sort by

30 publications mentioning bta-mir-92a-2

Open access articles that are associated with the species Bos taurus and mention the gene name mir-92a-2. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 20
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-21, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-99a, mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-99a, mmu-mir-140, mmu-mir-10b, mmu-mir-181a-2, mmu-mir-24-1, mmu-mir-191, hsa-mir-192, hsa-mir-148a, hsa-mir-30d, mmu-mir-122, hsa-mir-10b, hsa-mir-181a-2, hsa-mir-181a-1, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-122, hsa-mir-140, hsa-mir-191, hsa-mir-320a, mmu-mir-30d, mmu-mir-148a, mmu-mir-192, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-21a, mmu-mir-22, mmu-mir-24-2, mmu-mir-26a-1, mmu-mir-92a-2, mmu-mir-25, mmu-mir-181a-1, mmu-mir-26a-2, mmu-mir-92a-1, hsa-mir-26a-2, hsa-mir-423, hsa-mir-451a, mmu-mir-451a, hsa-mir-486-1, mmu-mir-486a, mmu-mir-423, bta-mir-26a-2, bta-let-7f-2, bta-mir-148a, bta-mir-21, bta-mir-30d, bta-mir-320a-2, bta-mir-99a, bta-mir-181a-2, bta-mir-27b, bta-mir-140, bta-let-7d, bta-mir-191, bta-mir-192, bta-mir-22, bta-mir-423, bta-let-7g, bta-mir-10b, bta-mir-24-2, bta-let-7a-1, bta-let-7f-1, bta-mir-122, bta-let-7i, bta-mir-25, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, hsa-mir-1246, bta-mir-24-1, bta-mir-26a-1, bta-mir-451, bta-mir-486, bta-mir-92a-1, bta-mir-181a-1, bta-mir-320a-1, mmu-mir-486b, hsa-mir-451b, bta-mir-1246, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-mir-451b, mmu-let-7k, hsa-mir-486-2
MiR-92a was down-regulated in IPF samples, while WISP1 was upregulated, and Berschneider et al. [28] provide evidence for WISP1 regulation by miR-92a in pulmonary fibrosis. [score:8]
Lai et al. [30], demonstrated that stimulation of TLR production in macrophages down-regulates miR-92a. [score:4]
Berschneider et al. [28], using human tissue from idiopathic pulmonary fibrosis (IPF) patients, determined that this condition is mediated by the WNT1-inducible signaling pathway protein-1 (WISP1), which is a target of miR-92a. [score:3]
Bta-miR-92a was down-regulated in the positive, compared to the negative group for the study herein. [score:3]
Serum antibody to M. bovis microRNA Negative Positive SE P-value bta-let-7b 11,691 15,421 1,200 0.0336 bta-miR-24-3p 15,908 24,390 1,495 0.0002 bta-miR-92a 83,405 64,330 4,156 0.0023 bta-miR-423-5p 124,920 101,818 6,315 0.0133 A total of 21 microRNAs were associated with season (Table 3). [score:1]
Bta-miR-92a is a candidate to be used as a diagnostic tool in animals exposed to the pathogen. [score:1]
[1 to 20 of 6 sentences]
2
[+] score: 12
Immune cell related miRNAs, such as miR-146a, miR-155, miR-221 or miR-15b, as well as highly expressed milk specific miRNAs like miR-148a, miR-221-5p, miR-30a-5p, miR-200a, miR-99a-5p, miR-7f demonstrated a significant correlation while approximately half of the highest expressed miRNAs (let-7a-5p, miR-26a, miR-200c, let-7f, miR-92a) were not significantly correlated between both milk fractions. [score:5]
In the MC fraction 18 miRNAs (up regulation: Bta-miR-25, -106b, -93, -140, 15a, -652, -26b, -221, -223, bta-let-7i, down regulation: Bta-miR-125a, -125b, -2898, -193a-5p, 320a, 100, -200c, -200b) and in SM 7 miRNAs (Bta-miR-92a, -20a, -25, -29b, -29c, -140, 21-5p) were found to be regulated (Fig 3A and 3B, Table 3). [score:4]
13 miRNAs (bta-miR-25, bta-miR-93, bta-miR-106b, bta-miR-125b, bta-miR-193a-5p, bta-miR-200b, bta-miR-200c, bta-miR-221, bta-miR-2898, bta-let-7i (MC); bta-miR-20a, bta-miR-29b, bta-miR-92 (SM)) which were found to be regulated during early pregnancy using NGS resutling, in case of MC miRNAs, in separation of cyclic and pregnant animals in PCA, were validated with RT-qPCR. [score:2]
Nevertheless, many potential biomarkers we found (MC: Bta-miR-25, -106b, -93, -221, -223 -193a-5p, -125a/b, -200c, -200b, bta-let-7i; SM: Bta-miR-92a, -20a, -29b/c) have been described to be involved in pregnancy in earlier studies [17, 18, 52– 54]. [score:1]
[1 to 20 of 4 sentences]
3
[+] score: 11
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-98, hsa-mir-99a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-10a, hsa-mir-10b, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-181a-1, hsa-mir-221, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-27b, hsa-mir-30b, hsa-mir-130a, hsa-mir-152, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-185, hsa-mir-193a, hsa-mir-320a, hsa-mir-200c, hsa-mir-1-1, hsa-mir-181b-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-99b, hsa-mir-130b, hsa-mir-30e, hsa-mir-363, hsa-mir-374a, hsa-mir-375, hsa-mir-378a, hsa-mir-148b, hsa-mir-331, hsa-mir-339, hsa-mir-423, hsa-mir-20b, hsa-mir-491, hsa-mir-193b, hsa-mir-181d, hsa-mir-92b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, bta-mir-29a, bta-let-7f-2, bta-mir-148a, bta-mir-18a, bta-mir-20a, bta-mir-221, bta-mir-27a, bta-mir-30d, bta-mir-320a-2, bta-mir-99a, bta-mir-181a-2, bta-mir-27b, bta-mir-30b, bta-mir-106a, bta-mir-10a, bta-mir-15b, bta-mir-181b-2, bta-mir-193a, bta-mir-20b, bta-mir-30e, bta-mir-98, bta-let-7d, bta-mir-148b, bta-mir-17, bta-mir-181c, bta-mir-191, bta-mir-200c, bta-mir-22, bta-mir-29b-2, bta-mir-29c, bta-mir-423, bta-let-7g, bta-mir-10b, bta-mir-24-2, bta-mir-30a, bta-let-7a-1, bta-let-7f-1, bta-mir-30c, bta-let-7i, bta-mir-25, bta-mir-363, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-15a, bta-mir-19a, bta-mir-19b, bta-mir-331, bta-mir-374a, bta-mir-99b, hsa-mir-374b, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, bta-mir-1-2, bta-mir-1-1, bta-mir-130a, bta-mir-130b, bta-mir-152, bta-mir-181d, bta-mir-182, bta-mir-185, bta-mir-24-1, bta-mir-193b, bta-mir-29d, bta-mir-30f, bta-mir-339a, bta-mir-374b, bta-mir-375, bta-mir-378-1, bta-mir-491, bta-mir-92a-1, bta-mir-92b, bta-mir-9-1, bta-mir-9-2, bta-mir-29e, bta-mir-29b-1, bta-mir-181a-1, bta-mir-181b-1, bta-mir-320b, bta-mir-339b, bta-mir-19b-2, bta-mir-320a-1, bta-mir-193a-2, bta-mir-378-2, hsa-mir-378b, hsa-mir-320e, hsa-mir-378c, bta-mir-148c, hsa-mir-374c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-378j, bta-mir-378b, bta-mir-378c, bta-mir-378d, bta-mir-374c, bta-mir-148d
MiR-92a, miR-19b and miR-363 were found to be highly expressed, while miR-17-5p, miR-18a, miR-20b and miR-106a were lowly expressed. [score:5]
As mentioned above, miR-17-5p, miR-363, miR-106a, miR-18a, miR-19b, miR-92a, miR-20b and miR-92b formed a complex cluster and family network, and they also showed different expression patterns. [score:3]
In our study, 8 miRNA families (let-7, mir-1, mir-17, mir-181, mir-148, mir-30, mir-92 and mir-99) were found with at least 3 members among all exosome miRNAs. [score:1]
In the genome, miR-92a/19b showed three copies; miR-363 and miR-20b had two copies; while miR-17, miR-18a and miR-106a had one copy. [score:1]
MiR-92a belongs to the miR-17 ~92 cluster with seven miRNAs (miR-17-5p, miR-17-3p, miR-18a, miR-19a, miR-19b, miR-20a and miR-92a) and was first described as an oncogenic miRNA cluster involved in B-cell lymphoma [61]. [score:1]
[1 to 20 of 5 sentences]
4
[+] score: 10
MiRNAs name Normalized expression level Mature sequences WF BF Goat-miR-146b-5p 186,997.77 158,761.10 ugagaacugaauuccauaggcugu Goat-miR-27b-3p 79,872.78 72,800.46 uucacaguggcuaaguucugc Goat-miR-205-5p 20,575.80 19,911.95 uccuucauuccaccggagucug Goat-miR-181a-2-5p 21,177.16 16,613.29 aacauucaacgcugucggugagu Goat-miR-181a-1-5p 21,176.79 16,613.08 aacauucaacgcugucggugagu Goat-miR-92a-3p 19,003.38 17,003.44 uauugcacuugucccggccugu Goat-miR-182-5p 14,218.79 13,630.30 uuuggcaaugguagaacucacacu Goat-miR-26a-1-5p 14,855.58 12,171.42 uucaaguaauccaggauaggcu Goat-miR-26a-2-5p 14,837.64 12,152.12 uucaaguaauccaggauaggcu Goat-let-7f-5p 10,685.28 8870.12 ugagguaguagauuguauaguu ijms-15-09531-t002_Table 2 Table 2 The five most abundantly expressed novel miRNAs in goat hair follicels. [score:5]
MiRNAs name Normalized expression level Mature sequences WF BF Goat-miR-146b-5p 186,997.77 158,761.10 ugagaacugaauuccauaggcugu Goat-miR-27b-3p 79,872.78 72,800.46 uucacaguggcuaaguucugc Goat-miR-205-5p 20,575.80 19,911.95 uccuucauuccaccggagucug Goat-miR-181a-2-5p 21,177.16 16,613.29 aacauucaacgcugucggugagu Goat-miR-181a-1-5p 21,176.79 16,613.08 aacauucaacgcugucggugagu Goat-miR-92a-3p 19,003.38 17,003.44 uauugcacuugucccggccugu Goat-miR-182-5p 14,218.79 13,630.30 uuuggcaaugguagaacucacacu Goat-miR-26a-1-5p 14,855.58 12,171.42 uucaaguaauccaggauaggcu Goat-miR-26a-2-5p 14,837.64 12,152.12 uucaaguaauccaggauaggcu Goat-let-7f-5p 10,685.28 8870.12 ugagguaguagauuguauaguu ijms-15-09531-t002_Table 2 Table 2 The five most abundantly expressed novel miRNAs in goat hair follicels. [score:5]
[1 to 20 of 2 sentences]
5
[+] score: 9
Other miRNAs from this paper: ssc-mir-122, ssc-mir-125b-2, ssc-mir-181b-2, ssc-mir-20a, ssc-mir-23a, ssc-mir-26a, ssc-mir-29b-1, ssc-mir-181c, ssc-mir-214, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-103-1, ssc-mir-107, ssc-mir-21, ssc-mir-29c, ssc-mir-30c-2, bta-mir-26a-2, bta-mir-29a, bta-let-7f-2, bta-mir-103-1, bta-mir-20a, bta-mir-21, bta-mir-26b, bta-mir-30d, bta-mir-499, bta-mir-99a, bta-mir-125b-1, bta-mir-126, bta-mir-181a-2, bta-mir-199a-1, bta-mir-30b, bta-mir-107, bta-mir-10a, bta-mir-127, bta-mir-142, bta-mir-181b-2, bta-mir-30e, bta-let-7d, bta-mir-132, bta-mir-138-2, bta-mir-17, bta-mir-181c, bta-mir-192, bta-mir-199b, bta-mir-200a, bta-mir-200c, bta-mir-214, bta-mir-23a, bta-mir-29b-2, bta-mir-29c, bta-mir-455, bta-let-7g, bta-mir-10b, bta-mir-30a, bta-mir-200b, bta-let-7a-1, bta-let-7f-1, bta-mir-122, bta-mir-30c, bta-let-7i, bta-mir-25, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-125b-2, bta-mir-99b, ssc-mir-99b, ssc-mir-17, ssc-mir-30b, ssc-mir-199b, bta-mir-1-2, bta-mir-1-1, bta-mir-129-1, bta-mir-129-2, bta-mir