:3]
To validate above miRNA expression patterns, quantitative RT-PCR was performed on tissue-specific miRNAs (miR-122, -133a), high cloning frequency miRNAs (miR-26a, -99a and -150) and low cloning frequency miRNAs (miR-103, -107, -411, -423-5p, -574-3p and -652). [score:3]
[1 to 20 of 4 sentences]
[+] score: 18
Host miR-26a suppresses replication of porcine reproductive and respiratory syndrome virus by upregulating type I interferons. [score:6]
Previous reports have shown that host miR-23 and miR-26a inhibited porcine reproductive and respiratory syndrome virus (PRRSV) replication in vitro strongly by activating the type I interferon (IFN) signaling pathway and promoting the expression of IFN-stimulated genes (Zhang et al., 2014; Jia et al., 2015; Li et al., 2015). [score:5]
In our study, miR-23, miR-26a, and miR-21 were downregulated following CPIV3 infection, respectively. [score:4]
Cellular microRNA miR-26a suppresses replication of porcine reproductive and respiratory syndrome virus by activating innate antiviral immunity. [score:3]
[1 to 20 of 4 sentences]
[+] score: 14
Among the top 10 abundantly expressed miRNAs in each group, 7 miRNAs (bta-miR-26a, bta-miR-10b, bta-let-7a-5p, bta-let-7f, bta-let-7i, bta-miR-27b and bta-miR-191) were commonly expressed in both preovulatory and subordinate follicles (Table 2). [score:5]
Among which, bta-miR-26a and bta-miR-10b were the two most abundantly expressed miRNAs with a read count of 49000 and 28169 in preovulatory dominant and 77,730 and 62,390 in subordinate follicles; accounting for 22.5 and 30% of the sequence reads aligned to known miRNAs, respectively. [score:3]
Interestingly, bta-miR-26a, bta-miR-10b and 3 isoforms of the let-7 family (bta-let-7a-5p, bta-let-7f and bta-let-7i) were among the top 10 abundantly expressed miRNAs in granulosa cells of both preovulatory dominant and subordinate follicles. [score:3]
Similarly, bta-miR-26a, let-7 family, bta-miR-10b and bta-miR-143 were among the top 10 abundantly expressed miRNAs in bovine ovarian and testicular tissues [36]. [score:3]
[1 to 20 of 4 sentences]
[+] score: 12
Other miRNAs from this paper: bta-mir-101-2, bta-mir-148a, bta-mir-30d, bta-mir-126, bta-mir-181a-2, bta-mir-27b, bta-mir-30b, bta-mir-142, bta-mir-30e, bta-mir-148b, bta-mir-186, bta-mir-191, bta-mir-22, bta-mir-30a, bta-mir-150, bta-mir-30c, bta-mir-101-1, bta-mir-141, bta-mir-146a, bta-mir-223, bta-mir-26a-1, bta-mir-30f, bta-mir-181a-1, bta-mir-2284i, bta-mir-2285a, bta-mir-2284s, bta-mir-2285d, bta-mir-2284l, bta-mir-2284j, bta-mir-2284t, bta-mir-2285b-1, bta-mir-2284d, bta-mir-2284n, bta-mir-2284g, bta-mir-2284p, bta-mir-2284u, bta-mir-2284f, bta-mir-2284a, bta-mir-2284k, bta-mir-2284c, bta-mir-2284v, bta-mir-2285c, bta-mir-2284q, bta-mir-2284m, bta-mir-2284b, bta-mir-2284r, bta-mir-2284h, bta-mir-2284o, bta-mir-2284e, bta-mir-1388, bta-mir-2898, bta-mir-2904-1, bta-mir-2904-2, bta-mir-2904-3, bta-mir-2284w, bta-mir-2284x, bta-mir-148c, bta-mir-2284y-1, bta-mir-2285e-1, bta-mir-2285e-2, bta-mir-2285f-1, bta-mir-2285f-2, bta-mir-2285g-1, bta-mir-2285h, bta-mir-2285i, bta-mir-2285j-1, bta-mir-2285j-2, bta-mir-2285k-1, bta-mir-2285l, bta-mir-2285o-1, bta-mir-2285o-2, bta-mir-2285n-1, bta-mir-2285n-2, bta-mir-2285p, bta-mir-2285m-1, bta-mir-2285m-2, bta-mir-2284y-2, bta-mir-2285n-3, bta-mir-2285n-4, bta-mir-2284y-3, bta-mir-2285o-3, bta-mir-2285o-4, bta-mir-2285m-3, bta-mir-2284y-4, bta-mir-2284y-5, bta-mir-2284y-6, bta-mir-2285m-4, bta-mir-2285o-5, bta-mir-2285m-5, bta-mir-2285n-5, bta-mir-2285n-6, bta-mir-2284y-7, bta-mir-2285n-7, bta-mir-2284z-1, bta-mir-2284aa-1, bta-mir-2285k-2, bta-mir-2284z-3, bta-mir-2284aa-2, bta-mir-2284aa-3, bta-mir-2285k-3, bta-mir-2285k-4, bta-mir-2284z-4, bta-mir-2285k-5, bta-mir-2284z-5, bta-mir-2284z-6, bta-mir-2284z-7, bta-mir-2284aa-4, bta-mir-2285q, bta-mir-2285r, bta-mir-2285s, bta-mir-2285t, bta-mir-2285b-2, bta-mir-2285v, bta-mir-2284z-2, bta-mir-2285g-2, bta-mir-2285g-3, bta-mir-2285af-1, bta-mir-2285af-2, bta-mir-2285y, bta-mir-2285w, bta-mir-2285x, bta-mir-2285z, bta-mir-2285u, bta-mir-2285aa, bta-mir-2285ab, bta-mir-2284ab, bta-mir-2285ac, bta-mir-2285ad, bta-mir-2284ac, bta-mir-2285ae, bta-mir-1842, bta-mir-2285ag, bta-mir-2285ah, bta-mir-2285ai, bta-mir-2285aj, bta-mir-2285ak, bta-mir-2285al, bta-mir-2285am, bta-mir-2285ar, bta-mir-2285as-1, bta-mir-2285as-2, bta-mir-2285as-3, bta-mir-2285at-1, bta-mir-2285at-2, bta-mir-2285at-3, bta-mir-2285at-4, bta-mir-2285au, bta-mir-2285av, bta-mir-2285aw, bta-mir-2285ax-1, bta-mir-2285ax-2, bta-mir-2285ax-3, bta-mir-2285ay, bta-mir-2285az, bta-mir-2285an, bta-mir-2285ao-1, bta-mir-2285ao-2, bta-mir-2285ap, bta-mir-2285ao-3, bta-mir-2285aq-1, bta-mir-2285aq-2, bta-mir-2285ba-1, bta-mir-2285ba-2, bta-mir-2285bb, bta-mir-2285bc, bta-mir-2285bd, bta-mir-2285be, bta-mir-2285bf-1, bta-mir-2285bf-2, bta-mir-2285bf-3, bta-mir-2285bg, bta-mir-2285bh, bta-mir-2285bi-1, bta-mir-2285bi-2, bta-mir-2285bj-1, bta-mir-2285bj-2, bta-mir-2285bk, bta-mir-2285bl, bta-mir-2285bm, bta-mir-2285bn, bta-mir-2285bo, bta-mir-2285bp, bta-mir-2285bq, bta-mir-2285br, bta-mir-2285bs, bta-mir-2285bt, bta-mir-2285bu-1, bta-mir-2285bu-2, bta-mir-2285bv, bta-mir-2285bw, bta-mir-2285bx, bta-mir-2285by, bta-mir-2285bz, bta-mir-2285ca, bta-mir-2285cb, bta-mir-2285cc, bta-mir-2285cd, bta-mir-2285ce, bta-mir-2285cf, bta-mir-2285cg, bta-mir-148d, bta-mir-2285ch, bta-mir-2285ci, bta-mir-2285cj, bta-mir-2285ck, bta-mir-2285cl, bta-mir-2285cm, bta-mir-2285cn, bta-mir-2285co, bta-mir-2285cp, bta-mir-2285cq, bta-mir-2285cr-1, bta-mir-2285cr-2, bta-mir-2285cs, bta-mir-2285ct, bta-mir-2285cu, bta-mir-2285cv-1, bta-mir-2285cv-2, bta-mir-2285cw-1, bta-mir-2285cw-2, bta-mir-2285cx, bta-mir-2285cy, bta-mir-2285cz, bta-mir-2285da, bta-mir-2285db, bta-mir-2285dc, bta-mir-2285dd, bta-mir-2285de, bta-mir-2285df, bta-mir-2285dg, bta-mir-2285dh, bta-mir-2285di, bta-mir-2285dj, bta-mir-2285dk, bta-mir-2285dl-1, bta-mir-2285dl-2, bta-mir-2285dm
Additional supporting evidence includes the roles of plasma miR-141 as a biomarker for colon cancers [54], miR-186 as a tumor-suppressor for the development and progression of lung adenocarcinoma [55], miR-26a in miRNA biogenesis to target Lin28B and Zcchc11 as a suppression mechanism for tumor growth and metastasis [56], and miR-22 targeting of estrogen receptor α mRNA to inhibit estrogen signaling associated with some forms of breast cancer [57]. [score:12]
[1 to 20 of 1 sentences]
[+] score: 11
