sort by

21 publications mentioning bta-mir-191

Open access articles that are associated with the species Bos taurus and mention the gene name mir-191. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 30
qRT-PCR was performed to quantify expression of miR-93, miR-103, miR-26a, miR-191, miR-23b, Let-7a and U6 for bovine samples and miR-21, miR-26a, miR-93, miR-103, miR-148a, miR-182 and miR-191 for porcine oocytes. [score:3]
Different letters above bars (a,b,c,d) indicate values that differ significantly (p < 0.05) Fig. 4Relative expression of porcine miRNAs after normalization with miR-26a, miR-191 and miR-93. [score:3]
In these samples, expression of miR-26a, miR-191, miR-93 and miR-103 were most similar. [score:3]
In porcine samples, normalization was performed using the relative expression of miR-26a, miR-191 and miR-93 (Fig.   4). [score:3]
In bovine samples, the expression of miR-23b, miR-26a, miR-93, miR-103, miR-191, Let-7a and the nuclear RNA U6 was examined. [score:3]
Stepwise removal to determine the optimum number of reference miRNAs identified miR-93 and miR-103 as the most stably expressed in bovine samples and miR-26a, miR-191 and miR-93 in porcine samples. [score:3]
The combination of miR-93 and miR-103 is optimal for normalizing miRNA expression for qPCR experiments on bovine oocytes and preimplantation embryos; the preferred combination for porcine oocytes is miR-26a, miR-191 and miR-93. [score:3]
In cattle, the BestKeeper outcome indicated expression levels of miR-93, miR-103 and miR-191 as having the highest coefficient of correlation [r] indicator of a linear relationship between two variables (Table  1). [score:3]
miR-23b miR-26a miR-93 miR-103 miR-191 Let-7a U6 coeff. [score:1]
In porcine samples, miR-93, miR-26a, miR-191 and miR-103 had the highest r and r [2] values (Tables  3, 4). [score:1]
In porcine samples, miR-26a and miR-191 had the lowest M values, followed by miR-93 (Fig.   1b). [score:1]
miR-191 was proposed as the best (most stable) miRNA data normalizer in the serum of human colorectal adenocarcinoma and colorectal adenoma patients [33], but had a lower stability ranking in rat tissues [45]. [score:1]
miR-21 miR-26a miR-93 miR-103 miR-148 miR-182 miR-191 coeff. [score:1]
In porcine samples, the miRNAs identified as fluctuating least in bovine samples, namely miR-26a, miR-93, miR-103 and miR-191 were examined together with miR-21, miR-148a, and miR-182. [score:1]
[1 to 20 of 14 sentences]
2
[+] score: 15
Relative quantification was performed by normalization of the expression of target miRNAs against that of miR-191, used as endogenous control. [score:5]
miR-191 has previously been reported to have stable expression in bovine serum [30] and in bovine oocytes and early embryos, and porcine oocytes [31] and thus is suitable as optimal endogenous expression normalizer for reverse transcription quantitative real-time polymerase chain reaction -based detection of microRNAs. [score:5]
The relative quantification of mature miRNA expression was normalized to the expression of bovine miR-191 control assays. [score:4]
bta-miR-191, -103 & -19b) showed more abundance (>7). [score:1]
[1 to 20 of 4 sentences]
3
[+] score: 9
Similarly, temporally DE miRNAs, miR-146, miR-191, miR-33, miR-7, miR-99/100, miR-486, and miR-145 may target genes that accelerate gut tissue and immune system development. [score:4]
Temporally DE miRNAs in small intestine (miR-146, miR-191, miR-33, miR-7, miR-99/100, miR-486, miR-145, and miR-211) were predicted to be related to gut epithelial cells development, immune cells development, inflammatory response, and other functions (Table 1). [score:3]
Functional analysis illustrated that miR-191, miR-33, miR-99/100, and miR-145 were mainly related to differentiation of leukocytes including lymphocytes. [score:1]
