sort by

19 publications mentioning bta-mir-145

Open access articles that are associated with the species Bos taurus and mention the gene name mir-145. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 27
We selected 8 miRNAs that were reported to be upregulated (miR-145, miR-143, miR-99a-5p) or downregulated (miR-155 and miR-142-3p, miR-132, miR-378) in follicular relative to luteal tissues of ruminants [19, 21] or differentially expressed in endometrium during the human menstrual cycle (miR-31) [48– 50]. [score:9]
In support of this, all 4 miRNAs that were expressed at higher levels on Day 0 than Day 8 of the oestrus cycle (let-7f, miR-125b, miR-99a-5p and miR-145) are also known to be expressed at higher levels in pre-ovulatory follicles than in corpora lutea of ruminant ovaries, consistent with their role in the follicle-to-luteal transition [21]. [score:5]
Moreover, the 4 miRNAs identified in our study to be differentially expressed during the oestrous cycle (let-7f, miR-125b, miR-99a-5p and miR-145; Fig 5) are indeed expressed naturally not only in the ovary but also (at lower levels) in many other tissues [55, 56], the relative contribution of which to circulating levels is not known. [score:5]
Finally, identified predicted KEGG pathways simultaneously targeted by two or more of the miRNAs identified in this study (miR-125b, let-7f, miR-99a-5p and miR-145), and those included ECM-receptor interaction, p53 signalling, Hippo signalling, Thyroid hormone and Cell cycle pathways (S5 File). [score:3]
S5 File KEGG pathways enriched among experimentally validated targets of let-7f, miR-125b, miR-99a-5p and miR-145 using miRPath 3.0 and TarBase 7.0. [score:3]
Accordingly, the circulating levels of these miRNAs were negatively correlated with plasma progesterone levels (ρ = -0.407; P = 0.049 and ρ = -0.404; P = 0.05 for miR-99a-5p and miR-145, respectively; S4 File), similar to let-7f above. [score:1]
Specifically, we identified an increase (up to 2.2-fold) in the levels of let-7f, miR-125b, miR-99a-5p and miR-145 during oestrus. [score:1]
[1 to 20 of 7 sentences]
2
[+] score: 24
Overexpression of miRNA-145 increased the transcription of genes associated with milk fat synthesis resulting in the expansion of the lipid droplet compartment, increase of triacylglycerol accumulation, and upregulation of the proportion of unsaturated fatty acids. [score:6]
Notably, insulin -induced gene 1 (INSIG1) is a direct target of miR-145. [score:4]
miRNA-145 -mediated downregulation of INSIG1 thus promotes cholesterol biosynthesis. [score:4]
Wang H. Shi H. Luo J. Yi Y. Yao D. Zhang X. Ma G. Loor J. J. MiR-145 regulates lipogenesis in goat mammary cells via targeting INSIG1 and epigenetic regulation of lipid-related genes J. Cell. [score:4]
Remarkably, inhibition of miRNA-145 increased methylation levels of FAS, SCD1, PPARG, and SREBP1. [score:3]