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-mir-21, hsa-mir-26a-1, hsa-mir-27a, hsa-mir-28, hsa-mir-30a, hsa-mir-96, hsa-mir-98, hsa-mir-99a, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-196a-1, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-30d, hsa-mir-34a, hsa-mir-196a-2, hsa-mir-199a-2, hsa-mir-23b, hsa-mir-27b, hsa-mir-125b-1, hsa-mir-143, hsa-mir-145, hsa-mir-152, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-194-1, hsa-mir-194-2, hsa-mir-200a, hsa-mir-99b, hsa-mir-26a-2, hsa-mir-378a, hsa-mir-342, hsa-mir-148b, hsa-mir-338, hsa-mir-335, hsa-mir-196b, hsa-mir-484, hsa-mir-486-1, hsa-mir-1271, hsa-mir-378d-2, bta-mir-103-1, bta-mir-148a, bta-mir-21, bta-mir-27a, bta-mir-30d, bta-mir-484, bta-mir-99a, bta-mir-125a, bta-mir-125b-1, bta-mir-145, bta-mir-199a-1, bta-mir-27b, bta-mir-98, bta-mir-148b, bta-mir-200a, bta-mir-30a, bta-let-7a-1, bta-mir-342, bta-mir-23b, bta-let-7a-2, bta-let-7a-3, bta-mir-103-2, bta-mir-125b-2, bta-mir-34a, bta-mir-99b, hsa-mir-885, hsa-mir-103b-1, hsa-mir-103b-2, bta-mir-143, bta-mir-152, bta-mir-16a, bta-mir-194-2, bta-mir-196a-2, bta-mir-196a-1, bta-mir-196b, bta-mir-199a-2, bta-mir-26a-1, bta-mir-28, bta-mir-335, bta-mir-338, bta-mir-378-1, bta-mir-486, bta-mir-885, bta-mir-96, bta-mir-1271, bta-mir-2299, bta-mir-199c, bta-mir-1388, bta-mir-194-1, bta-mir-378-2, hsa-mir-378b, bta-mir-3431, hsa-mir-378c, hsa-mir-4286, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, bta-mir-4286-1, bta-mir-4286-2, hsa-mir-378j, bta-mir-378b, bta-mir-378c, hsa-mir-486-2, bta-mir-378d, bta-mir-194b, bta-mir-194b-2
For example, miR-148a and miR-143 are highly expressed in both bovine and goat mammary glands during lactation [49]; miR-148a and miR-26a have been shown to demonstrate consistent expression patterns in bovine milk throughout the lactation period [50] and miR-21-5p increased in expression remarkably at fresh period compared with dry period [23]. [score:6]
Six (bta-miR-148a, miR-26a, miR-21-5p, miR-27b, le-7f and let-7a-5p), four (bta-miR-30a-5p, miR-26a, miR-21-5p and let-7a-5p) and five (bta-miR-148a, miR-26a, let-7a-5p, miR-143 and miR-21-5p) of the highly expressed miRNAs in our study are also among the top 10 highly expressed miRNAs detected respectively in bovine mammary epithelial cells (MAC-T) [43] and lactating glands [24, 48]. [score:5]
[1 to 20 of 2 sentences]
[+] score: 11
For example, it has been shown that global or liver-specific overexpression of miR-26a prevented obesity -induced metabolic complications by targeting several key regulators of hepatic energy metabolism and insulin signaling in mice fed an HFD [40]. [score:6]
Furthermore, a previous study showed that expression of miR-26a, an obesity-regulated miRNA, is regulated by NEFA in human adipocytes [19]. [score:5]
[1 to 20 of 2 sentences]
[+] score: 10
MiRNAs name Normalized expression level Mature sequences WF BF Goat-miR-146b-5p 186,997.77 158,761.10 ugagaacugaauuccauaggcugu Goat-miR-27b-3p 79,872.78 72,800.46 uucacaguggcuaaguucugc Goat-miR-205-5p 20,575.80 19,911.95 uccuucauuccaccggagucug Goat-miR-181a-2-5p 21,177.16 16,613.29 aacauucaacgcugucggugagu Goat-miR-181a-1-5p 21,176.79 16,613.08 aacauucaacgcugucggugagu Goat-miR-92a-3p 19,003.38 17,003.44 uauugcacuugucccggccugu Goat-miR-182-5p 14,218.79 13,630.30 uuuggcaaugguagaacucacacu Goat-miR-26a-1-5p 14,855.58 12,171.42 uucaaguaauccaggauaggcu Goat-miR-26a-2-5p 14,837.64 12,152.12 uucaaguaauccaggauaggcu Goat-let-7f-5p 10,685.28 8870.12 ugagguaguagauuguauaguu ijms-15-09531-t002_Table 2 Table 2 The five most abundantly expressed novel miRNAs in goat hair follicels. [score:5]
MiRNAs name Normalized expression level Mature sequences WF BF Goat-miR-146b-5p 186,997.77 158,761.10 ugagaacugaauuccauaggcugu Goat-miR-27b-3p 79,872.78 72,800.46 uucacaguggcuaaguucugc Goat-miR-205-5p 20,575.80 19,911.95 uccuucauuccaccggagucug Goat-miR-181a-2-5p 21,177.16 16,613.29 aacauucaacgcugucggugagu Goat-miR-181a-1-5p 21,176.79 16,613.08 aacauucaacgcugucggugagu Goat-miR-92a-3p 19,003.38 17,003.44 uauugcacuugucccggccugu Goat-miR-182-5p 14,218.79 13,630.30 uuuggcaaugguagaacucacacu Goat-miR-26a-1-5p 14,855.58 12,171.42 uucaaguaauccaggauaggcu Goat-miR-26a-2-5p 14,837.64 12,152.12 uucaaguaauccaggauaggcu Goat-let-7f-5p 10,685.28 8870.12 ugagguaguagauuguauaguu ijms-15-09531-t002_Table 2 Table 2 The five most abundantly expressed novel miRNAs in goat hair follicels. [score:5]
[1 to 20 of 2 sentences]
[+] score: 9
miR-21-5p mediates suppression of target genes to enhance upstream and downstream mTORC1 (mammalian target of rapamycin complex 1) signaling for postnatal growth [20] while miR-26a can enhance insulin sensitivity and suppress lipogenesis and gluconeogenesis [52]. [score:9]
[1 to 20 of 1 sentences]
[+] score: 9
Immune cell related miRNAs, such as miR-146a, miR-155, miR-221 or miR-15b, as well as highly expressed milk specific miRNAs like miR-148a, miR-221-5p, miR-30a-5p, miR-200a, miR-99a-5p, miR-7f demonstrated a significant correlation while approximately half of the highest expressed miRNAs (let-7a-5p, miR-26a, miR-200c, let-7f, miR-92a) were not significantly correlated between both milk fractions. [score:5]
The same study both identified and biologically-validated bta-miR-26a as differentially up-regulated between day 24 pregnant and non-pregnant heifers [72]. [score:4]
[1 to 20 of 2 sentences]
[+] score: 8
MiR-26 down-regulates TNF-alpha/NF-kappaB signalling and IL-6 expression by silencing HMGA1 and MALT1. [score:5]
miR-26 regulates inflammation through down -regulating IL-6 production [22], and miR-26b participates in the inflammatory response of LPS stimulated bovine alveolar macrophages by enhancing the NF-κB signaling pathway [23]. [score:3]
[1 to 20 of 2 sentences]
[+] score: 7
In the mammary glands of lactating goats, we found that miRNAs associated with cell proliferation (miR-26a, miR-21), conferring epithelial phenotype (miR-29a, miR-30a/d), immune response and development (miR-181, let-7a/b/f/g/i) were abundantly expressed, as well as miRNAs involved in lipid metabolism (miR-103, miR-23a, miR-27b, miR-200a/b/c). [score:4]
Specifically, miR-26a (cell proliferation) was the most abundantly expressed, followed by miR-148 (may control insulin content) and miR-21 (cell proliferation). [score:3]
[1 to 20 of 2 sentences]
[+] score: 7
Other miRNAs from this paper: hsa-let-7c, hsa-let-7d, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-20a, hsa-mir-21, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-99a, hsa-mir-148a, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-181a-2, hsa-mir-181a-1, hsa-mir-125b-1, hsa-mir-143, hsa-mir-125b-2, hsa-mir-126, hsa-mir-146a, hsa-mir-155, hsa-mir-106b, hsa-mir-99b, hsa-mir-26a-2, hsa-mir-378a, hsa-mir-151a, hsa-mir-450a-1, hsa-mir-452, hsa-mir-450a-2, hsa-mir-92b, hsa-mir-151b, hsa-mir-378d-2, bta-let-7f-2, bta-mir-148a, bta-mir-151, bta-mir-16b, bta-mir-20a, bta-mir-21, bta-mir-26b, bta-mir-99a, bta-mir-125b-1, bta-mir-126, bta-mir-181a-2, bta-mir-92a-2, bta-let-7d, bta-mir-17, bta-mir-450a-2, bta-mir-7-3, bta-let-7f-1, bta-let-7c, bta-mir-125b-2, bta-mir-15a, bta-mir-99b, hsa-mir-450b, bta-mir-106b, bta-mir-143, bta-mir-146a, bta-mir-155, bta-mir-16a, bta-mir-26a-1, bta-mir-378-1, bta-mir-452, bta-mir-92a-1, bta-mir-92b, bta-mir-7-2, bta-mir-7-1, bta-mir-181a-1, bta-mir-2284i, bta-mir-2285a, bta-mir-2284s, bta-mir-2285d, bta-mir-2284l, bta-mir-2284j, bta-mir-2284t, bta-mir-2285b-1, bta-mir-2284d, bta-mir-2284n, bta-mir-2284g, bta-mir-2284p, bta-mir-2284u, bta-mir-2284f, bta-mir-2284a, bta-mir-2284k, bta-mir-2284c, bta-mir-2284v, bta-mir-2285c, bta-mir-2284q, bta-mir-2284m, bta-mir-2284b, bta-mir-2284r, bta-mir-2284h, bta-mir-2284o, bta-mir-2284e, bta-mir-450a-1, bta-mir-378-2, hsa-mir-378b, bta-mir-2284w, bta-mir-2284x, hsa-mir-378c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, bta-mir-450b, bta-mir-2284y-1, bta-mir-2285e-1, bta-mir-2285e-2, bta-mir-2285f-1, bta-mir-2285f-2, bta-mir-2285g-1, bta-mir-2285h, bta-mir-2285i, bta-mir-2285j-1, bta-mir-2285j-2, bta-mir-2285k-1, bta-mir-2285l, hsa-mir-378j, bta-mir-2285o-1, bta-mir-2285o-2, bta-mir-2285n-1, bta-mir-2285n-2, bta-mir-2285p, bta-mir-2285m-1, bta-mir-2285m-2, bta-mir-2284y-2, bta-mir-378b, bta-mir-2285n-3, bta-mir-2285n-4, bta-mir-2284y-3, bta-mir-2285o-3, bta-mir-2285o-4, bta-mir-2285m-3, bta-mir-378c, bta-mir-2284y-4, bta-mir-2284y-5, bta-mir-2284y-6, bta-mir-2285m-4, bta-mir-2285o-5, bta-mir-2285m-5, bta-mir-2285n-5, bta-mir-2285n-6, bta-mir-2284y-7, bta-mir-2285n-7, bta-mir-2284z-1, bta-mir-2284aa-1, bta-mir-2285k-2, bta-mir-2284z-3, bta-mir-2284aa-2, bta-mir-2284aa-3, bta-mir-2285k-3, bta-mir-2285k-4, bta-mir-2284z-4, bta-mir-2285k-5, bta-mir-2284z-5, bta-mir-2284z-6, bta-mir-2284z-7, bta-mir-2284aa-4, bta-mir-2285q, bta-mir-2285r, bta-mir-2285s, bta-mir-2285t, bta-mir-2285b-2, bta-mir-2285v, bta-mir-2284z-2, bta-mir-2285g-2, bta-mir-2285g-3, bta-mir-2285af-1, bta-mir-2285af-2, bta-mir-2285y, bta-mir-2285w, bta-mir-2285x, bta-mir-2285z, bta-mir-2285u, bta-mir-2285aa, bta-mir-2285ab, bta-mir-2284ab, bta-mir-2285ac, bta-mir-2285ad, bta-mir-2284ac, bta-mir-2285ae, bta-mir-378d, bta-mir-2285ag, bta-mir-2285ah, bta-mir-2285ai, bta-mir-2285aj, bta-mir-2285ak, bta-mir-2285al, bta-mir-2285am, bta-mir-2285ar, bta-mir-2285as-1, bta-mir-2285as-2, bta-mir-2285as-3, bta-mir-2285at-1, bta-mir-2285at-2, bta-mir-2285at-3, bta-mir-2285at-4, bta-mir-2285au, bta-mir-2285av, bta-mir-2285aw, bta-mir-2285ax-1, bta-mir-2285ax-2, bta-mir-2285ax-3, bta-mir-2285ay, bta-mir-2285az, bta-mir-2285an, bta-mir-2285ao-1, bta-mir-2285ao-2, bta-mir-2285ap, bta-mir-2285ao-3, bta-mir-2285aq-1, bta-mir-2285aq-2, bta-mir-2285ba-1, bta-mir-2285ba-2, bta-mir-2285bb, bta-mir-2285bc, bta-mir-2285bd, bta-mir-2285be, bta-mir-2285bf-1, bta-mir-2285bf-2, bta-mir-2285bf-3, bta-mir-2285bg, bta-mir-2285bh, bta-mir-2285bi-1, bta-mir-2285bi-2, bta-mir-2285bj-1, bta-mir-2285bj-2, bta-mir-2285bk, bta-mir-2285bl, bta-mir-2285bm, bta-mir-2285bn, bta-mir-2285bo, bta-mir-2285bp, bta-mir-2285bq, bta-mir-2285br, bta-mir-2285bs, bta-mir-2285bt, bta-mir-2285bu-1, bta-mir-2285bu-2, bta-mir-2285bv, bta-mir-2285bw, bta-mir-2285bx, bta-mir-2285by, bta-mir-2285bz, bta-mir-2285ca, bta-mir-2285cb, bta-mir-2285cc, bta-mir-2285cd, bta-mir-2285ce, bta-mir-2285cf, bta-mir-2285cg, bta-mir-2285ch, bta-mir-2285ci, bta-mir-2285cj, bta-mir-2285ck, bta-mir-2285cl, bta-mir-2285cm, bta-mir-2285cn, bta-mir-2285co, bta-mir-2285cp, bta-mir-2285cq, bta-mir-2285cr-1, bta-mir-2285cr-2, bta-mir-2285cs, bta-mir-2285ct, bta-mir-2285cu, bta-mir-2285cv-1, bta-mir-2285cv-2, bta-mir-2285cw-1, bta-mir-2285cw-2, bta-mir-2285cx, bta-mir-2285cy, bta-mir-2285cz, bta-mir-2285da, bta-mir-2285db, bta-mir-2285dc, bta-mir-2285dd, bta-mir-2285de, bta-mir-2285df, bta-mir-2285dg, bta-mir-2285dh, bta-mir-2285di, bta-mir-2285dj, bta-mir-2285dk, bta-mir-2285dl-1, bta-mir-2285dl-2, bta-mir-2285dm
Other highly expressed microRNAs previously associated with endothelial cells included miR-21, miR-378, miR-20a, miR-17, and miR-26a [Kuehbacher et al., 2007; Wang and Olson, 2009; Bonauer et al., 2010]. [score:3]
The relative expression levels of the other five microRNAs in RMVs and OECs were also similar to those in RMECs, with the exception of miR-26a (Fig. 5C). [score:3]
The high level of miR-26a in RMVs, which is not maintained in RMECs, may be related to its function in cell cycle arrest [Kota et al., 2009]. [score:1]
[1 to 20 of 3 sentences]
[+] score: 7
Other miRNAs from this paper: bta-mir-26b, bta-mir-106b, bta-mir-26a-1, bta-mir-758, bta-mir-26c
Expression of ABCA1 was found to be correlated with beef traits in the LD muscle between 1 and 24 Months in Chinese Red Steppes [39]A SNP c27113G > A present in the ABCA1 gene was reported to have significant associations with conjugated linoleic acid (CLA) in the muscle of a Waagyu x Limousin reference population [40]miR-758, miR-26 and miR-106b all reported to target ABCA1 [41] KLF11 KLF11 is a ubiquitously expressed transcription factor which contains a Krüppel-like 3 zinc finger motif at the C-terminal end of the protein. [score:7]
[1 to 20 of 1 sentences]
[+] score: 6
Several of these were found to be differentially expressed in abnormal versus normal human sperm, including: miR-26a, −99a, −16, and −34b-3p [29]. [score:3]
Of the fifteen top expressed miRNA in undifferentiated spermatogonia (in vitro), six were present in the mature sperm we analyzed, including: let-7a, −7b, miR-26a, −16, −125b, and −24 [20]. [score:3]
[1 to 20 of 2 sentences]
[+] score: 6
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-21, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-99a, mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-99a, mmu-mir-140, mmu-mir-10b, mmu-mir-181a-2, mmu-mir-24-1, mmu-mir-191, hsa-mir-192, hsa-mir-148a, hsa-mir-30d, mmu-mir-122, hsa-mir-10b, hsa-mir-181a-2, hsa-mir-181a-1, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-122, hsa-mir-140, hsa-mir-191, hsa-mir-320a, mmu-mir-30d, mmu-mir-148a, mmu-mir-192, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-21a, mmu-mir-22, mmu-mir-24-2, mmu-mir-26a-1, mmu-mir-92a-2, mmu-mir-25, mmu-mir-181a-1, mmu-mir-26a-2, mmu-mir-92a-1, hsa-mir-26a-2, hsa-mir-423, hsa-mir-451a, mmu-mir-451a, hsa-mir-486-1, mmu-mir-486a, mmu-mir-423, bta-let-7f-2, bta-mir-148a, bta-mir-21, bta-mir-30d, bta-mir-320a-2, bta-mir-99a, bta-mir-181a-2, bta-mir-27b, bta-mir-140, bta-mir-92a-2, bta-let-7d, bta-mir-191, bta-mir-192, bta-mir-22, bta-mir-423, bta-let-7g, bta-mir-10b, bta-mir-24-2, bta-let-7a-1, bta-let-7f-1, bta-mir-122, bta-let-7i, bta-mir-25, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, hsa-mir-1246, bta-mir-24-1, bta-mir-26a-1, bta-mir-451, bta-mir-486, bta-mir-92a-1, bta-mir-181a-1, bta-mir-320a-1, mmu-mir-486b, hsa-mir-451b, bta-mir-1246, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-mir-451b, mmu-let-7k, hsa-mir-486-2
Several microRNAs had similar expression when comparing results from the present study with those of There were nine microRNAs (bta-miR-10b, bta-miR-423-3p, bta-miR-99a-5p, bta-miR-181a, bta-miR-423-5p, bta-miR-148a, bta-miR-26a, bta-miR-192, and bta-miR-486), that were upregulated in earlier stages of life in both studies. [score:6]
[1 to 20 of 1 sentences]
[+] score: 6
Serum levels of miR-16, miR-17, miR-20a, miR-20b, miR-26a, and miR-26b were up-regulated in an experimental sepsis condition induced by cecal ligation and puncture in mice 34, whereas over -expression of miR-21, miR-29b and miR-148a occurred in systemic lupus erythematosus 35 36. [score:6]
[1 to 20 of 1 sentences]
[+] score: 5
The miRNA bta-miR-26a was detected in all of our samples, with similar abundance levels observed among the groups. [score:1]
More specifically, they found that the bta-miR-26a level was correlated with early pregnancy in cattle. [score:1]