-133a-2, bta-mir-133a-1, bta-mir-133b, bta-mir-135b, bta-mir-138-1, bta-mir-143, bta-mir-144, bta-mir-146b, bta-mir-146a, bta-mir-181d, bta-mir-190a, bta-mir-199a-2, bta-mir-202, bta-mir-206, bta-mir-211, bta-mir-212, bta-mir-223, bta-mir-26a-1, bta-mir-29d, bta-mir-30f, bta-mir-338, bta-mir-33a, bta-mir-33b, bta-mir-375, bta-mir-429, bta-mir-451, bta-mir-92a-1, bta-mir-92b, bta-mir-29e, bta-mir-29b-1, bta-mir-181a-1, bta-mir-181b-1, ssc-mir-133a-1, ssc-mir-1, ssc-mir-146b, ssc-mir-181a-1, ssc-mir-30a, bta-mir-199c, ssc-mir-206, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-133b, ssc-mir-29a, ssc-mir-30d, ssc-mir-30e, ssc-mir-199a-2, ssc-mir-499, ssc-mir-143, ssc-mir-10a, ssc-mir-10b, ssc-mir-103-2, ssc-mir-181a-2, ssc-mir-181b-1, ssc-mir-181d, ssc-mir-99a, ssc-mir-92a-2, ssc-mir-92a-1, ssc-mir-92b, ssc-mir-192, ssc-mir-142, ssc-mir-127, ssc-mir-202, ssc-mir-129a, ssc-mir-455, ssc-mir-125b-1, ssc-mir-338, ssc-mir-133a-2, ssc-mir-146a, bta-mir-26c, ssc-mir-30c-1, ssc-mir-126, ssc-mir-199a-1, ssc-mir-451, ssc-let-7a-2, ssc-mir-129b, ssc-mir-429, ssc-let-7d, ssc-let-7f-2, ssc-mir-29b-2, ssc-mir-132, ssc-mir-138, ssc-mir-144, ssc-mir-190a, ssc-mir-212, bta-mir-133c, ssc-mir-26b, ssc-mir-200b, ssc-mir-223, ssc-mir-375, ssc-mir-33b
Furthermore, Qiang et al. (2017b) found three miRNAs (miR-310, miR-92, and miR-127) that were upregulated and four (miR-92d, miR-375, miR-146, and miR-694) that were downregulated by comparing a control group of Nile tilapia with a group infected with Streptococcus iniae. [score:7]
Ramachandra et al. (2008) discovered 14 miRNAs in early embryos (5 dpf); among these, miR-21, miR-30d, miR-92a, miR-200, and miR-26 are associated with differentiation and development. [score:2]
[1 to 20 of 2 sentences]
6
[+] score: 9
In eggs there are five abundantly expressed miRNAs including rmi-miR-1, rmi-miR-310/miR-92, rmi-miR-279, rmi-miR-275 and rmi-miR-71 that accounted for 80.6% of the total amount of miRNA transcripts (Figure 3A and Additional file 3), while in all other life stages miR-1 was the most abundantly expressed miRNA (Figure 3). [score:5]
Complete list of miRNAs and statistics are shown in Additional file 9. In male ticks we found 9 miRNAs up regulated in comparison to female ticks (P < 9.62E-05) including rmi-miR-133, rmi-miR-bantam, rmi-miR-279 and rmi-miR-310/miR-92 (Table 5 and Additional file 9). [score:2]
Complete list of miRNAs and statistics are shown in Additional file 9. In male ticks we found 9 miRNAs up regulated in comparison to female ticks (P < 9.62E-05) including rmi-miR-133, rmi-miR-bantam, rmi-miR-279 and rmi-miR-310/miR-92 (Table 5 and Additional file 9). [score:2]
[1 to 20 of 3 sentences]
7
[+] score: 8
MicroRNA-92a negatively regulates Toll-like receptor (TLR)-triggered inflammatory response in macrophages by targeting MKK4 kinase. [score:3]
miR-92a family and their target genes in tumorigenesis and metastasis. [score:3]
Oxidative stress activates endothelial innate immunity via sterol regulatory element binding protein 2 (SREBP2) transactivation of microRNA-92a. [score:2]
[1 to 20 of 3 sentences]
8
[+] score: 8
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-27a, hsa-mir-31, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-101-1, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-16-2, hsa-mir-192, hsa-mir-199a-1, hsa-mir-30c-2, hsa-mir-199a-2, hsa-mir-223, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-125b-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-140, hsa-mir-141, hsa-mir-152, hsa-mir-191, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-149, hsa-mir-150, hsa-mir-320a, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-101-2, hsa-mir-99b, hsa-mir-26a-2, hsa-mir-379, hsa-mir-423, hsa-mir-451a, hsa-mir-486-1, hsa-mir-496, hsa-mir-520a, hsa-mir-525, hsa-mir-518b, hsa-mir-516b-2, hsa-mir-516b-1, hsa-mir-516a-1, hsa-mir-516a-2, hsa-mir-92b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, bta-mir-26a-2, bta-let-7f-2, bta-mir-101-2, bta-mir-103-1, bta-mir-16b, bta-mir-20a, bta-mir-21, bta-mir-27a, bta-mir-320a-2, bta-mir-125a, bta-mir-125b-1, bta-mir-199a-1, bta-mir-31, bta-mir-140, bta-let-7d, bta-mir-132, bta-mir-191, bta-mir-192, bta-mir-22, bta-mir-23a, bta-mir-29c, bta-mir-423, bta-let-7g, bta-mir-24-2, bta-let-7a-1, bta-mir-150, bta-let-7f-1, bta-mir-30c, bta-let-7i, bta-mir-23b, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-125b-2, bta-mir-99b, hsa-mir-1249, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, bta-mir-101-1, bta-mir-133a-2, bta-mir-133a-1, bta-mir-141, bta-mir-152, bta-mir-16a, bta-mir-24-1, bta-mir-199a-2, bta-mir-223, bta-mir-26a-1, bta-mir-379, bta-mir-451, bta-mir-486, bta-mir-496, bta-mir-92a-1, bta-mir-92b, bta-mir-1249, bta-mir-320b, bta-mir-320a-1, hsa-mir-320e, hsa-mir-23c, hsa-mir-451b, bta-mir-149, hsa-mir-486-2