miRNA-145 is another miRNA epigenetically involved in the regulation of metabolism of fatty acids in goat MECs [126]. [score:2]
In contrast, silencing of miRNA-145 impaired fatty acid synthesis [126]. [score:1]
[1 to 20 of 7 sentences]
3
[+] score: 19
Similarly, for those indentified under CS diet, one was rumen specific (miR-2349), and five were tissue DE including three rumen up-regulated (miR-147, -93, and -27b), two liver DE (up-regulated, miR-874; down-regulated, miR-145down-regulated miRNA (miR-145) and one up-regulated miRNA (miR-874) and one mammary gland upregulated (let-7c). [score:19]
[1 to 20 of 1 sentences]
4
[+] score: 18
From this screened target set, we found that let-7b, mir-15b, mir-18a, mir-29a, mir-101, mir-125b, mir-126, mir-143, mir-145, mir-199a and mir-222 to have the highest number and overlapping targets (Figure 6). [score:5]
While miR-145 [76] and mir-199a [77] have recently been shown to be down-modulated in the tumor cells, the miR-222 is reported to be down-regulated in ovarian epithelial carcinomas [74]. [score:4]
The expression of all new miRNAs including nine annotated miRNAs (let-7b, mir-15b, mir-18a, mir-29a, mir-125b, mir-126, mir-145, mir-199a and mir-222) in 11 different bovine tissues were analyzed using semi-quantitative RT-PCR (details in Figure 4, Table 2 and Additional file 2). [score:3]
which are identified by our new screening approach, were already validated in wet lab experiments and reported as targets of multiple miRNAs (miR-145, miR-125b, miR-126 and miR-29) [69- 73]. [score:3]
For example, miR-199a, miR-145, miR-125b and let-7 clusters were found to be the most differentially regulated miRNAs in human ovarian cancer [74, 75]. [score:2]
This includes bomir-940 in the oviduct; bta-mir-222, bomir-F2422 and bomir-G2511 in the uterus; and bta-mir-29a, bomir-143, bta-mir-145, bta-mir-199, bomir-542 in the placenta. [score:1]
[1 to 20 of 6 sentences]
5
[+] score: 18
Of these miRNAs, miR-338-3p and miR-145-5p were further confirmed to regulate buffalo-specific targets through binding to the 28-bp insertion sites (Figures 3 and 4). [score:4]
Further dual-luciferase assays revealed that luciferase activity of psi-CHECK2-UTR-1 is significantly decreased in the presence of miR-145-5p (p=0.001) or miR-338-3p (p=0.004) (Figure 4C), suggesting that these miRNAs could directly decrease UTR-1 expression. [score:3]
The UTR-1 or UTR-1m construct was cotransfected into 293T cells with vectors expressing miR-338-3p or miR-145-5p or miR-neg. [score:3]
Similarly, the four miRNAs and miR-145-5p, particularly miR-125b-5p, miR-338-3p, and miR-145-5p, were confirmed to have high expression levels in both cattle and buffalo obex tissues (Figure 6A). [score:3]
Because the UTR-1 fragment contains the 28-bp insertion site (Figure 4A), the sequences have two putative sites to respectively bind miR-338-3p and miR-145-5p. [score:1]
For example, the 28-bp insertion allele in buffalo PRNP 3′UTR is located in a putative binding site for six miRNAs: miR-145-5p, miR-149-5p, miR-212-5p, miR-324-3p, miR-338-3p, and miR-668-5p. [score:1]
The regulatory differences between cattle and buffalo sequences were further confirmed by in vitro assays in miR-338-3p (ΔΔG=10.2 kcal/mol), miR-145-5p (ΔΔG=8.0 kcal/mol), miR-125b-5p (ΔΔG=6.8 kcal/mol), miR-331-3p (ΔΔG=4.7 kcal/mol), and miR-132-3p (ΔΔG=1.8 kcal/mol). [score:1]
For example, the ΔG (−32.7 kcal/mol) of buffalo 3′UTR fragment (g. 961-1020) with miR-145-5p is more negative than that of cattle (−24.7 kcal/mol), corresponding to higher stability of the miRNA-mRNA duplex (Figure 2A). [score:1]
Relatively high ΔΔG values were detected in miR-338-3p (10.2), miR-668-5p (8.1), miR-145-5p (8.0), miR-204-3p (7.7), and miR-125b-5p (6.8), suggesting that buffalo sequences have increased binding potential to most of the miRNAs. [score:1]
[1 to 20 of 9 sentences]
6
[+] score: 15
The expression of miR-223, miR-184, miR-132, miR-1246 and miR-130b were up-regulated while miR-196a, miR-205, miR-200b, miR-31 and miR-145 were down-regulated, which was in agreement with the high-throughput sequencing results (Figure 4). [score:9]
miRNA Target Genes miR-1246 ATP2B4, MAP3K1, ADCK3, PSD2, SLC5A1 miR-130b EXOC3L1, TIE1, BAZ2B, C3, GRAMD1C miR-145 HSD3B7, SLCO4A1, PDIA4, ACADL, PTPN11, KRT9, RASSF6, RNF43, LAMC2 miR-196a ADAP1, GPR97, POMT1 miR-200b ARID3A, MLXIP, GPR110 miR-205 IL13RA2, COL5A2, ADM, CXCR2, XPO6, SPSB1, FMO5, PSMF1 miR-31 MEX3D, PFKFB3, ST3GAL3, IL2RB, ANKRD32, MGST1 miR-184 HSPA1L, SLC25A15, HEG1, MAPRE2, ACP6, SYNE2 miR-223 TMEM165 miR-132 IQCA1 Figure 5 Gene ontology statistics. [score:3]
miRNA Target Genes miR-1246 ATP2B4, MAP3K1, ADCK3, PSD2, SLC5A1 miR-130b EXOC3L1, TIE1, BAZ2B, C3, GRAMD1C miR-145 HSD3B7, SLCO4A1, PDIA4, ACADL, PTPN11, KRT9, RASSF6, RNF43, LAMC2 miR-196a ADAP1, GPR97, POMT1 miR-200b ARID3A, MLXIP, GPR110 miR-205 IL13RA2, COL5A2, ADM, CXCR2, XPO6, SPSB1, FMO5, PSMF1 miR-31 MEX3D, PFKFB3, ST3GAL3, IL2RB, ANKRD32, MGST1 miR-184 HSPA1L, SLC25A15, HEG1, MAPRE2, ACP6, SYNE2 miR-223 TMEM165 miR-132 IQCA1 Figure 5 Gene ontology statistics. [score:3]
[1 to 20 of 3 sentences]
7
[+] score: 9
Similarly, temporally DE miRNAs, miR-146, miR-191, miR-33, miR-7, miR-99/100, miR-486, and miR-145 may target genes that accelerate gut tissue and immune system development. [score:4]
Temporally DE miRNAs in small intestine (miR-146, miR-191, miR-33, miR-7, miR-99/100, miR-486, miR-145, and miR-211) were predicted to be related to gut epithelial cells development, immune cells development, inflammatory response, and other functions (Table 1). [score:3]
A total of 13 regional and temporal DE miRNAs (regional DE miRNAs: miR-192, miR-194, miR-205, miR-31, and miR-196; temporal DE miRNAs: miR-146b, miR-191, miR-99a, miR-145, miR-211, miR-486, miR-33, miR-7, and miR-196b) that identified from miRNA-seq were selected for validation using stem-loop qRT-PCR. [score:1]
Functional analysis illustrated that miR-191, miR-33, miR-99/100, and miR-145 were mainly related to differentiation of leukocytes including lymphocytes. [score:1]
[1 to 20 of 4 sentences]
8
[+] score: 9
It was shown that miR-145 regulate lipogenesis via targeting the INSIG1 gene 59; miR-27a suppress triglyceride accumulation via targeting PPARɣ gene 60 while miR-152 enhance viability and multiplication capacity of cow mammary gland cells through regulation of DNMT1 gene 10. [score:9]
[1 to 20 of 1 sentences]
9
[+] score: 8
Similar examples of virally controlled host miRNA expression exists for the human papillomavirus HPV-31 where the virus appeared to downregulate the expression of hsa-miR-145, which in turn results in increased viral genome amplification [89]. [score:8]
[1 to 20 of 1 sentences]
10
[+] score: 7
microRNA miRBase Accession Mature Sequence (5'-3') Reference bta-let-7a MIMAT0003844 UGAGGUAGUAGGUUGUAUAGUU[29] bta-let-7b MIMAT0004331 UGAGGUAGUAGGUUGUGUGGUU[29] bta-let-7e MIMAT0004333 UGAGGUAGGAGGUUGUAUAGU[29] bta-let-7f MIMAT0003519 UGAGGUAGUAGAUUGUAUAGUU[29] bta-let-7g MIMAT0003838 UGAGGUAGUAGUUUGUACAGUU[29] bta-let-7i MIMAT0003851 UGAGGUAGUAGUUUGUGCUGUU[29] bta-miR-98 MIMAT0003809 UGAGGUAGUAAGUUGUAUUGUU[30] bta-miR-145 MIMAT0003542 GUCCAGUUUUCCCAGGAAUCCCU[29] Approximately 160 kb were sequenced from the 0.6 Mb to 3.9 Mb polled region on BTA01 for polymorphism detection by targeting known gene coding and regulatory regions as well as putative regulatory regions (Table 1). [score:5]
Disruption and alignment of the microRNA bta-let-7b seed sequence overlapping the location of SNP bSYNJ1_C3981T is shown in Figure 2. MicroRNA bta-mir-145 (Table 5) overlaps the location of the bSYNJ1_C3981T SNP, but the SNP is not within its seed sequence. [score:1]
microRNA miRBase Accession Mature Sequence (5'-3') Reference bta-let-7a MIMAT0003844 UGAGGUAGUAGGUUGUAUAGUU[29] bta-let-7b MIMAT0004331 UGAGGUAGUAGGUUGUGUGGUU[29] bta-let-7e MIMAT0004333 UGAGGUAGGAGGUUGUAUAGU[29] bta-let-7f MIMAT0003519 UGAGGUAGUAGAUUGUAUAGUU[29] bta-let-7g MIMAT0003838 UGAGGUAGUAGUUUGUACAGUU[29] bta-let-7i MIMAT0003851 UGAGGUAGUAGUUUGUGCUGUU[29] bta-miR-98 MIMAT0003809 UGAGGUAGUAAGUUGUAUUGUU[30] bta-miR-145 MIMAT0003542 GUCCAGUUUUCCCAGGAAUCCCU[29] A total of 13 novel SNPs concordant with the polled trait in Holsteins (Table 2) were identified. [score:1]
[1 to 20 of 3 sentences]
11
[+] score: 6
Moreover, miR-143 and miR-145, are highly expressed in adipose tissue, and are also abundantly expressed in the goat mammary glands as well, suggesting the same regulatory function of some miRNAs in mammary glands and adipose tissue. [score:6]
[1 to 20 of 1 sentences]
12
[+] score: 6