The levels of bta-miR-26a increased from gestational days 16 to 24 and, according to the authors, these changes may reflect a disturbance in the miRNA abundance patterns in one or more body tissues and might play an important role in pregnancy outcomes [24]. [score:1]
In humans, it has been demonstrated that increasing levels of hsa-miR-26a in the maternal circulation are associated with pregnancy. [score:1]
Our data suggest that, in cattle, bta-miR-26a may be involved in early pregnancy and its diagnosis, but not in the quality and maintenance of pregnancy. [score:1]
[1 to 20 of 5 sentences]
[+] score: 5
Other miRNAs from this paper: ssc-mir-122, ssc-mir-125b-2, ssc-mir-181b-2, ssc-mir-20a, ssc-mir-23a, ssc-mir-26a, ssc-mir-29b-1, ssc-mir-181c, ssc-mir-214, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-103-1, ssc-mir-107, ssc-mir-21, ssc-mir-29c, ssc-mir-30c-2, bta-mir-29a, bta-let-7f-2, bta-mir-103-1, bta-mir-20a, bta-mir-21, bta-mir-26b, bta-mir-30d, bta-mir-499, bta-mir-99a, bta-mir-125b-1, bta-mir-126, bta-mir-181a-2, bta-mir-199a-1, bta-mir-30b, bta-mir-107, bta-mir-10a, bta-mir-127, bta-mir-142, bta-mir-181b-2, bta-mir-30e, bta-mir-92a-2, bta-let-7d, bta-mir-132, bta-mir-138-2, bta-mir-17, bta-mir-181c, bta-mir-192, bta-mir-199b, bta-mir-200a, bta-mir-200c, bta-mir-214, bta-mir-23a, bta-mir-29b-2, bta-mir-29c, bta-mir-455, bta-let-7g, bta-mir-10b, bta-mir-30a, bta-mir-200b, bta-let-7a-1, bta-let-7f-1, bta-mir-122, bta-mir-30c, bta-let-7i, bta-mir-25, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-125b-2, bta-mir-99b, ssc-mir-99b, ssc-mir-17, ssc-mir-30b, ssc-mir-199b, bta-mir-1-2, bta-mir-1-1, bta-mir-129-1, bta-mir-129-2, bta-mir-133a-2, bta-mir-133a-1, bta-mir-133b, bta-mir-135b, bta-mir-138-1, bta-mir-143, bta-mir-144, bta-mir-146b, bta-mir-146a, bta-mir-181d, bta-mir-190a, bta-mir-199a-2, bta-mir-202, bta-mir-206, bta-mir-211, bta-mir-212, bta-mir-223, bta-mir-26a-1, bta-mir-29d, bta-mir-30f, bta-mir-338, bta-mir-33a, bta-mir-33b, bta-mir-375, bta-mir-429, bta-mir-451, bta-mir-92a-1, bta-mir-92b, bta-mir-29e, bta-mir-29b-1, bta-mir-181a-1, bta-mir-181b-1, ssc-mir-133a-1, ssc-mir-1, ssc-mir-146b, ssc-mir-181a-1, ssc-mir-30a, bta-mir-199c, ssc-mir-206, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-133b, ssc-mir-29a, ssc-mir-30d, ssc-mir-30e, ssc-mir-199a-2, ssc-mir-499, ssc-mir-143, ssc-mir-10a, ssc-mir-10b, ssc-mir-103-2, ssc-mir-181a-2, ssc-mir-181b-1, ssc-mir-181d, ssc-mir-99a, ssc-mir-92a-2, ssc-mir-92a-1, ssc-mir-92b, ssc-mir-192, ssc-mir-142, ssc-mir-127, ssc-mir-202, ssc-mir-129a, ssc-mir-455, ssc-mir-125b-1, ssc-mir-338, ssc-mir-133a-2, ssc-mir-146a, bta-mir-26c, ssc-mir-30c-1, ssc-mir-126, ssc-mir-199a-1, ssc-mir-451, ssc-let-7a-2, ssc-mir-129b, ssc-mir-429, ssc-let-7d, ssc-let-7f-2, ssc-mir-29b-2, ssc-mir-132, ssc-mir-138, ssc-mir-144, ssc-mir-190a, ssc-mir-212, bta-mir-133c, ssc-mir-26b, ssc-mir-200b, ssc-mir-223, ssc-mir-375, ssc-mir-33b
They recorded changes in the expression levels of eight miRNAs (miR-1a, miR-181a, miR-133a, miR-214, miR-133b, miR-206, miR-146, and miR-26a) shown to be involved in a strong resumption of myogenesis (Zhu et al., 2014). [score:3]
Ramachandra et al. (2008) discovered 14 miRNAs in early embryos (5 dpf); among these, miR-21, miR-30d, miR-92a, miR-200, and miR-26 are associated with differentiation and development. [score:2]
[1 to 20 of 2 sentences]
[+] score: 5
Gene targeted by the disease miRNA26. [score:5]
[1 to 20 of 1 sentences]
[+] score: 5
Of them five miRNAs (bta-miR-10b, -miR-26a, -miR-30a-5p, -miR-450a, and -miR-202) were as well-classified among the top 20 most abundantly expressed miRNAs. [score:3]
Bta-miR-26a and bta-miR-143, among others were identified as potential biomarkers. [score:1]
In total, 22 miRNAs (bta-miR-21-5p, -miR-143, -miR-10b, -let-7i, -miR-202, -miR-148a, -let-7f, -miR-3600, -miR-99a55p, -let-7a-5p, -miR-27b, -miT-100, -let7g, -miR-26a, -miR-378, -miR-30d, -miR-125b, -450a, -miR-30e-5p, -let-7b, -miR-199a-3p, and -miR-26c) contributed to the top twenty most abundantly sequenced miRNAs in the bovine CL. [score:1]
[1 to 20 of 3 sentences]
[+] score: 5
Interestingly, a study showed that another miRNA, miR-26a, targeted the cell cycle checkpoint kinase, ATM, in porcine follicular cells during atresia, leading to increased DNA breaking and apoptosis, and raising the possibility that miR-155 could exert a similar effect through targeting MSH2 in bovine theca cells. [score:5]
[1 to 20 of 1 sentences]
[+] score: 5
The geometric means of expression for the reference miRNAs miR-26a, miR-191 and let-7a were used for normalization of the target miRNAs. [score:5]
[1 to 20 of 1 sentences]
[+] score: 4
Other miRNAs from this paper: bta-mir-29a, bta-let-7f-2, bta-mir-16b, bta-mir-21, bta-mir-221, bta-mir-222, bta-mir-30d, bta-mir-99a, bta-mir-145, bta-mir-181a-2, bta-mir-199a-1, bta-mir-27b, bta-mir-142, bta-mir-181b-2, bta-mir-30e, bta-mir-92a-2, bta-let-7d, bta-mir-132, bta-mir-181c, bta-mir-191, bta-mir-199b, bta-mir-214, bta-mir-29b-2, bta-mir-29c, bta-mir-455, bta-let-7g, bta-mir-10b, bta-mir-24-2, bta-let-7a-1, bta-mir-150, bta-let-7f-1, bta-mir-122, bta-let-7i, bta-mir-34c, bta-mir-363, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-195, bta-mir-34a, bta-mir-365-1, bta-mir-99b, bta-mir-100, bta-mir-129-1, bta-mir-129-2, bta-mir-130a, bta-mir-130b, bta-mir-133a-2, bta-mir-133a-1, bta-mir-143, bta-mir-146b, bta-mir-146a, bta-mir-155, bta-mir-181d, bta-mir-182, bta-mir-183, bta-mir-184, bta-mir-24-1, bta-mir-196a-2, bta-mir-196a-1, bta-mir-199a-2, bta-mir-212, bta-mir-26a-1, bta-mir-28, bta-mir-29d, bta-mir-32, bta-mir-335, bta-mir-338, bta-mir-339a, bta-mir-346, bta-mir-365-2, bta-mir-378-1, bta-mir-383, bta-mir-409a, bta-mir-449a, bta-mir-449b, bta-mir-449c, bta-mir-592, bta-mir-708, bta-mir-92a-1, bta-mir-92b, bta-mir-29e, bta-mir-29b-1, bta-mir-1271, bta-mir-1249, bta-mir-181a-1, bta-mir-181b-1, bta-mir-2285a, bta-mir-2285d, bta-mir-2285b-1, bta-mir-2332, bta-mir-199c, bta-mir-2389, bta-mir-2285c, bta-mir-2404-1, bta-mir-449d, bta-mir-2411, bta-mir-2446, bta-mir-339b, bta-mir-2404-2, bta-mir-2483, bta-mir-424, bta-mir-378-2, bta-mir-409b, bta-mir-2285e-1, bta-mir-2285e-2, bta-mir-2285f-1, bta-mir-2285f-2, bta-mir-2285g-1, bta-mir-2285h, bta-mir-2285i, bta-mir-2285j-1, bta-mir-2285j-2, bta-mir-2285k-1, bta-mir-2285l, bta-mir-2285o-1, bta-mir-2285o-2, bta-mir-2285n-1, bta-mir-2285n-2, bta-mir-2285p, bta-mir-2285m-1, bta-mir-2285m-2, bta-mir-378b, bta-mir-2285n-3, bta-mir-2285n-4, bta-mir-2285o-3, bta-mir-2285o-4, bta-mir-2285m-3, bta-mir-378c, bta-mir-2285m-4, bta-mir-2285o-5, bta-mir-2285m-5, bta-mir-2285n-5, bta-mir-2285n-6, bta-mir-2285n-7, bta-mir-2285k-2, bta-mir-2285k-3, bta-mir-2285k-4, bta-mir-2285k-5, bta-mir-2285q, bta-mir-2285r, bta-mir-2285s, bta-mir-2285t, bta-mir-2285b-2, bta-mir-2285v, bta-mir-2285g-2, bta-mir-2285g-3, bta-mir-2285af-1, bta-mir-2285af-2, bta-mir-2285y, bta-mir-2285w, bta-mir-2285x, bta-mir-2285z, bta-mir-2285u, bta-mir-2285aa, bta-mir-2285ab, bta-mir-2285ac, bta-mir-2285ad, bta-mir-2285ae, bta-mir-378d, bta-mir-2285ag, bta-mir-2285ah, bta-mir-2285ai, bta-mir-2285aj, bta-mir-2285ak, bta-mir-2285al, bta-mir-2285am, bta-mir-2285ar, bta-mir-2285as-1, bta-mir-2285as-2, bta-mir-2285as-3, bta-mir-2285at-1, bta-mir-2285at-2, bta-mir-2285at-3, bta-mir-2285at-4, bta-mir-2285au, bta-mir-2285av, bta-mir-2285aw, bta-mir-2285ax-1, bta-mir-2285ax-2, bta-mir-2285ax-3, bta-mir-2285ay, bta-mir-2285az, bta-mir-2285an, bta-mir-2285ao-1, bta-mir-2285ao-2, bta-mir-2285ap, bta-mir-2285ao-3, bta-mir-2285aq-1, bta-mir-2285aq-2, bta-mir-2285ba-1, bta-mir-2285ba-2, bta-mir-2285bb, bta-mir-2285bc, bta-mir-2285bd, bta-mir-2285be, bta-mir-2285bf-1, bta-mir-2285bf-2, bta-mir-2285bf-3, bta-mir-2285bg, bta-mir-2285bh, bta-mir-2285bi-1, bta-mir-2285bi-2, bta-mir-2285bj-1, bta-mir-2285bj-2, bta-mir-2285bk, bta-mir-2285bl, bta-mir-2285bm, bta-mir-2285bn, bta-mir-2285bo, bta-mir-2285bp, bta-mir-2285bq, bta-mir-2285br, bta-mir-2285bs, bta-mir-2285bt, bta-mir-2285bu-1, bta-mir-2285bu-2, bta-mir-2285bv, bta-mir-2285bw, bta-mir-2285bx, bta-mir-2285by, bta-mir-2285bz, bta-mir-2285ca, bta-mir-2285cb, bta-mir-2285cc, bta-mir-2285cd, bta-mir-2285ce, bta-mir-2285cf, bta-mir-2285cg, bta-mir-2285ch, bta-mir-2285ci, bta-mir-2285cj, bta-mir-2285ck, bta-mir-2285cl, bta-mir-2285cm, bta-mir-2285cn, bta-mir-2285co, bta-mir-2285cp, bta-mir-2285cq, bta-mir-2285cr-1, bta-mir-2285cr-2, bta-mir-2285cs, bta-mir-2285ct, bta-mir-2285cu, bta-mir-2285cv-1, bta-mir-2285cv-2, bta-mir-2285cw-1, bta-mir-2285cw-2, bta-mir-2285cx, bta-mir-2285cy, bta-mir-2285cz, bta-mir-2285da, bta-mir-2285db, bta-mir-2285dc, bta-mir-2285dd, bta-mir-2285de, bta-mir-2285df, bta-mir-2285dg, bta-mir-2285dh, bta-mir-2285di, bta-mir-2285dj, bta-mir-2285dk, bta-mir-2285dl-1, bta-mir-2285dl-2, bta-mir-2285dm
For instance, the let-7 family members (bta-let-7f, bta-let-7a-5p, bta-let-7g and let-7i), bta-miR-10b, bta-miR-26a, bta-miR-99b and bta-miR-27b were among the highly expressed miRNAs in all follicular stages at both day 3 and day 7 of the estrous cycle. [score:3]
Among these, bta-miR-10b, bta-miR-26a, bta-miR-99b, bta-miR-27b, let-7 families (bta-let-7f, and bta-let-7a-5p) and bta-miR-92a appeared ≥10000 read counts in each sample (Figure 2). [score:1]
[1 to 20 of 2 sentences]
[+] score: 4
Other miRNAs from this paper: bta-mir-29a, bta-let-7f-2, bta-mir-151, bta-mir-21, bta-mir-27a, bta-mir-125b-1, bta-mir-205, bta-mir-27b, bta-mir-193a, bta-mir-98, bta-let-7d, bta-mir-17, bta-mir-200a, bta-mir-200c, bta-mir-210, bta-mir-29b-2, bta-mir-29c, bta-let-7g, bta-mir-200b, bta-let-7a-1, bta-mir-150, bta-let-7f-1, bta-let-7i, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-125b-2, bta-mir-15a, bta-mir-100, bta-mir-130a, bta-mir-146a, bta-mir-155, bta-mir-184, bta-mir-219-1, bta-mir-223, bta-mir-28, bta-mir-494, bta-mir-708, bta-mir-9-1, bta-mir-9-2, bta-mir-29e, bta-mir-29b-1, bta-mir-2284i, bta-mir-2285a, bta-mir-2284s, bta-mir-2285d, bta-mir-2284l, bta-mir-2284j, bta-mir-2284t, bta-mir-2285b-1, bta-mir-2284d, bta-mir-2284n, bta-mir-2284g, bta-mir-2284p, bta-mir-2284u, bta-mir-2284f, bta-mir-2284a, bta-mir-2284k, bta-mir-2284c, bta-mir-2284v, bta-mir-2285c, bta-mir-2284q, bta-mir-2284m, bta-mir-2284b, bta-mir-2284r, bta-mir-2284h, bta-mir-2284o, bta-mir-664a, bta-mir-2284e, bta-mir-2284w, bta-mir-2284x, bta-mir-3596, bta-mir-652, bta-mir-2284y-1, bta-mir-2285e-1, bta-mir-2285e-2, bta-mir-2285f-1, bta-mir-2285f-2, bta-mir-2285g-1, bta-mir-2285h, bta-mir-2285i, bta-mir-2285j-1, bta-mir-2285j-2, bta-mir-2285k-1, bta-mir-2285l, bta-mir-2285o-1, bta-mir-2285o-2, bta-mir-2285n-1, bta-mir-2285n-2, bta-mir-2285p, bta-mir-2285m-1, bta-mir-2285m-2, bta-mir-2284y-2, bta-mir-2285n-3, bta-mir-2285n-4, bta-mir-2284y-3, bta-mir-2285o-3, bta-mir-2285o-4, bta-mir-2285m-3, bta-mir-2284y-4, bta-mir-2284y-5, bta-mir-2284y-6, bta-mir-2285m-4, bta-mir-2285o-5, bta-mir-2285m-5, bta-mir-2285n-5, bta-mir-2285n-6, bta-mir-2284y-7, bta-mir-2285n-7, bta-mir-2284z-1, bta-mir-2284aa-1, bta-mir-2285k-2, bta-mir-2284z-3, bta-mir-2284aa-2, bta-mir-2284aa-3, bta-mir-2285k-3, bta-mir-2285k-4, bta-mir-2284z-4, bta-mir-2285k-5, bta-mir-2284z-5, bta-mir-2284z-6, bta-mir-2284z-7, bta-mir-2284aa-4, bta-mir-2285q, bta-mir-2285r, bta-mir-2285s, bta-mir-2285t, bta-mir-2285b-2, bta-mir-2285v, bta-mir-2284z-2, bta-mir-2285g-2, bta-mir-2285g-3, bta-mir-2285af-1, bta-mir-2285af-2, bta-mir-2285y, bta-mir-2285w, bta-mir-2285x, bta-mir-2285z, bta-mir-2285u, bta-mir-2285aa, bta-mir-2285ab, bta-mir-2284ab, bta-mir-664b, bta-mir-2285ac, bta-mir-2285ad, bta-mir-2284ac, bta-mir-2285ae, bta-mir-2285ag, bta-mir-2285ah, bta-mir-2285ai, bta-mir-2285aj, bta-mir-2285ak, bta-mir-2285al, bta-mir-2285am, bta-mir-2285ar, bta-mir-2285as-1, bta-mir-2285as-2, bta-mir-2285as-3, bta-mir-2285at-1, bta-mir-2285at-2, bta-mir-2285at-3, bta-mir-2285at-4, bta-mir-2285au, bta-mir-2285av, bta-mir-2285aw, bta-mir-2285ax-1, bta-mir-2285ax-2, bta-mir-2285ax-3, bta-mir-2285ay, bta-mir-2285az, bta-mir-2285an, bta-mir-2285ao-1, bta-mir-2285ao-2, bta-mir-2285ap, bta-mir-2285ao-3, bta-mir-2285aq-1, bta-mir-2285aq-2, bta-mir-2285ba-1, bta-mir-2285ba-2, bta-mir-2285bb, bta-mir-2285bc, bta-mir-2285bd, bta-mir-2285be, bta-mir-2285bf-1, bta-mir-2285bf-2, bta-mir-2285bf-3, bta-mir-2285bg, bta-mir-2285bh, bta-mir-2285bi-1, bta-mir-2285bi-2, bta-mir-2285bj-1, bta-mir-2285bj-2, bta-mir-2285bk, bta-mir-2285bl, bta-mir-2285bm, bta-mir-2285bn, bta-mir-2285bo, bta-mir-2285bp, bta-mir-2285bq, bta-mir-2285br, bta-mir-2285bs, bta-mir-2285bt, bta-mir-2285bu-1, bta-mir-2285bu-2, bta-mir-2285bv, bta-mir-2285bw, bta-mir-2285bx, bta-mir-2285by, bta-mir-2285bz, bta-mir-2285ca, bta-mir-2285cb, bta-mir-2285cc, bta-mir-2285cd, bta-mir-2285ce, bta-mir-2285cf, bta-mir-2285cg, bta-mir-2285ch, bta-mir-2285ci, bta-mir-2285cj, bta-mir-2285ck, bta-mir-2285cl, bta-mir-2285cm, bta-mir-2285cn, bta-mir-2285co, bta-mir-2285cp, bta-mir-2285cq, bta-mir-2285cr-1, bta-mir-2285cr-2, bta-mir-2285cs, bta-mir-2285ct, bta-mir-2285cu, bta-mir-2285cv-1, bta-mir-2285cv-2, bta-mir-2285cw-1, bta-mir-2285cw-2, bta-mir-2285cx, bta-mir-2285cy, bta-mir-2285cz, bta-mir-2285da, bta-mir-2285db, bta-mir-2285dc, bta-mir-2285dd, bta-mir-2285de, bta-mir-2285df, bta-mir-2285dg, bta-mir-2285dh, bta-mir-2285di, bta-mir-2285dj, bta-mir-2285dk, bta-mir-2285dl-1, bta-mir-2285dl-2, bta-mir-2285dm
Additionally, bta-miR-15a, bta-miR-17, bta-miR-26a-2, bta-miR-29a, bta-miR-29b-1, and bta-miR-193a were identified as down-regulated in the normalised data (both methods), but not in the un-normalised data. [score:4]
[1 to 20 of 1 sentences]
[+] score: 3
Through TGF-β signaling, miR-26a and miR-29 could regulate myogenic differentiation [34, 35]. [score:2]
Dey B. K. Gagan J. Yan Z. Dutta A. miR-26a is required for skeletal muscle differentiation and regeneration in mice Genes Dev. [score:1]
[1 to 20 of 2 sentences]
[+] score: 3
miRNA expression among steers varied considerably with type of miRNA, ranging from highly uniform such as miR-26a with a coefficient of variation (CV) of 0.05 to highly variable such as miR-2428 with a CV of 1.90 (Figure  3). [score:3]
[1 to 20 of 1 sentences]
[+] score: 3