Out of the most abundant miRNAs in bovine plasma, miR-486 and miR-92a are reportedly expressed primarily in erythrocytes, and miR-191 is expressed primarily in platelets [31, 35]. [score:5]
b Expression level of the 20 most abundant miRNAs in bovine plasma (calculated as 2 [^(40-Ct)])Comparing the 20 most abundant miRNAs in each of the PCR array and sequencing datasets, only 6 miRNAs (miR-486, miR-22-3p, miR-191, miR-92a, miR-140 and miR-451) were common. [score:1]
b Expression level of the 20 most abundant miRNAs in bovine plasma (calculated as 2 [^(40-Ct)]) Comparing the 20 most abundant miRNAs in each of the PCR array and sequencing datasets, only 6 miRNAs (miR-486, miR-22-3p, miR-191, miR-92a, miR-140 and miR-451) were common. [score:1]
Common miRNAs identified across studies include miR-486, miR-92a, miR-192 and miR-423-5p. [score:1]
[1 to 20 of 4 sentences]
9
[+] score: 7
We analyzed the expression levels of nine inflammation-related miRNA in milk by qPCR and normalized the values obtained to the expression level of miR-92a [43]. [score:5]
ΔCT was calculated by subtracting the CT values of miR-92a [43] from the CT value of the target miRNA. [score:1]
S3 Table (A) CT values of miR-26b, miR-29b, miR-92a, miR-122, miR-125b, miR-222, miR-204, miR-205 and miR-383 in normal and mastitis cows. [score:1]
[1 to 20 of 3 sentences]
10
[+] score: 7
Among the 10 most abundant miRNAs in plasma (Fig 1C), miR-486 (the most abundant) and miR-92a are reportedly expressed primarily in red blood cells [37], whereas miR-191 is highly expressed in platelets [38]. [score:5]
Out of the 20 most abundant miRNAs in each of the sequencing and PCR array datasets, only six (miR-451, miR-486, miR-22-3p, miR-92a, miR-191 and miR-140) were common to both datasets (20% overlap). [score:1]
Four of the 10 most abundant miRNAs (miR-486, miR-92a, miR-192 and miR-423-5p) were also identified as highly abundant in bovine plasma in another study using Illumina technology [39]. [score:1]
[1 to 20 of 3 sentences]
11
[+] score: 7
Out of these miRNAs,miR-15b (up-regulated 2 folds) have been previously reported to show up-regulation using real-time RT-PCR in dose- and time -dependent manner along with other miRNAs (let-7d, miR-16, miR-25, miR-92a, miR-103, miR-107 and miR-451) in the whole blood of C57BL/6 mice injected with LPS [35]. [score:7]
[1 to 20 of 1 sentences]
12
[+] score: 6
Other miRNAs from this paper: bta-mir-26a-2, bta-mir-29a, bta-let-7f-2, bta-mir-16b, bta-mir-21, bta-mir-221, bta-mir-222, bta-mir-30d, bta-mir-99a, bta-mir-145, bta-mir-181a-2, bta-mir-199a-1, bta-mir-27b, bta-mir-142, bta-mir-181b-2, bta-mir-30e, bta-let-7d, bta-mir-132, bta-mir-181c, bta-mir-191, bta-mir-199b, bta-mir-214, bta-mir-29b-2, bta-mir-29c, bta-mir-455, bta-let-7g, bta-mir-10b, bta-mir-24-2, bta-let-7a-1, bta-mir-150, bta-let-7f-1, bta-mir-122, bta-let-7i, bta-mir-34c, bta-mir-363, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-195, bta-mir-34a, bta-mir-365-1, bta-mir-99b, bta-mir-100, bta-mir-129-1, bta-mir-129-2, bta-mir-130a, bta-mir-130b, bta-mir-133a-2, bta-mir-133a-1, bta-mir-143, bta-mir-146b, bta-mir-146a, bta-mir-155, bta-mir-181d, bta-mir-182, bta-mir-183, bta-mir-184, bta-mir-24-1, bta-mir-196a-2, bta-mir-196a-1, bta-mir-199a-2, bta-mir-212, bta-mir-26a-1, bta-mir-28, bta-mir-29d, bta-mir-32, bta-mir-335, bta-mir-338, bta-mir-339a, bta-mir-346, bta-mir-365-2, bta-mir-378-1, bta-mir-383, bta-mir-409a, bta-mir-449a, bta-mir-449b, bta-mir-449c, bta-mir-592, bta-mir-708, bta-mir-92a-1, bta-mir-92b, bta-mir-29e, bta-mir-29b-1, bta-mir-1271, bta-mir-1249, bta-mir-181a-1, bta-mir-181b-1, bta-mir-2285a, bta-mir-2285d, bta-mir-2285b-1, bta-mir-2332, bta-mir-199c, bta-mir-2389, bta-mir-2285c, bta-mir-2404-1, bta-mir-449d, bta-mir-2411, bta-mir-2446, bta-mir-339b, bta-mir-2404-2, bta-mir-2483, bta-mir-424, bta-mir-378-2, bta-mir-409b, bta-mir-2285e-1, bta-mir-2285e-2, bta-mir-2285f-1, bta-mir-2285f-2, bta-mir-2285g-1, bta-mir-2285h, bta-mir-2285i, bta-mir-2285j-1, bta-mir-2285j-2, bta-mir-2285k-1, bta-mir-2285l, bta-mir-2285o-1, bta-mir-2285o-2, bta-mir-2285n-1, bta-mir-2285n-2, bta-mir-2285p, bta-mir-2285m-1, bta-mir-2285m-2, bta-mir-378b, bta-mir-2285n-3, bta-mir-2285n-4, bta-mir-2285o-3, bta-mir-2285o-4, bta-mir-2285m-3, bta-mir-378c, bta-mir-2285m-4, bta-mir-2285o-5, bta-mir-2285m-5, bta-mir-2285n-5, bta-mir-2285n-6, bta-mir-2285n-7, bta-mir-2285k-2, bta-mir-2285k-3, bta-mir-2285k-4, bta-mir-2285k-5, bta-mir-2285q, bta-mir-2285r, bta-mir-2285s, bta-mir-2285t, bta-mir-2285b-2, bta-mir-2285v, bta-mir-2285g-2, bta-mir-2285g-3, bta-mir-2285af-1, bta-mir-2285af-2, bta-mir-2285y, bta-mir-2285w, bta-mir-2285x, bta-mir-2285z, bta-mir-2285u, bta-mir-2285aa, bta-mir-2285ab, bta-mir-2285ac, bta-mir-2285ad, bta-mir-2285ae, bta-mir-378d, bta-mir-2285ag, bta-mir-2285ah, bta-mir-2285ai, bta-mir-2285aj, bta-mir-2285ak, bta-mir-2285al, bta-mir-2285am, bta-mir-2285ar, bta-mir-2285as-1, bta-mir-2285as-2, bta-mir-2285as-3, bta-mir-2285at-1, bta-mir