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-mir-21, hsa-mir-26a-1, hsa-mir-27a, hsa-mir-28, hsa-mir-30a, hsa-mir-96, hsa-mir-98, hsa-mir-99a, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-196a-1, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-30d, hsa-mir-34a, hsa-mir-196a-2, hsa-mir-199a-2, hsa-mir-23b, hsa-mir-27b, hsa-mir-125b-1, hsa-mir-143, hsa-mir-145, hsa-mir-152, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-194-1, hsa-mir-194-2, hsa-mir-200a, hsa-mir-99b, hsa-mir-26a-2, hsa-mir-378a, hsa-mir-342, hsa-mir-148b, hsa-mir-338, hsa-mir-335, hsa-mir-196b, hsa-mir-484, hsa-mir-486-1, hsa-mir-1271, hsa-mir-378d-2, bta-mir-26a-2, bta-mir-103-1, bta-mir-148a, bta-mir-21, bta-mir-27a, bta-mir-30d, bta-mir-484, bta-mir-99a, bta-mir-125a, bta-mir-125b-1, bta-mir-199a-1, bta-mir-27b, bta-mir-98, bta-mir-148b, bta-mir-200a, bta-mir-30a, bta-let-7a-1, bta-mir-342, bta-mir-23b, bta-let-7a-2, bta-let-7a-3, bta-mir-103-2, bta-mir-125b-2, bta-mir-34a, bta-mir-99b, hsa-mir-885, hsa-mir-103b-1, hsa-mir-103b-2, bta-mir-143, bta-mir-152, bta-mir-16a, bta-mir-194-2, bta-mir-196a-2, bta-mir-196a-1, bta-mir-196b, bta-mir-199a-2, bta-mir-26a-1, bta-mir-28, bta-mir-335, bta-mir-338, bta-mir-378-1, bta-mir-486, bta-mir-885, bta-mir-96, bta-mir-1271, bta-mir-2299, bta-mir-199c, bta-mir-1388, bta-mir-194-1, bta-mir-378-2, hsa-mir-378b, bta-mir-3431, hsa-mir-378c, hsa-mir-4286, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, bta-mir-4286-1, bta-mir-4286-2, hsa-mir-378j, bta-mir-378b, bta-mir-378c, hsa-mir-486-2, bta-mir-378d, bta-mir-194b, bta-mir-194b-2
When compared with the control period (day-14), we identified a total of 22 DE miRNAs at day+28 including 10 up-regulated (bta-miR-199c, miR-199a-3p, miR-98, miR-378, miR-21-5p, miR-148b, miR-34a, miR-152, miR-16a, and miR-28) and 12 down-regulated (bta-miR-200a, miR-145, miR-99a-5p, miR-125b, miR-99b, miR-125a, miR-96, miR-484, miR-1388-5p, miR-342, miR-486 and miR-1271) (Table  2). [score:6]
[1 to 20 of 1 sentences]
13
[+] score: 5
Yan et al. found that miRNA-145 inhibits mouse granulosa cell apoptosis by targeting the activin receptor 1B [35]. [score:5]
[1 to 20 of 1 sentences]
14
[+] score: 5
Statistically significant downregulation was confirmed for miR-9-5p and miR-145 only in the case of the HER cell cultures (for LIM, p ≤ 0.16 and p ≤ 0.053, respectively). [score:4]
Besides the abovementioned miRNAs promoting myoblast differentiation, a few identified molecules such as miR-29b [49], miR-31 [50], miR-9 [51], miR-145 [52], miR-194 [53], miR-378 [54], miR-449 [55], miR-503 [11, 27], miR-542, [56], and miR-660 [11] were described in the literature as skeletal muscle-related. [score:1]
[1 to 20 of 2 sentences]
15
[+] score: 5