Other miRNAs from this paper: mmu-let-7g, mmu-let-7i, mmu-mir-23b, mmu-mir-29b-1, mmu-mir-30b, mmu-mir-99a, mmu-mir-126a, mmu-mir-132, mmu-mir-141, mmu-mir-181a-2, mmu-mir-185, mmu-mir-193a, mmu-mir-199a-1, mmu-mir-200b, mmu-mir-34c, mmu-let-7d, mmu-mir-196a-1, mmu-mir-196a-2, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-20a, mmu-mir-22, mmu-mir-23a, mmu-mir-26a-1, mmu-mir-26b, mmu-mir-34a, mmu-mir-200c, mmu-mir-212, mmu-mir-181a-1, mmu-mir-26a-2, mmu-mir-29b-2, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-378a, mmu-mir-451a, mmu-mir-674, mmu-mir-423, mmu-mir-146b, bta-let-7f-2, bta-mir-16b, bta-mir-20a, bta-mir-26b, bta-mir-99a, bta-mir-126, bta-mir-181a-2, bta-mir-199a-1, bta-mir-30b, bta-mir-193a, bta-let-7d, bta-mir-132, bta-mir-199b, bta-mir-200a, bta-mir-200c, bta-mir-22, bta-mir-23a, bta-mir-29b-2, bta-mir-423, bta-let-7g, bta-mir-200b, bta-let-7a-1, bta-let-7f-1, bta-let-7i, bta-mir-23b, bta-mir-34c, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-34a, bta-mir-141, bta-mir-146b, bta-mir-16a, bta-mir-185, bta-mir-196a-2, bta-mir-196a-1, bta-mir-199a-2, bta-mir-212, bta-mir-26a-1, bta-mir-29b-1, bta-mir-181a-1, bta-mir-2284i, bta-mir-2284s, bta-mir-2284l, bta-mir-2284j, bta-mir-2284t, bta-mir-2284d, bta-mir-2284n, bta-mir-2284g, bta-mir-2284p, bta-mir-2284u, bta-mir-2284f, bta-mir-2284a, bta-mir-2284k, bta-mir-2284c, bta-mir-2284v, bta-mir-2284q, bta-mir-2284m, bta-mir-2284b, bta-mir-2284r, bta-mir-2284h, bta-mir-2284o, bta-mir-2284e, bta-mir-2284w, bta-mir-2284x, bta-mir-2284y-1, mmu-let-7j, bta-mir-2284y-2, bta-mir-2284y-3, bta-mir-2284y-4, bta-mir-2284y-5, bta-mir-2284y-6, bta-mir-2284y-7, bta-mir-2284z-1, bta-mir-2284aa-1, bta-mir-2284z-3, bta-mir-2284aa-2, bta-mir-2284aa-3, bta-mir-2284z-4, bta-mir-2284z-5, bta-mir-2284z-6, bta-mir-2284z-7, bta-mir-2284aa-4, bta-mir-2285t, bta-mir-2284z-2, mmu-let-7k, mmu-mir-126b, bta-mir-2284ab, bta-mir-2284ac
Relative expression of miR-200a-3p (TaqMan® ID 000502, Applied Biosystems), miR-26a-5p (TaqMan® ID 000405) and let-7c-5p (TaqMan® ID 000379) were determined by RT-qPCR, on Mastercycler RealPlex 4 (Eppendorf®), in epithelial (mammary gland at lactation day-12 (MG) and kidney (K)) and non-epithelial (brain (B) and liver (L)) mouse tissue samples. [score:3]
[1 to 20 of 1 sentences]
[+] score: 3
Two miRNAs, miR-10b-5p and miR-143-3p, were among the most expressed miRNAs in all preparations of all three tissues while miR-26a-5p and miR-30a-5p were also in the top ten miRNAs in all groups except cooked adrenal. [score:3]
[1 to 20 of 1 sentences]
[+] score: 3
In these two libraries, bta-let-7f, bta-miR-122, bta-miR-148a, bta-miR-192, bta-miR-21-5p, bta-miR-26a/c, and bta-miR-30a-5p were the dominantly expressed miRNAs (Table  S2). [score:3]
[1 to 20 of 1 sentences]
[+] score: 3
MiR-148a and miR-26a were the most abundantly expressed miRNAs since they accounted for more than 10% of the read counts in each stage of lactation. [score:3]
[1 to 20 of 1 sentences]
[+] score: 3
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-27a, hsa-mir-31, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-16-2, hsa-mir-192, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-181a-2, hsa-mir-205, hsa-mir-181a-1, hsa-mir-214, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-146a, hsa-mir-184, hsa-mir-186, hsa-mir-193a, hsa-mir-194-1, hsa-mir-155, hsa-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-219a-2, hsa-mir-99b, hsa-mir-26a-2, hsa-mir-365a, hsa-mir-365b, hsa-mir-374a, hsa-mir-148b, hsa-mir-423, hsa-mir-486-1, hsa-mir-499a, hsa-mir-532, hsa-mir-590, bta-let-7f-2, bta-mir-103-1, bta-mir-148a, bta-mir-16b, bta-mir-21, bta-mir-221, bta-mir-222, bta-mir-27a, bta-mir-499, bta-mir-125b-1, bta-mir-181a-2, bta-mir-205, bta-mir-27b, bta-mir-30b, bta-mir-31, bta-mir-193a, bta-let-7d, bta-mir-148b, bta-mir-186, bta-mir-191, bta-mir-192, bta-mir-200a, bta-mir-214, bta-mir-22, bta-mir-23a, bta-mir-29c, bta-mir-423, bta-let-7g, bta-mir-24-2, bta-let-7a-1, bta-mir-532, bta-let-7f-1, bta-mir-30c, bta-let-7i, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-125b-2, bta-mir-365-1, bta-mir-374a, bta-mir-99b, hsa-mir-374b, hsa-mir-664a, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-1915, bta-mir-146a, bta-mir-155, bta-mir-16a, bta-mir-184, bta-mir-24-1, bta-mir-194-2, bta-mir-219-1, bta-mir-223, bta-mir-26a-1, bta-mir-365-2, bta-mir-374b, bta-mir-486, bta-mir-763, bta-mir-9-1, bta-mir-9-2, bta-mir-181a-1, bta-mir-2284i, bta-mir-2284s, bta-mir-2284l, bta-mir-2284j, bta-mir-2284t, bta-mir-2284d, bta-mir-2284n, bta-mir-2284g, bta-mir-2339, bta-mir-2284p, bta-mir-2284u, bta-mir-2284f, bta-mir-2284a, bta-mir-2284k, bta-mir-2284c, bta-mir-2284v, bta-mir-2284q, bta-mir-2284m, bta-mir-2284b, bta-mir-2284r, bta-mir-2284h, bta-mir-2284o, bta-mir-664a, bta-mir-2284e, bta-mir-1388, bta-mir-194-1, bta-mir-193a-2, bta-mir-2284w, bta-mir-2284x, bta-mir-148c, hsa-mir-374c, hsa-mir-219b, hsa-mir-499b, hsa-mir-664b, bta-mir-2284y-1, bta-mir-2284y-2, bta-mir-2284y-3, bta-mir-2284y-4, bta-mir-2284y-5, bta-mir-2284y-6, bta-mir-2284y-7, bta-mir-2284z-1, bta-mir-2284aa-1, bta-mir-2284z-3, bta-mir-2284aa-2, bta-mir-2284aa-3, bta-mir-2284z-4, bta-mir-2284z-5, bta-mir-2284z-6, bta-mir-2284z-7, bta-mir-2284aa-4, bta-mir-2284z-2, hsa-mir-486-2, hsa-mir-6516, bta-mir-2284ab, bta-mir-664b, bta-mir-6516, bta-mir-219-2, bta-mir-2284ac, bta-mir-219b, bta-mir-374c, bta-mir-148d
Most of the detected top expressed miRNAs are conserved in human, mouse, and bovine, and belong to several miRNA families, vis, miR-31, miR-26a, miR-27a-3p/27b, let-7a-5p/7f/7i, miR-21-5p, miR-22-3p, miR-184, miR-186, miR-191, miR-205 and miR221/222. [score:3]
[1 to 20 of 1 sentences]
[+] score: 3
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-21, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-99a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-16-2, hsa-mir-192, hsa-mir-148a, hsa-mir-10b, hsa-mir-181a-2, hsa-mir-181a-1, hsa-mir-215, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-mir-15b, hsa-mir-27b, hsa-mir-125b-1, hsa-mir-141, hsa-mir-143, hsa-mir-152, hsa-mir-125b-2, hsa-mir-126, hsa-mir-146a, hsa-mir-184, hsa-mir-200c, hsa-mir-155, hsa-mir-29c, hsa-mir-200a, hsa-mir-99b, hsa-mir-296, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-378a, hsa-mir-342, hsa-mir-148b, hsa-mir-451a, ssc-mir-125b-2, ssc-mir-148a, ssc-mir-15b, ssc-mir-184, ssc-mir-224, ssc-mir-23a, ssc-mir-24-1, ssc-mir-26a, ssc-mir-29b-1, ssc-let-7f-1, ssc-mir-103-1, ssc-mir-21, ssc-mir-29c, hsa-mir-486-1, hsa-mir-499a, hsa-mir-671, hsa-mir-378d-2, bta-mir-29a, bta-let-7f-2, bta-mir-103-1, bta-mir-148a, bta-mir-16b, bta-mir-21, bta-mir-499, bta-mir-99a, bta-mir-125b-1, bta-mir-126, bta-mir-181a-2, bta-mir-27b, bta-mir-31, bta-mir-15b, bta-mir-215, bta-mir-30e, bta-mir-148b, bta-mir-192, bta-mir-200a, bta-mir-200c, bta-mir-23a, bta-mir-29b-2, bta-mir-29c, bta-mir-10b, bta-mir-24-2, bta-mir-30a, bta-mir-200b, bta-let-7a-1, bta-mir-342, bta-let-7f-1, bta-let-7a-2, bta-let-7a-3, bta-mir-103-2, bta-mir-125b-2, bta-mir-15a, bta-mir-99b, hsa-mir-664a, ssc-mir-99b, hsa-mir-103b-1, hsa-mir-103b-2, ssc-mir-15a, ssc-mir-16-2, ssc-mir-16-1, bta-mir-141, bta-mir-143, bta-mir-146a, bta-mir-152, bta-mir-155, bta-mir-16a, bta-mir-184, bta-mir-24-1, bta-mir-223, bta-mir-224, bta-mir-26a-1, bta-mir-296, bta-mir-29d, bta-mir-378-1, bta-mir-451, bta-mir-486, bta-mir-671, bta-mir-29e, bta-mir-29b-1, bta-mir-181a-1, ssc-mir-181a-1, ssc-mir-215, ssc-mir-30a, bta-mir-2318, bta-mir-2339, bta-mir-2430, bta-mir-664a, bta-mir-378-2, ssc-let-7a-1, ssc-mir-378-1, ssc-mir-29a, ssc-mir-30e, ssc-mir-499, ssc-mir-143, ssc-mir-10b, ssc-mir-486-1, ssc-mir-152, ssc-mir-103-2, ssc-mir-181a-2, ssc-mir-27b, ssc-mir-24-2, ssc-mir-99a, ssc-mir-148b, ssc-mir-664, ssc-mir-192, ssc-mir-342, ssc-mir-125b-1, oar-mir-21, oar-mir-29a, oar-mir-125b, oar-mir-181a-1, hsa-mir-378b, hsa-mir-378c, ssc-mir-296, ssc-mir-155, ssc-mir-146a, bta-mir-148c, ssc-mir-126, ssc-mir-378-2, ssc-mir-451, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-451b, hsa-mir-499b, ssc-let-7a-2, ssc-mir-486-2, hsa-mir-664b, hsa-mir-378j, ssc-let-7f-2, ssc-mir-29b-2, ssc-mir-31, ssc-mir-671, bta-mir-378b, bta-mir-378c, hsa-mir-486-2, oar-let-7a, oar-let-7f, oar-mir-103, oar-mir-10b, oar-mir-143, oar-mir-148a, oar-mir-152, oar-mir-16b, oar-mir-181a-2, oar-mir-200a, oar-mir-200b, oar-mir-200c, oar-mir-23a, oar-mir-26a, oar-mir-29b-1, oar-mir-30a, oar-mir-99a, bta-mir-664b, chi-let-7a, chi-let-7f, chi-mir-103, chi-mir-10b, chi-mir-125b, chi-mir-126, chi-mir-141, chi-mir-143, chi-mir-146a, chi-mir-148a, chi-mir-148b, chi-mir-155, chi-mir-15a, chi-mir-15b, chi-mir-16a, chi-mir-16b, chi-mir-184, chi-mir-192, chi-mir-200a, chi-mir-200b, chi-mir-200c, chi-mir-215, chi-mir-21, chi-mir-223, chi-mir-224, chi-mir-2318, chi-mir-23a, chi-mir-24, chi-mir-26a, chi-mir-27b, chi-mir-296, chi-mir-29a, chi-mir-29b, chi-mir-29c, chi-mir-30a, chi-mir-30e, chi-mir-342, chi-mir-378, chi-mir-451, chi-mir-499, chi-mir-671, chi-mir-99a, chi-mir-99b, bta-mir-378d, ssc-mir-378b, oar-mir-29b-2, ssc-mir-141, ssc-mir-200b, ssc-mir-223, bta-mir-148d
Additionally, a number of miRNAs including miR-148a, miR-26a, miR-21-5p, miR-27b, miR-143, bta-miR-30a-5p, let-7a-5p, let-7f, miR-10b, and miR-99a-5p are highly expressed in bovine mammary gland/mammary epithelial cells (Li et al., 2012a, 2014a; Jin et al., 2014a; Le Guillou et al., 2014) suggesting roles in the lactation process and mammary gland functions. [score:3]
[1 to 20 of 1 sentences]
[+] score: 2
Other miRNAs from this paper: hsa-let-7f-1, hsa-let-7f-2, hsa-mir-20a, hsa-mir-21, hsa-mir-26a-1, hsa-mir-34a, hsa-mir-182, hsa-mir-210, hsa-mir-215, hsa-mir-221, hsa-mir-1-2, hsa-mir-15b, hsa-mir-122, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-141, hsa-mir-144, hsa-mir-127, hsa-mir-1-1, hsa-mir-34b, hsa-mir-34c, hsa-mir-26a-2, hsa-mir-375, hsa-mir-133b, hsa-mir-20b, hsa-mir-429, hsa-mir-451a, hsa-mir-486-1, hsa-mir-802, bta-let-7f-2, bta-mir-16b, bta-mir-20a, bta-mir-21, bta-mir-221, bta-mir-34b, bta-mir-127, bta-mir-15b, bta-mir-20b, bta-mir-215, bta-mir-210, bta-let-7f-1, bta-mir-122, bta-mir-34c, bta-mir-34a, bta-mir-1-2, bta-mir-1-1, bta-mir-133a-2, bta-mir-133a-1, bta-mir-133b, bta-mir-141, bta-mir-144, bta-mir-16a, bta-mir-182, bta-mir-26a-1, bta-mir-375, bta-mir-429, bta-mir-451, bta-mir-486, bta-mir-2285a, bta-mir-2285d, bta-mir-2285b-1, bta-mir-2376, bta-mir-2285c, bta-mir-1388, bta-mir-3431, hsa-mir-451b, bta-mir-2285e-1, bta-mir-2285e-2, bta-mir-2285f-1, bta-mir-2285f-2, bta-mir-2285g-1, bta-mir-2285h, bta-mir-2285i, bta-mir-2285j-1, bta-mir-2285j-2, bta-mir-2285k-1, bta-mir-2285l, bta-mir-6119, bta-mir-2285o-1, bta-mir-2285o-2, bta-mir-2285n-1, bta-mir-2285n-2, bta-mir-2285p, bta-mir-2285m-1, bta-mir-2285m-2, bta-mir-2285n-3, bta-mir-2285n-4, bta-mir-2285o-3, bta-mir-2285o-4, bta-mir-2285m-3, bta-mir-2285m-4, bta-mir-2285o-5, bta-mir-2285m-5, bta-mir-2285n-5, bta-mir-2285n-6, bta-mir-2285n-7, bta-mir-2285k-2, bta-mir-6529a, bta-mir-2285k-3, bta-mir-2285k-4, bta-mir-2285k-5, bta-mir-2285q, bta-mir-2285r, bta-mir-2285s, bta-mir-2285t, bta-mir-2285b-2, bta-mir-2285v, hsa-mir-486-2, bta-mir-2285g-2, bta-mir-2285g-3, bta-mir-2285af-1, bta-mir-2285af-2, bta-mir-2285y, bta-mir-2285w, bta-mir-2285x, bta-mir-6529b, bta-mir-133c, bta-mir-2285z, bta-mir-2285u, bta-mir-2285aa, bta-mir-2285ab, bta-mir-2285ac, bta-mir-2285ad, bta-mir-2285ae, bta-mir-2285ag, bta-mir-2285ah, bta-mir-2285ai, bta-mir-2285aj, bta-mir-2285ak, bta-mir-2285al, bta-mir-2285am, bta-mir-2285ar, bta-mir-2285as-1, bta-mir-2285as-2, bta-mir-2285as-3, bta-mir-2285at-1, bta-mir-2285at-2, bta-mir-2285at-3, bta-mir-2285at-4, bta-mir-2285au, bta-mir-2285av, bta-mir-2285aw, bta-mir-2285ax-1, bta-mir-2285ax-2, bta-mir-2285ax-3, bta-mir-2285ay, bta-mir-2285az, bta-mir-2285an, bta-mir-2285ao-1, bta-mir-2285ao-2, bta-mir-2285ap, bta-mir-2285ao-3, bta-mir-2285aq-1, bta-mir-2285aq-2, bta-mir-2285ba-1, bta-mir-2285ba-2, bta-mir-2285bb, bta-mir-2285bc, bta-mir-2285bd, bta-mir-2285be, bta-mir-2285bf-1, bta-mir-2285bf-2, bta-mir-2285bf-3, bta-mir-2285bg, bta-mir-2285bh, bta-mir-2285bi-1, bta-mir-2285bi-2, bta-mir-2285bj-1, bta-mir-2285bj-2, bta-mir-2285bk, bta-mir-2285bl, bta-mir-2285bm, bta-mir-2285bn, bta-mir-2285bo, bta-mir-2285bp, bta-mir-2285bq, bta-mir-2285br, bta-mir-2285bs, bta-mir-2285bt, bta-mir-2285bu-1, bta-mir-2285bu-2, bta-mir-2285bv, bta-mir-2285bw, bta-mir-2285bx, bta-mir-2285by, bta-mir-2285bz, bta-mir-2285ca, bta-mir-2285cb, bta-mir-2285cc, bta-mir-2285cd, bta-mir-2285ce, bta-mir-2285cf, bta-mir-2285cg, bta-mir-2285ch, bta-mir-2285ci, bta-mir-2285cj, bta-mir-2285ck, bta-mir-2285cl, bta-mir-2285cm, bta-mir-2285cn, bta-mir-2285co, bta-mir-2285cp, bta-mir-2285cq, bta-mir-2285cr-1, bta-mir-2285cr-2, bta-mir-2285cs, bta-mir-2285ct, bta-mir-2285cu, bta-mir-2285cv-1, bta-mir-2285cv-2, bta-mir-2285cw-1, bta-mir-2285cw-2, bta-mir-2285cx, bta-mir-2285cy, bta-mir-2285cz, bta-mir-2285da, bta-mir-2285db, bta-mir-2285dc, bta-mir-2285dd, bta-mir-2285de, bta-mir-2285df, bta-mir-2285dg, bta-mir-2285dh, bta-mir-2285di, bta-mir-2285dj, bta-mir-2285dk, bta-mir-2285dl-1, bta-mir-2285dl-2, bta-mir-2285dm, hsa-mir-6529
Moreover, miRNAs enriched in the bovine blood cell fraction included many previously reported to be blood cell-derived in humans, such as miR-144, miR-451, let-7f, miR-26a, miR-15b, miR-20a, miR-16a, miR-16b and miR-486 [18, 25, 37, 39– 41]. [score:1]
We then sought to validate the results for these eight miRNAs (miR-122, miR-215, miR-133a, miR-144, miR-451, and miR-6119-5p, miR-26a and let-7f) using samples from an independent group of animals (four Holstein-Friesian cross cows, aged between 24 and 48 months, in late pregnancy or post-partum) and we confirmed differences in plasma and cell levels of seven miRNAs (Additional file  2); levels of miR-133a were very low (Ct 34–37) in the original group of animals and were undetectable in this second group. [score:1]
[1 to 20 of 2 sentences]
[+] score: 2