-2285at-2, bta-mir-2285at-3, bta-mir-2285at-4, bta-mir-2285au, bta-mir-2285av, bta-mir-2285aw, bta-mir-2285ax-1, bta-mir-2285ax-2, bta-mir-2285ax-3, bta-mir-2285ay, bta-mir-2285az, bta-mir-2285an, bta-mir-2285ao-1, bta-mir-2285ao-2, bta-mir-2285ap, bta-mir-2285ao-3, bta-mir-2285aq-1, bta-mir-2285aq-2, bta-mir-2285ba-1, bta-mir-2285ba-2, bta-mir-2285bb, bta-mir-2285bc, bta-mir-2285bd, bta-mir-2285be, bta-mir-2285bf-1, bta-mir-2285bf-2, bta-mir-2285bf-3, bta-mir-2285bg, bta-mir-2285bh, bta-mir-2285bi-1, bta-mir-2285bi-2, bta-mir-2285bj-1, bta-mir-2285bj-2, bta-mir-2285bk, bta-mir-2285bl, bta-mir-2285bm, bta-mir-2285bn, bta-mir-2285bo, bta-mir-2285bp, bta-mir-2285bq, bta-mir-2285br, bta-mir-2285bs, bta-mir-2285bt, bta-mir-2285bu-1, bta-mir-2285bu-2, bta-mir-2285bv, bta-mir-2285bw, bta-mir-2285bx, bta-mir-2285by, bta-mir-2285bz, bta-mir-2285ca, bta-mir-2285cb, bta-mir-2285cc, bta-mir-2285cd, bta-mir-2285ce, bta-mir-2285cf, bta-mir-2285cg, bta-mir-2285ch, bta-mir-2285ci, bta-mir-2285cj, bta-mir-2285ck, bta-mir-2285cl, bta-mir-2285cm, bta-mir-2285cn, bta-mir-2285co, bta-mir-2285cp, bta-mir-2285cq, bta-mir-2285cr-1, bta-mir-2285cr-2, bta-mir-2285cs, bta-mir-2285ct, bta-mir-2285cu, bta-mir-2285cv-1, bta-mir-2285cv-2, bta-mir-2285cw-1, bta-mir-2285cw-2, bta-mir-2285cx, bta-mir-2285cy, bta-mir-2285cz, bta-mir-2285da, bta-mir-2285db, bta-mir-2285dc, bta-mir-2285dd, bta-mir-2285de, bta-mir-2285df, bta-mir-2285dg, bta-mir-2285dh, bta-mir-2285di, bta-mir-2285dj, bta-mir-2285dk, bta-mir-2285dl-1, bta-mir-2285dl-2, bta-mir-2285dm
In addition, the expression of 12 miRNA families including miR-130 (a, b), bta-miR-181 (a, b, c, d), bta-miR-199 (a-3p, a-5p, b, c), bta-miR-2285 (k, t), bta-miR-2411 (- 3p,-5p), bta-miR-2483 (- 3p,-5p), bta-miR-29 (a, b), bta-miR-339 (a, b), bta-miR-365 (- 3p,-5p), bta-miR-455 (- 3p,-5p), bta-miR-92, and bta-miR-99 (a,-5p, b) were differentially expressed between the granulosa cells of SF and DF (Table 1). [score:5]
Among these, bta-miR-10b, bta-miR-26a, bta-miR-99b, bta-miR-27b, let-7 families (bta-let-7f, and bta-let-7a-5p) and bta-miR-92a appeared ≥10000 read counts in each sample (Figure 2). [score:1]
[1 to 20 of 2 sentences]
13
[+] score: 6
All other miRNAs tested (miR-15a, miR-23b-3p, miR-27b, miR-30d-5p, miR-92a, miR-140, miR-197, miR-345-5p, miR-451, miR-885, miR-2284x, miR-2295, miR-2412, and miR-2478) were not differently expressed between the groups (P > 0.10), except that miR-103 content tended to be higher in the grain-fed cattle than in the grazing cattle (P = 0.057). [score:3]
[1]log2(G/H): the value of log2(grazing/grain-fed)We then conducted qPCR for the contents of c-miRNAs of interest, not only to validate the results of microarray analysis for those 13 miRNAs and the miRNAs below the top 20 in SAM analysis (miR-29b, miR-197), but also to further explore potential feeding -induced miRNAs among adipose-enriched (miR-15a, miR-19a, miR-27b, miR-92a, miR-103, miR-142-5p), plasma-enriched (miR-2412, miR-2478), and bovine-specific (miR-2284x and miR-2295) miRNAs [31]. [score:1]
[1]log2(G/H): the value of log2(grazing/grain-fed) We then conducted qPCR for the contents of c-miRNAs of interest, not only to validate the results of microarray analysis for those 13 miRNAs and the miRNAs below the top 20 in SAM analysis (miR-29b, miR-197), but also to further explore potential feeding -induced miRNAs among adipose-enriched (miR-15a, miR-19a, miR-27b, miR-92a, miR-103, miR-142-5p), plasma-enriched (miR-2412, miR-2478), and bovine-specific (miR-2284x and miR-2295) miRNAs [31]. [score:1]
In contrast, the plasma samples were enriched with moderate concentrations of miRNAs associated with adipose tissue, such as miR-15a, miR-19a/b, miR-21, miR-27b, miR-92a/b, miR-103, miR-106a/b, miR-107, miR-125b, and miR-150 [11, 12]. [score:1]
[1 to 20 of 4 sentences]
14
[+] score: 4
Further, in another study [42], it was reported that MiR-92a inhibits porcine ovarian granulosa cell apoptosis by targeting Smad7 gene. [score:4]
[1 to 20 of 1 sentences]
15
[+] score: 4
Subsequently, we analyzed miRNA content and found a number of immune-related miRNAs expressed in these vesicles, including miR-21, miR-30a, miR-92a, miR-99a and miR-223 (Fig 1e). [score:3]
Sequence bta-miR-21 MI0004742 AUGCUUAUCAGACUGAUGUUGACU bta-miR-30a MI0005054 UGUAAACAUCCUCGACUGGAAGC bta-miR-92a MI0009905 UAUUGCACUUCUGGGCCGGUCU bta-miR-99a MI0004751 AACCCGUAGAUCCGAUCUUGU bta-miR-223 MI0009782 UGUCAGUUUGUCAAAUACCCCA Bovine milk-derived EVs were isolated as described above. [score:1]
[1 to 20 of 2 sentences]
16
[+] score: 3
MiR-486, miR-92a, miR-16, miR-144, and miR-451 have been commonly applied as erythrocyte markers for human and mice [40, 41], and they were all expressed in our bovine sera and exosomes dataset with high proportion. [score:3]
[1 to 20 of 1 sentences]
17
[+] score: 3