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26b, hsa-mir-27a, hsa-mir-31, hsa-mir-33a, hsa-mir-99a, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-147a, hsa-mir-34a, hsa-mir-182, hsa-mir-199a-2, hsa-mir-212, hsa-mir-221, hsa-mir-224, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-132, hsa-mir-142, hsa-mir-145, hsa-mir-152, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-127, hsa-mir-134, hsa-mir-200c, hsa-mir-106b, hsa-mir-361, hsa-mir-148b, hsa-mir-20b, hsa-mir-410, hsa-mir-202, hsa-mir-503, hsa-mir-33b, hsa-mir-643, hsa-mir-659, bta-let-7f-2, bta-mir-103-1, bta-mir-148a, bta-mir-21, bta-mir-221, bta-mir-26b, bta-mir-27a, bta-mir-99a, bta-mir-125a, bta-mir-125b-1, bta-mir-199a-1, bta-mir-27b, bta-mir-30b, bta-mir-31, bta-mir-127, bta-mir-142, bta-mir-20b, bta-let-7d, bta-mir-132, bta-mir-148b, bta-mir-200c, bta-mir-22, bta-mir-23a, bta-mir-29b-2, bta-mir-361, bta-let-7g, bta-mir-24-2, bta-let-7a-1, bta-let-7f-1, bta-let-7i, bta-mir-25, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-125b-2, bta-mir-34a, hsa-mir-708, hsa-mir-147b, hsa-mir-877, hsa-mir-940, hsa-mir-548j, hsa-mir-302e, hsa-mir-103b-1, hsa-mir-103b-2, bta-mir-100, bta-mir-106b, bta-mir-130a, bta-mir-134, bta-mir-147, bta-mir-152, bta-mir-153-1, bta-mir-153-2, bta-mir-182, bta-mir-24-1, bta-mir-199a-2, bta-mir-202, bta-mir-212, bta-mir-224, bta-mir-33a, bta-mir-33b, bta-mir-410, bta-mir-708, bta-mir-877, bta-mir-940, bta-mir-29b-1, bta-mir-148c, bta-mir-503, bta-mir-148d
This study demonstrated that eight miRNAs (miR-503, miR-21, miR-29b, miR-142-3p, miR-34a, miR-152, miR-25 and miR-130a) were highly expressed, while nine miRNAs (miR-125a, miR-199a-3p, miR-125b, miR-99a, let-7c, miR-145, miR-31, miR-202 and miR-27b) were expressed at lower level between the follicular and luteal stages in ovine ovarian tissues. [score:5]
[1 to 20 of 1 sentences]
16
[+] score: 4
Meanwhile, miR-145 and miR-143 cooperatively target a network of transcription factors to promote differentiation and repress proliferation of smooth muscle cells [10]. [score:3]
In addition, miR-145 is found to be necessary for myocardin -induced reprogramming of adult fibroblasts into smooth muscle cells and can induce differentiation of multipotent neural crest stem cells into vascular smooth muscle [10]. [score:1]
[1 to 20 of 2 sentences]
17
[+] score: 3
In addition, the expression of three mammary gland tissue enriched miRNAs (bta-miR126-3p, miR-145-5p and miR-199a-5p) was significantly higher in mammary gland tissue than in the three milk fractions (p < 0.05). [score:3]
[1 to 20 of 1 sentences]
18
[+] score: 3