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-32, hsa-mir-33a, hsa-mir-99a, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, mmu-let-7g, mmu-let-7i, mmu-mir-15b, mmu-mir-99a, mmu-mir-126a, mmu-mir-128-1, mmu-mir-130a, mmu-mir-140, mmu-mir-154, mmu-mir-204, mmu-mir-143, hsa-mir-204, hsa-mir-211, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-222, hsa-mir-223, mmu-mir-301a, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-128-1, hsa-mir-130a, hsa-mir-140, hsa-mir-143, hsa-mir-126, hsa-mir-129-2, hsa-mir-154, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-26a-1, mmu-mir-26b, mmu-mir-29a, mmu-mir-29c, mmu-mir-27a, mmu-mir-129-2, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-340, mmu-mir-107, mmu-mir-32, mmu-mir-218-1, mmu-mir-218-2, mmu-mir-223, mmu-mir-26a-2, mmu-mir-211, mmu-mir-222, mmu-mir-128-2, hsa-mir-128-2, hsa-mir-29c, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-26a-2, hsa-mir-379, mmu-mir-379, hsa-mir-340, mmu-mir-409, hsa-mir-409, hsa-mir-499a, hsa-mir-455, hsa-mir-670, mmu-mir-1249, mmu-mir-670, mmu-mir-499, mmu-mir-455, bta-mir-29a, bta-let-7f-2, bta-mir-101-2, bta-mir-103-1, bta-mir-16b, bta-mir-222, bta-mir-26b, bta-mir-27a, bta-mir-499, bta-mir-99a, bta-mir-126, bta-mir-128-1, bta-mir-34b, bta-mir-107, bta-mir-140, bta-mir-15b, bta-mir-218-2, bta-let-7d, bta-mir-29c, bta-mir-455, bta-let-7g, bta-let-7a-1, bta-let-7f-1, bta-let-7i, bta-mir-34c, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-204, hsa-mir-1249, hsa-mir-1306, hsa-mir-103b-1, hsa-mir-103b-2, bta-mir-128-2, bta-mir-129-2, bta-mir-130a, bta-mir-143, bta-mir-154a, bta-mir-211, bta-mir-218-1, bta-mir-223, bta-mir-26a-1, bta-mir-301a, bta-mir-32, bta-mir-33a, bta-mir-340, bta-mir-379, bta-mir-409a, bta-mir-670, mmu-mir-1306, bta-mir-1306, bta-mir-1249, bta-mir-2284i, bta-mir-2285a, bta-mir-2284s, bta-mir-2285d, bta-mir-2284l, bta-mir-2284j, bta-mir-2284t, bta-mir-2285b-1, bta-mir-2284d, bta-mir-2284n, bta-mir-2284g, bta-mir-2284p, bta-mir-2284u, bta-mir-2284f, bta-mir-2284a, bta-mir-2284k, bta-mir-2284c, bta-mir-2284v, bta-mir-2285c, bta-mir-2284q, bta-mir-2284m, bta-mir-2284b, bta-mir-2284r, bta-mir-2284h, bta-mir-2284o, bta-mir-2284e, hsa-mir-1260b, bta-mir-2284w, bta-mir-2284x, bta-mir-409b, hsa-mir-499b, bta-mir-1260b, bta-mir-2284y-1, bta-mir-2285e-1, bta-mir-2285e-2, bta-mir-2285f-1, bta-mir-2285f-2, bta-mir-2285g-1, bta-mir-2285h, bta-mir-2285i, bta-mir-2285j-1, bta-mir-2285j-2, bta-mir-2285k-1, bta-mir-2285l, bta-mir-6119, mmu-let-7j, bta-mir-2285o-1, bta-mir-2285o-2, bta-mir-2285n-1, bta-mir-2285n-2, bta-mir-2285p, bta-mir-2285m-1, bta-mir-2285m-2, bta-mir-2284y-2, bta-mir-2285n-3, bta-mir-2285n-4, bta-mir-2284y-3, bta-mir-154c, bta-mir-154b, bta-mir-2285o-3, bta-mir-2285o-4, bta-mir-2285m-3, bta-mir-2284y-4, bta-mir-2284y-5, bta-mir-2284y-6, bta-mir-2285m-4, bta-mir-2285o-5, bta-mir-2285m-5, bta-mir-2285n-5, bta-mir-2285n-6, bta-mir-2284y-7, bta-mir-2285n-7, bta-mir-2284z-1, bta-mir-2284aa-1, bta-mir-2285k-2, bta-mir-2284z-3, bta-mir-2284aa-2, bta-mir-2284aa-3, bta-mir-2285k-3, bta-mir-2285k-4, bta-mir-2284z-4, bta-mir-2285k-5, bta-mir-2284z-5, bta-mir-2284z-6, bta-mir-2284z-7, bta-mir-2284aa-4, bta-mir-2285q, bta-mir-2285r, bta-mir-2285s, bta-mir-2285t, bta-mir-2285b-2, bta-mir-2285v, bta-mir-2284z-2, mmu-let-7k, mmu-mir-126b, bta-mir-2285g-2, bta-mir-2285g-3, bta-mir-2285af-1, bta-mir-2285af-2, bta-mir-2285y, bta-mir-2285w, bta-mir-2285x, bta-mir-2285z, bta-mir-2285u, bta-mir-2285aa, bta-mir-2285ab, bta-mir-2284ab, bta-mir-2285ac, bta-mir-2285ad, bta-mir-2284ac, bta-mir-2285ae, chi-let-7a, chi-let-7b, chi-let-7c, chi-let-7d, chi-let-7e, chi-let-7f, chi-let-7g, chi-let-7i, chi-mir-103, chi-mir-107, chi-mir-1249, chi-mir-126, chi-mir-1306, chi-mir-130a, chi-mir-140, chi-mir-143, chi-mir-154a, chi-mir-154b, chi-mir-15b, chi-mir-16b, chi-mir-204, chi-mir-211, chi-mir-222, chi-mir-223, chi-mir-2284a, chi-mir-2284b, chi-mir-2284c, chi-mir-2284d, chi-mir-2284e, chi-mir-26a, chi-mir-26b, chi-mir-27a, chi-mir-29a, chi-mir-29c, chi-mir-301a, chi-mir-33a, chi-mir-340, chi-mir-34b, chi-mir-34c, chi-mir-379, chi-mir-409, chi-mir-455, chi-mir-499, chi-mir-99a, bta-mir-2285ag, bta-mir-2285ah, bta-mir-2285ai, bta-mir-2285aj, bta-mir-2285ak, bta-mir-2285al, bta-mir-2285am, bta-mir-2285ar, bta-mir-2285as-1, bta-mir-2285as-2, bta-mir-2285as-3, bta-mir-2285at-1, bta-mir-2285at-2, bta-mir-2285at-3, bta-mir-2285at-4, bta-mir-2285au, bta-mir-2285av, bta-mir-2285aw, bta-mir-2285ax-1, bta-mir-2285ax-2, bta-mir-2285ax-3, bta-mir-2285ay, bta-mir-2285az, bta-mir-2285an, bta-mir-2285ao-1, bta-mir-2285ao-2, bta-mir-2285ap, bta-mir-2285ao-3, bta-mir-2285aq-1, bta-mir-2285aq-2, bta-mir-2285ba-1, bta-mir-2285ba-2, bta-mir-2285bb, bta-mir-2285bc, bta-mir-2285bd, bta-mir-2285be, bta-mir-2285bf-1, bta-mir-2285bf-2, bta-mir-2285bf-3, bta-mir-2285bg, bta-mir-2285bh, bta-mir-2285bi-1, bta-mir-2285bi-2, bta-mir-2285bj-1, bta-mir-2285bj-2, bta-mir-2285bk, bta-mir-2285bl, bta-mir-2285bm, bta-mir-2285bn, bta-mir-2285bo, bta-mir-2285bp, bta-mir-2285bq, bta-mir-2285br, bta-mir-2285bs, bta-mir-2285bt, bta-mir-2285bu-1, bta-mir-2285bu-2, bta-mir-2285bv, bta-mir-2285bw, bta-mir-2285bx, bta-mir-2285by, bta-mir-2285bz, bta-mir-2285ca, bta-mir-2285cb, bta-mir-2285cc, bta-mir-2285cd, bta-mir-2285ce, bta-mir-2285cf, bta-mir-2285cg, bta-mir-2285ch, bta-mir-2285ci, bta-mir-2285cj, bta-mir-2285ck, bta-mir-2285cl, bta-mir-2285cm, bta-mir-2285cn, bta-mir-2285co, bta-mir-2285cp, bta-mir-2285cq, bta-mir-2285cr-1, bta-mir-2285cr-2, bta-mir-2285cs, bta-mir-2285ct, bta-mir-2285cu, bta-mir-2285cv-1, bta-mir-2285cv-2, bta-mir-2285cw-1, bta-mir-2285cw-2, bta-mir-2285cx, bta-mir-2285cy, bta-mir-2285cz, bta-mir-2285da, bta-mir-2285db, bta-mir-2285dc, bta-mir-2285dd, bta-mir-2285de, bta-mir-2285df, bta-mir-2285dg, bta-mir-2285dh, bta-mir-2285di, bta-mir-2285dj, bta-mir-2285dk, bta-mir-2285dl-1, bta-mir-2285dl-2, bta-mir-2285dm
Previous studies indeed reported that conserved resident precursors such as mir-26a/b might cooperate with their host genes, the carboxy-terminal domain RNA polymerase II polypeptide A small phosphatase (CTDSP) family, in the regulatory network of G1/S phase transition [68]. [score:2]
[1 to 20 of 1 sentences]
[+] score: 1
Regarding the top 20 c-miRNAs, the c-miRNA profiles of both JB cattle groups were considerably similar to those of JSH cattle [24], except that in the latter, miR-15b, miR-19b, miR-20a, and miR-26a were not in the top 20 but were above 30. [score:1]
[1 to 20 of 1 sentences]
[+] score: 1
Type Gene ceRNA Ann cow miRNA MDBK 3′UTR miRNA chimeras Non-coding H19 Yes let-7 let-7 Coding PTEN PTENP1 No miR-21 Various miRNAs, mostly miR-27 CNOT6L Yes miR-17, miR-19 miR-17 and miR-25 VAPA Yes miR-17, miR-19 miR-17 ZEB2 Yes miR-26, miR-25 None KRAS KRAS1P Yes let-7 let-7 present, but mostly miR-27 and miR-222 HMGA2 No let-7 let-7 TGFBR3 No let-7 let-7 peak in exon, miR-15, -17, -21, -27 and -31 peaks in 3′UTRDefinitions of previously described ceRNAs in human or mouse were obtained from ref. [score:1]
[1 to 20 of 1 sentences]
[+] score: 1
However, in livestock, few studies have been described so far, with the exception of studies using porcine tissues where miR-93, miR-25, miR-106a, miR-17-5p, and miR-26a have been reported as stable reference miRNAs [12– 13]. [score:1]
[1 to 20 of 1 sentences]