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-21, hsa-mir-23a, hsa-mir-30a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-196a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-196a-2, hsa-mir-210, hsa-mir-181a-1, hsa-mir-218-1, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-30b, hsa-mir-128-1, hsa-mir-145, hsa-mir-191, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-30c-1, hsa-mir-99b, hsa-mir-296, hsa-mir-30e, hsa-mir-361, hsa-mir-337, hsa-mir-148b, hsa-mir-196b, hsa-mir-425, hsa-mir-20b, hsa-mir-486-1, hsa-mir-488, hsa-mir-181d, hsa-mir-498, hsa-mir-519c, hsa-mir-520a, hsa-mir-526b, hsa-mir-520d, hsa-mir-506, hsa-mir-92b, hsa-mir-608, hsa-mir-617, hsa-mir-625, hsa-mir-641, hsa-mir-1264, hsa-mir-1271, bta-let-7f-2, bta-mir-103-1, bta-mir-148a, bta-mir-21, bta-mir-30d, bta-mir-128-1, bta-mir-145, bta-mir-181a-2, bta-mir-30b, bta-mir-181b-2, bta-mir-20b, bta-mir-30e, bta-let-7d, bta-mir-148b, bta-mir-181c, bta-mir-191, bta-mir-210, bta-mir-23a, bta-mir-361, bta-mir-425, bta-let-7g, bta-mir-30a, bta-let-7a-1, bta-let-7f-1, bta-mir-30c, bta-let-7i, bta-mir-23b, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-99b, hsa-mir-890, hsa-mir-888, hsa-mir-889, hsa-mir-938, hsa-mir-1184-1, hsa-mir-1203, hsa-mir-1204, hsa-mir-1265, hsa-mir-103b-1, hsa-mir-103b-2, bta-mir-128-2, bta-mir-181d, bta-mir-196a-2, bta-mir-196a-1, bta-mir-196b, bta-mir-218-1, bta-mir-296, bta-mir-30f, bta-mir-486, bta-mir-488, bta-mir-92a-1, bta-mir-92b, bta-mir-1271, bta-mir-181a-1, bta-mir-181b-1, bta-mir-148c, hsa-mir-1184-2, hsa-mir-1184-3, hsa-mir-486-2, bta-mir-1264, bta-mir-148d
Interestingly, the expression level of certain miRNA families namely, the let 7 family (let-7a, let-7c, let-7d, let-7d*, let-7e, let-7f, let-7i), miR-181 family (miR-181a, miR-181b), miR-30 family (miR-30b*, miR-30c-2*, miR-30e ), miR-425 family (miR-425, miR-425*), miR-92 family (miR-92a, miR-92a-1*, miR-92b) and miR-196 family (miR-196a, and miR-196b) were repressed in SE animal group. [score:3]
[1 to 20 of 1 sentences]
18
[+] score: 3
Comparing these results with our data collected by small RNA-Seq of bovine plasma samples, five out of ten miRNAs (miR-486, miR-21, miR-22, miR-25 and miR-92) were as well present in our top 20 list of most abundant miRNAs, either for the analyzed miRNA profile through mapping to hsa and bta miRBase entries (Table S3). [score:1]
gov, version 2.2.29, human genomic plus transcript database) revealed high query coverages (bta-miR-486: 46%, bta-miR-21: 100%, bta-miR-22 100%, bta-miR-25 100%, bta-miR-92: 95%) and therefore high similarity of bta-miRNAs aligned to human transcripts. [score:1]
The second (miR-486) and third (miR-92a) most abundant human miRNAs are found in the top 10 list of sequenced bovine miRNAs (Table S3). [score:1]
[1 to 20 of 3 sentences]
19
[+] score: 3
Six miRNAs (miR-16b, miR-19a, miR-106, miR142–5 p, miR-196a and miR-2454) had the expression in agreement between qRT-PCR and microarray, however the other six (miR92a, miR-92b, miR-101, miR-103, miR-296 and miR-2368*) had divergent results. [score:3]
[1 to 20 of 1 sentences]
20
[+] score: 3
Significant changes in miR-92b expression levels have also been noted in the process of neointimal formation in a rat mo del of vascular injury 48, in individuals with a cardiac rehabilitation following surgical coronary revascularization 49 and in individuals with heart failure 50, indicating that miR-92 is also involved in neovascularization. [score:3]
[1 to 20 of 1 sentences]
21
[+] score: 2
Top-ranked milk miRNA (ref 9) miRNA% milk miRNAs FC (T0 to T3) let-7b 39.1% -111 let-7a/c 37.0% 5 let-7f 2.8% 14 miR-30a 1.9% -39 miR-21 1.7% 23 miR-99a 1.7% -33 let-7d 1.4% ND (T3) miR-148a 1.2% 32 miR-92a 1.1% 8 miR-30d 1.0% -1144 We attempted to replicate and expand on the report of Baier et al., that milk intake increases presence of bovine miRNAs in human plasma and PBMCs. [score:1]
Top-ranked milk miRNA (ref 9) miRNA% milk miRNAs FC (T0 to T3) let-7b 39.1% -111 let-7a/c 37.0% 5 let-7f 2.8% 14 miR-30a 1.9% -39 miR-21 1.7% 23 miR-99a 1.7% -33 let-7d 1.4% ND (T3) miR-148a 1.2% 32 miR-92a 1.1% 8 miR-30d 1.0% -1144 Total reads in the RNA-seq datasets for plasma at T0, T3, T6, and T9 are shown, along with the number and percentage of reads mapped using miRge, Chimira, or Bowtie. [score:1]
[1 to 20 of 2 sentences]
22
[+] score: 1
Of note, miR-92 and let-7 were detected in some of the libraries however the mature miRNAs are perfectly conserved between nematodes and mammals. [score:1]
[1 to 20 of 1 sentences]
23
[+] score: 1
04.152:123191: 123211:1 [h] Intronic bomir-C1931-5p 23 gma-miR1523 1 +CCUGCUGAUCUCACAUUAAUUCA26:12405838: 12405860:1 [h] Intergenic bomir-A2143-3p 18 oan-miR-181c* 1 +CGGCAGAUGAAGUCCAUC16:47801336: 47801353:1 [h] Intronic bomir-F2422-5p 20 hsa-miR-659 1 +GGUGGGAGGGUCCCACCGAG18:53584142: 53584161:1 [h] Intragenic bomir-F2531-3p 18 ppt-miR1030i 3 +UGGUGGAGAUGCCGGGGA8:77307661: 77307678:1 [g] Intergenic bomir-G2511-3p 18 bmo-miR-92 1 +AGGCGGGCCGGGGUUGGA18:41190536: 41190553:1 [h] Intergenic bomir-E2664-3p 20 mml-miR-638 1 -AGGGCGGGCGGCGACUGGAA18:64361001: 64361020:-1 [h] Intragenic bomir-D3011-3p 21 mml-miR-650b 1 +CCGAGUGCUCCCGCGAGCGCU18:39424938: 39424958:1 [g] Intragenic bomir-A3341-1-3p 22 bta-miR-487a 1 +GUGGCUGUCCCUGGAGGUGGG3:124988008: 124988028:1 [h] IntergenicUn. [score:1]