Other miRNAs from this paper: bta-mir-26a-2, bta-mir-29a, bta-let-7f-2, bta-mir-16b, bta-mir-21, bta-mir-221, bta-mir-222, bta-mir-30d, bta-mir-99a, bta-mir-181a-2, bta-mir-199a-1, bta-mir-27b, bta-mir-142, bta-mir-181b-2, bta-mir-30e, bta-mir-92a-2, bta-let-7d, bta-mir-132, bta-mir-181c, bta-mir-191, bta-mir-199b, bta-mir-214, bta-mir-29b-2, bta-mir-29c, bta-mir-455, bta-let-7g, bta-mir-10b, bta-mir-24-2, bta-let-7a-1, bta-mir-150, bta-let-7f-1, bta-mir-122, bta-let-7i, bta-mir-34c, bta-mir-363, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-195, bta-mir-34a, bta-mir-365-1, bta-mir-99b, bta-mir-100, bta-mir-129-1, bta-mir-129-2, bta-mir-130a, bta-mir-130b, bta-mir-133a-2, bta-mir-133a-1, bta-mir-143, bta-mir-146b, bta-mir-146a, bta-mir-155, bta-mir-181d, bta-mir-182, bta-mir-183, bta-mir-184, bta-mir-24-1, bta-mir-196a-2, bta-mir-196a-1, bta-mir-199a-2, bta-mir-212, bta-mir-26a-1, bta-mir-28, bta-mir-29d, bta-mir-32, bta-mir-335, bta-mir-338, bta-mir-339a, bta-mir-346, bta-mir-365-2, bta-mir-378-1, bta-mir-383, bta-mir-409a, bta-mir-449a, bta-mir-449b, bta-mir-449c, bta-mir-592, bta-mir-708, bta-mir-92a-1, bta-mir-92b, bta-mir-29e, bta-mir-29b-1, bta-mir-1271, bta-mir-1249, bta-mir-181a-1, bta-mir-181b-1, bta-mir-2285a, bta-mir-2285d, bta-mir-2285b-1, bta-mir-2332, bta-mir-199c, bta-mir-2389, bta-mir-2285c, bta-mir-2404-1, bta-mir-449d, bta-mir-2411, bta-mir-2446, bta-mir-339b, bta-mir-2404-2, bta-mir-2483, bta-mir-424, bta-mir-378-2, bta-mir-409b, bta-mir-2285e-1, bta-mir-2285e-2, bta-mir-2285f-1, bta-mir-2285f-2, bta-mir-2285g-1, bta-mir-2285h, bta-mir-2285i, bta-mir-2285j-1, bta-mir-2285j-2, bta-mir-2285k-1, bta-mir-2285l, bta-mir-2285o-1, bta-mir-2285o-2, bta-mir-2285n-1, bta-mir-2285n-2, bta-mir-2285p, bta-mir-2285m-1, bta-mir-2285m-2, bta-mir-378b, bta-mir-2285n-3, bta-mir-2285n-4, bta-mir-2285o-3, bta-mir-2285o-4, bta-mir-2285m-3, bta-mir-378c, bta-mir-2285m-4, bta-mir-2285o-5, bta-mir-2285m-5, bta-mir-2285n-5, bta-mir-2285n-6, bta-mir-2285n-7, bta-mir-2285k-2, bta-mir-2285k-3, bta-mir-2285k-4, bta-mir-2285k-5, bta-mir-2285q, bta-mir-2285r, bta-mir-2285s, bta-mir-2285t, bta-mir-2285b-2, bta-mir-2285v, bta-mir-2285g-2, bta-mir-2285g-3, bta-mir-2285af-1, bta-mir-2285af-2, bta-mir-2285y, bta-mir-2285w, bta-mir-2285x, bta-mir-2285z, bta-mir-2285u, bta-mir-2285aa, bta-mir-2285ab, bta-mir-2285ac, bta-mir-2285ad, bta-mir-2285ae, bta-mir-378d, bta-mir-2285ag, bta-mir-2285ah, bta-mir-2285ai, bta-mir-2285aj, bta-mir-2285ak, bta-mir-2285al, bta-mir-2285am, bta-mir-2285ar, bta-mir-2285as-1, bta-mir-2285as-2, bta-mir-2285as-3, bta-mir-2285at-1, bta-mir-2285at-2, bta-mir-2285at-3, bta-mir-2285at-4, bta-mir-2285au, bta-mir-2285av, bta-mir-2285aw, bta-mir-2285ax-1, bta-mir-2285ax-2, bta-mir-2285ax-3, bta-mir-2285ay, bta-mir-2285az, bta-mir-2285an, bta-mir-2285ao-1, bta-mir-2285ao-2, bta-mir-2285ap, bta-mir-2285ao-3, bta-mir-2285aq-1, bta-mir-2285aq-2, bta-mir-2285ba-1, bta-mir-2285ba-2, bta-mir-2285bb, bta-mir-2285bc, bta-mir-2285bd, bta-mir-2285be, bta-mir-2285bf-1, bta-mir-2285bf-2, bta-mir-2285bf-3, bta-mir-2285bg, bta-mir-2285bh, bta-mir-2285bi-1, bta-mir-2285bi-2, bta-mir-2285bj-1, bta-mir-2285bj-2, bta-mir-2285bk, bta-mir-2285bl, bta-mir-2285bm, bta-mir-2285bn, bta-mir-2285bo, bta-mir-2285bp, bta-mir-2285bq, bta-mir-2285br, bta-mir-2285bs