[1 to 20 of 1 sentences]
24
[+] score: 1
In order of decreasing abundance, the top five were miR-486, miR-423-5p, miR-92a, miR-22-3p and miR-191. [score:1]
[1 to 20 of 1 sentences]
25
[+] score: 1
In order of decreasing abundance, the top five were miR-486, miR-423-5p, miR-92a, miR-22-3p and miR-191. [score:1]
[1 to 20 of 1 sentences]
26
[+] score: 1
Other miRNAs from this paper: bta-let-7f-2, bta-mir-21, bta-mir-221, bta-mir-222, bta-mir-26b, bta-mir-125a, bta-mir-125b-1, bta-mir-128-1, bta-mir-181a-2, bta-mir-27b, bta-mir-30b, bta-mir-140, bta-mir-15b, bta-let-7d, bta-let-7g, bta-mir-30a, bta-let-7a-1, bta-let-7f-1, bta-let-7i, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-125b-2, bta-mir-374a, bta-mir-128-2, bta-mir-146b, bta-mir-152, bta-mir-155, bta-mir-181d, bta-mir-24-1, bta-mir-223, bta-mir-374b, bta-mir-500, bta-mir-708, bta-mir-92a-1, bta-mir-9-1, bta-mir-9-2, bta-mir-1249, bta-mir-181a-1, bta-mir-2285a, bta-mir-2285d, bta-mir-2285b-1, bta-mir-2285c, bta-mir-2478, bta-mir-2898, bta-mir-2285e-1, bta-mir-2285e-2, bta-mir-2285f-1, bta-mir-2285f-2, bta-mir-2285g-1, bta-mir-2285h, bta-mir-2285i, bta-mir-2285j-1, bta-mir-2285j-2, bta-mir-2285k-1, bta-mir-2285l, bta-mir-2285o-1, bta-mir-2285o-2, bta-mir-2285n-1, bta-mir-2285n-2, bta-mir-2285p, bta-mir-2285m-1, bta-mir-2285m-2, bta-mir-2285n-3, bta-mir-2285n-4, bta-mir-2285o-3, bta-mir-2285o-4, bta-mir-2285m-3, bta-mir-2285m-4, bta-mir-2285o-5, bta-mir-2285m-5, bta-mir-2285n-5, bta-mir-2285n-6, bta-mir-2285n-7, bta-mir-2285k-2, bta-mir-2285k-3, bta-mir-2285k-4, bta-mir-2285k-5, bta-mir-2285q, bta-mir-2285r, bta-mir-2285s, bta-mir-2285t, bta-mir-2285b-2, bta-mir-2285v, bta-mir-2285g-2, bta-mir-2285g-3, bta-mir-2285af-1, bta-mir-2285af-2, bta-mir-2285y, bta-mir-2285w, bta-mir-2285x, bta-mir-2285z, bta-mir-2285u, bta-mir-2285aa, bta-mir-2285ab, bta-mir-2285ac, bta-mir-2285ad, bta-mir-2285ae, bta-mir-2285ag, bta-mir-2285ah, bta-mir-2285ai, bta-mir-2285aj, bta-mir-2285ak, bta-mir-2285al, bta-mir-2285am, bta-mir-2285ar, bta-mir-2285as-1, bta-mir-2285as-2, bta-mir-2285as-3, bta-mir-2285at-1, bta-mir-2285at-2, bta-mir-2285at-3, bta-mir-2285at-4, bta-mir-2285au, bta-mir-2285av, bta-mir-2285aw, bta-mir-2285ax-1, bta-mir-2285ax-2, bta-mir-2285ax-3, bta-mir-2285ay, bta-mir-2285az, bta-mir-2285an, bta-mir-2285ao-1, bta-mir-2285ao-2, bta-mir-2285ap, bta-mir-2285ao-3, bta-mir-2285aq-1, bta-mir-2285aq-2, bta-mir-2285ba-1, bta-mir-2285ba-2, bta-mir-2285bb, bta-mir-2285bc, bta-mir-2285bd, bta-mir-2285be, bta-mir-2285bf-1, bta-mir-2285bf-2, bta-mir-2285bf-3, bta-mir-2285bg, bta-mir-2285bh, bta-mir-2285bi-1, bta-mir-2285bi-2, bta-mir-2285bj-1, bta-mir-2285bj-2, bta-mir-2285bk, bta-mir-2285bl, bta-mir-2285bm, bta-mir-2285bn, bta-mir-2285bo, bta-mir-2285bp, bta-mir-2285bq, bta-mir-2285br, bta-mir-2285bs, bta-mir-2285bt, bta-mir-2285bu-1, bta-mir-2285bu-2, bta-mir-2285bv, bta-mir-2285bw, bta-mir-2285bx, bta-mir-2285by, bta-mir-2285bz, bta-mir-2285ca, bta-mir-2285cb, bta-mir-2285cc, bta-mir-2285cd, bta-mir-2285ce, bta-mir-2285cf, bta-mir-2285cg, bta-mir-2285ch, bta-mir-2285ci, bta-mir-2285cj, bta-mir-2285ck, bta-mir-2285cl, bta-mir-2285cm, bta-mir-2285cn, bta-mir-2285co, bta-mir-2285cp, bta-mir-2285cq, bta-mir-2285cr-1, bta-mir-2285cr-2, bta-mir-2285cs, bta-mir-2285ct, bta-mir-2285cu, bta-mir-2285cv-1, bta-mir-2285cv-2, bta-mir-2285cw-1, bta-mir-2285cw-2, bta-mir-2285cx, bta-mir-2285cy, bta-mir-2285cz, bta-mir-2285da, bta-mir-2285db, bta-mir-2285dc, bta-mir-2285dd, bta-mir-2285de, bta-mir-2285df, bta-mir-2285dg, bta-mir-2285dh, bta-mir-2285di, bta-mir-2285dj, bta-mir-2285dk, bta-mir-2285dl-1, bta-mir-2285dl-2, bta-mir-2285dm
Finally, IPA revealed that miR-128 and miR-92a are associated with Smad2/3 proteins (Fig. 5b), critical downstream mediators of TGFβ-signaling (reviewed in [61]). [score:1]
[1 to 20 of 1 sentences]
27
[+] score: 1
Chen Y Exosomal microRNA miR-92a concentration in serum reflects human brown fat activityNat. [score:1]
[1 to 20 of 1 sentences]
28
[+] score: 1
Between different gender groups, miR-92/miR-127 showed the least variation, with a p-value of 0.859, the highest value among all the candidate miRNAs. [score:1]
[1 to 20 of 1 sentences]
29
[+] score: 1
These included bta-miR-125b (16,807), bta-miR-16b (1023), bta-miR-92a (5157), bta-miR-378 (2098), bta-miR-940 (1435) and bta-miR-2284x (31,532). [score:1]
[1 to 20 of 1 sentences]
30
[+] score: 1
Other miRNAs from this paper: hsa-let-7c, hsa-let-7d, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-20a, hsa-mir-21, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-99a, hsa-mir-148a, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-181a-2, hsa-mir-181a-1, hsa-mir-125b-1, hsa-mir-143, hsa-mir-125b-2, hsa-mir-126, hsa-mir-146a, hsa-mir-155, hsa-mir-106b, hsa-mir-99b, hsa-mir-26a-2, hsa-mir-378a, hsa-mir-151a, hsa-mir-450a-1, hsa-mir-452, hsa-mir-450a-2, hsa-mir-92b, hsa-mir-151b, hsa-mir-378d-2, bta-mir-26a-2, bta-let-7f-2, bta-mir-148a, bta-mir-151, bta-mir-16b, bta-mir-20a, bta-mir-21, bta-mir-26b, bta-mir-99a, bta-mir-125b-1, bta-mir-126, bta-mir-181a-2, bta-let-7d, bta-mir-17, bta-mir-450a-2, bta-mir-7-3, bta-let-7f-1, bta-let-7c, bta-mir-125b-2, bta-mir-15a, bta-mir-99b, hsa-mir-450b, bta-mir-106b, bta-mir-143, bta-mir-146a, bta-mir-155, bta-mir-16a, bta-mir-26a-1, bta-mir-378-1, bta-mir-452, bta-mir-92a-1, bta-mir-92b, bta-mir-7-2, bta-mir-7-1, bta-mir-181a-1, bta-mir-2284i, bta-mir-2285a, bta-mir-2284s, bta-mir-2285d, bta-mir-2284l, bta-mir-2284j, bta-mir-2284t, bta-mir-2285b-1, bta-mir-2284d, bta-mir-2284n, bta-mir-2284g, bta-mir-2284p, bta-mir-2284u, bta-mir-2284f, bta-mir-2284a, bta-mir-2284k, bta-mir-2284c, bta-mir-2284v, bta-mir-2285c, bta-mir-2284q, bta-mir-2284m, bta-mir-2284b, bta-mir-2284r, bta-mir-2284h, bta-mir-2284o, bta-mir-2284e, bta-mir-450a-1, bta-mir-378-2, hsa-mir-378b, bta-mir-2284w, bta-mir-2284x, hsa-mir-378c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, bta-mir-450b, bta-mir-2284y-1, bta-mir-2285e-1, bta-mir-2285e-2, bta-mir-2285f-1, bta-mir-2285f-2, bta-mir-2285g-1, bta-mir-2285h, bta-mir-2285i, bta-mir-2285j-1, bta-mir-2285j-2, bta-mir-2285k-1, bta-mir-2285l, hsa-mir-378j, bta-mir-2285o-1, bta-mir-2285o-2, bta-mir-2285n-1, bta-mir-2285n-2, bta-mir-2285p, bta-mir-2285m-1, bta-mir-2285m-2, bta-mir-2284y-2, bta-mir-378b, bta-mir-2285n-3, bta-mir-2285n-4, bta-mir-2284y-3, bta-mir-2285o-3, bta-mir-2285o-4, bta-mir-2285m-3, bta-mir-378c, bta-mir-2284y-4, bta-mir-2284y-5, bta-mir-2284y-6, bta-mir-2285m-4, bta-mir-2285o-5, bta-mir-2285m-5, bta-mir-2285n-5, bta-mir-2285n-6, bta-mir-2284y-7, bta-mir-2285n-7, bta-mir-2284z-1, bta-mir-2284aa-1, bta-mir-2285k-2, bta-mir-2284z-3, bta-mir-2284aa-2, bta-mir-2284aa-3, bta-mir-2285k-3, bta-mir-2285k-4, bta-mir-2284z-4, bta-mir-2285k-5, bta-mir-2284z-5, bta-mir-2284z-6, bta-mir-2284z-7, bta-mir-2284aa-4, bta-mir-2285q, bta-mir-2285r, bta-mir-2285s, bta-mir-2285t, bta-mir-2285b-2, bta-mir-2285v, bta-mir-2284z-2, bta-mir-2285g-2, bta-mir-2285g-3, bta-mir-2285af-1, bta-mir-2285af-2, bta-mir-2285y, bta-mir-2285w, bta-mir-2285x, bta-mir-2285z, bta-mir-2285u, bta-mir-2285aa, bta-mir-2285ab, bta-mir-2284ab, bta-mir-2285ac, bta-mir-2285ad, bta-mir-2284ac, bta-mir-2285ae, bta-mir-378d, bta-mir-2285ag, bta-mir-2285ah, bta-mir-2285ai, bta-mir-2285aj, bta-mir-2285ak, bta-mir-2285al, bta-mir-2285am, bta-mir-2285ar, bta-mir-2285as-1, bta-mir-2285as-2, bta-mir-2285as-3, bta-mir-2285at-1, bta-mir-2285at-2, bta-mir-2285at-3, bta-mir-2285at-4, bta-mir-2285au, bta-mir-2285av, bta-mir-2285aw, bta-mir-2285ax-1, bta-mir-2285ax-2, bta-mir-2285ax-3, bta-mir-2285ay, bta-mir-2285az, bta-mir-2285an, bta-mir-2285ao-1, bta-mir-2285ao-2, bta-mir-2285ap, bta-mir-2285ao-3, bta-mir-2285aq-1, bta-mir-2285aq-2, bta-mir-2285ba-1, bta-mir-2285ba-2, bta-mir-2285bb, bta-mir-2285bc, bta-mir-2285bd, bta-mir-2285be, bta-mir-2285bf-1, bta-mir-2285bf-2, bta-mir-2285bf-3, bta-mir-2285bg, bta-mir-2285bh, bta-mir-2285bi-1, bta-mir-2285bi-2, bta-mir-2285bj-1, bta-mir-2285bj-2, bta-mir-2285bk, bta-mir-2285bl, bta-mir-2285bm, bta-mir-2285bn, bta-mir-2285bo, bta-mir-2285bp, bta-mir-2285bq, bta-mir-2285br, bta-mir-2285bs, bta-mir-2285bt, bta-mir-2285bu-1, bta-mir-2285bu-2, bta-mir-2285bv, bta-mir-2285bw, bta-mir-2285bx, bta-mir-2285by, bta-mir-2285bz, bta-mir-2285ca, bta-mir-2285cb, bta-mir-2285cc, bta-mir-2285cd, bta-mir-2285ce, bta-mir-2285cf, bta-mir-2285cg, bta-mir-2285ch, bta-mir-2285ci, bta-mir-2285cj, bta-mir-2285ck, bta-mir-2285cl, bta-mir-2285cm, bta-mir-2285cn, bta-mir-2285co, bta-mir-2285cp, bta-mir-2285cq, bta-mir-2285cr-1, bta-mir-2285cr-2, bta-mir-2285cs, bta-mir-2285ct, bta-mir-2285cu, bta-mir-2285cv-1, bta-mir-2285cv-2, bta-mir-2285cw-1, bta-mir-2285cw-2, bta-mir-2285cx, bta-mir-2285cy, bta-mir-2285cz, bta-mir-2285da, bta-mir-2285db, bta-mir-2285dc, bta-mir-2285dd, bta-mir-2285de, bta-mir-2285df, bta-mir-2285dg, bta-mir-2285dh, bta-mir-2285di, bta-mir-2285dj, bta-mir-2285dk, bta-mir-2285dl-1, bta-mir-2285dl-2, bta-mir-2285dm
7 mir-155 14,390 2,101.7 let-7c 14,020 2,047.7 mir-143 12,204 1,782.4 mir-181a-2//mir-181a-1 11,882 1,735.4 mir-146a 10,952 1,599.6 mir-15a 9,938 1,451.5 mir-99b 9,755 1,424.8 mir-148a 9,502 1,387.8 mir-125b-1//mir-125b-2 9,395 1,372.2 mir-106b 9,284 1,356.0 mir-26b 9,146 1,335.8 mir-16b 8,750 1,278.0 let-7d 8,273 1,208.3 mir-16a 8,007 1,169.5 mir-92//mir-92a 7,427 1,084.7 mir-7//mir-7-2//mir-7-1 6,852 1,000.8 Fig. 2IsomiRs and detection of star sequences. [score:1]
[1 to 20 of 1 sentences]