, bta-mir-2285bt, bta-mir-2285bu-1, bta-mir-2285bu-2, bta-mir-2285bv, bta-mir-2285bw, bta-mir-2285bx, bta-mir-2285by, bta-mir-2285bz, bta-mir-2285ca, bta-mir-2285cb, bta-mir-2285cc, bta-mir-2285cd, bta-mir-2285ce, bta-mir-2285cf, bta-mir-2285cg, bta-mir-2285ch, bta-mir-2285ci, bta-mir-2285cj, bta-mir-2285ck, bta-mir-2285cl, bta-mir-2285cm, bta-mir-2285cn, bta-mir-2285co, bta-mir-2285cp, bta-mir-2285cq, bta-mir-2285cr-1, bta-mir-2285cr-2, bta-mir-2285cs, bta-mir-2285ct, bta-mir-2285cu, bta-mir-2285cv-1, bta-mir-2285cv-2, bta-mir-2285cw-1, bta-mir-2285cw-2, bta-mir-2285cx, bta-mir-2285cy, bta-mir-2285cz, bta-mir-2285da, bta-mir-2285db, bta-mir-2285dc, bta-mir-2285dd, bta-mir-2285de, bta-mir-2285df, bta-mir-2285dg, bta-mir-2285dh, bta-mir-2285di, bta-mir-2285dj, bta-mir-2285dk, bta-mir-2285dl-1, bta-mir-2285dl-2, bta-mir-2285dm
Others, miR-24, miR-122, miR-145, miR-182, miR-143 and miR-150 which increased progesterone level in human granulosa cells after they were over expressed [71] were found to be increased at day 7 of the estrous cycle. [score:3]
[1 to 20 of 1 sentences]
19
[+] score: 1
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-21, hsa-mir-23a, hsa-mir-30a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-196a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-196a-2, hsa-mir-210, hsa-mir-181a-1, hsa-mir-218-1, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-30b, hsa-mir-128-1, hsa-mir-145, hsa-mir-191, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-30c-1, hsa-mir-99b, hsa-mir-296, hsa-mir-30e, hsa-mir-361, hsa-mir-337, hsa-mir-148b, hsa-mir-196b, hsa-mir-425, hsa-mir-20b, hsa-mir-486-1, hsa-mir-488, hsa-mir-181d, hsa-mir-498, hsa-mir-519c, hsa-mir-520a, hsa-mir-526b, hsa-mir-520d, hsa-mir-506, hsa-mir-92b, hsa-mir-608, hsa-mir-617, hsa-mir-625, hsa-mir-641, hsa-mir-1264, hsa-mir-1271, bta-let-7f-2, bta-mir-103-1, bta-mir-148a, bta-mir-21, bta-mir-30d, bta-mir-128-1, bta-mir-181a-2, bta-mir-30b, bta-mir-181b-2, bta-mir-20b, bta-mir-30e, bta-mir-92a-2, bta-let-7d, bta-mir-148b, bta-mir-181c, bta-mir-191, bta-mir-210, bta-mir-23a, bta-mir-361, bta-mir-425, bta-let-7g, bta-mir-30a, bta-let-7a-1, bta-let-7f-1, bta-mir-30c, bta-let-7i, bta-mir-23b, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-99b, hsa-mir-890, hsa-mir-888, hsa-mir-889, hsa-mir-938, hsa-mir-1184-1, hsa-mir-1203, hsa-mir-1204, hsa-mir-1265, hsa-mir-103b-1, hsa-mir-103b-2, bta-mir-128-2, bta-mir-181d, bta-mir-196a-2, bta-mir-196a-1, bta-mir-196b, bta-mir-218-1, bta-mir-296, bta-mir-30f, bta-mir-486, bta-mir-488, bta-mir-92a-1, bta-mir-92b, bta-mir-1271, bta-mir-181a-1, bta-mir-181b-1, bta-mir-148c, hsa-mir-1184-2, hsa-mir-1184-3, hsa-mir-486-2, bta-mir-1264, bta-mir-148d
Interestingly, 14 miRNAs including let-7e, miR-92b, miR-337-3p, let-7f and miR-145 were affected in both SE and CE animal groups. [score:1]
[1 to 20 of 1 sentences]