A total of 13 regional and temporal DE miRNAs (regional DE miRNAs: miR-192, miR-194, miR-205, miR-31, and miR-196; temporal DE miRNAs: miR-146b, miR-191, miR-99a, miR-145, miR-211, miR-486, miR-33, miR-7, and miR-196b) that identified from miRNA-seq were selected for validation using stem-loop qRT-PCR. [score:1]
[1 to 20 of 4 sentences]
4
[+] score: 9
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-98, hsa-mir-99a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-10a, hsa-mir-10b, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-181a-1, hsa-mir-221, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-27b, hsa-mir-30b, hsa-mir-130a, hsa-mir-152, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-185, hsa-mir-193a, hsa-mir-320a, hsa-mir-200c, hsa-mir-1-1, hsa-mir-181b-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-99b, hsa-mir-130b, hsa-mir-30e, hsa-mir-363, hsa-mir-374a, hsa-mir-375, hsa-mir-378a, hsa-mir-148b, hsa-mir-331, hsa-mir-339, hsa-mir-423, hsa-mir-20b, hsa-mir-491, hsa-mir-193b, hsa-mir-181d, hsa-mir-92b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, bta-mir-29a, bta-let-7f-2, bta-mir-148a, bta-mir-18a, bta-mir-20a, bta-mir-221, bta-mir-27a, bta-mir-30d, bta-mir-320a-2, bta-mir-99a, bta-mir-181a-2, bta-mir-27b, bta-mir-30b, bta-mir-106a, bta-mir-10a, bta-mir-15b, bta-mir-181b-2, bta-mir-193a, bta-mir-20b, bta-mir-30e, bta-mir-92a-2, bta-mir-98, bta-let-7d, bta-mir-148b, bta-mir-17, bta-mir-181c, bta-mir-200c, bta-mir-22, bta-mir-29b-2, bta-mir-29c, bta-mir-423, bta-let-7g, bta-mir-10b, bta-mir-24-2, bta-mir-30a, bta-let-7a-1, bta-let-7f-1, bta-mir-30c, bta-let-7i, bta-mir-25, bta-mir-363, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-15a, bta-mir-19a, bta-mir-19b, bta-mir-331, bta-mir-374a, bta-mir-99b, hsa-mir-374b, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, bta-mir-1-2, bta-mir-1-1, bta-mir-130a, bta-mir-130b, bta-mir-152, bta-mir-181d, bta-mir-182, bta-mir-185, bta-mir-24-1, bta-mir-193b, bta-mir-29d, bta-mir-30f, bta-mir-339a, bta-mir-374b, bta-mir-375, bta-mir-378-1, bta-mir-491, bta-mir-92a-1, bta-mir-92b, bta-mir-9-1, bta-mir-9-2, bta-mir-29e, bta-mir-29b-1, bta-mir-181a-1, bta-mir-181b-1, bta-mir-320b, bta-mir-339b, bta-mir-19b-2, bta-mir-320a-1, bta-mir-193a-2, bta-mir-378-2, hsa-mir-378b, hsa-mir-320e, hsa-mir-378c, bta-mir-148c, hsa-mir-374c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-378j, bta-mir-378b, bta-mir-378c, bta-mir-378d, bta-mir-374c, bta-mir-148d
MiR-378 promotes osteoblast differentiation by targeting polypeptide N-acetylgalactosaminyltransferase 7 (GalNAc-T7 or GalNT7) [70], and miR-191 regulates erythroid differentiation in mammals by up -regulating erythroid-enriched genes Riok3 and Mxi1[71]. [score:5]
Notably, some miRNAs among the top 10 identified here have been reported to be related to immunity (miR-320, miR-181a, miR-30a-3p, let-7a, let-7f and let-7c) and development (miR-193a-3p, miR-378 and miR-191). [score:2]
Further comparison revealed that miR-191 and let-7a, which potentially play a vital role in immunity, were found in both that study and in the top 10 miRNAs of our study. [score:1]
The top 10 miRNAs were ssc-miR-193a-3p, ssc-miR-423-5p, ssc-miR-320, ssc-miR-181a, ssc-miR-30a-3p, ssc-miR-378, ssc-miR-191, ssc-let-7a, ssc-let-7f and ssc-let-7c. [score:1]
[1 to 20 of 4 sentences]
5
[+] score: 7
Other miRNAs from this paper: bta-mir-26a-2, bta-mir-29a, bta-let-7f-2, bta-mir-16b, bta-mir-21, bta-mir-221, bta-mir-222, bta-mir-30d, bta-mir-99a, bta-mir-145, bta-mir-181a-2, bta-mir-199a-1, bta-mir-27b, bta-mir-142, bta-mir-181b-2, bta-mir-30e, bta-mir-92a-2, bta-let-7d, bta-mir-132, bta-mir-181c, bta-mir-199b, bta-mir-214, bta-mir-29b-2, bta-mir-29c, bta-mir-455, bta-let-7g, bta-mir-10b, bta-mir-24-2, bta-let-7a-1, bta-mir-150, bta-let-7f-1, bta-mir-122, bta-let-7i, bta-mir-34c, bta-mir-363, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-195, bta-mir-34a, bta-mir-365-1, bta-mir-99b, bta-mir-100, bta-mir-129-1, bta-mir-129-2, bta-mir-130a, bta-mir-130b, bta-mir-133a-2, bta-mir-133a-1, bta-mir-143, bta-mir-146b, bta-mir-146a, bta-mir-155, bta-mir-181d, bta-mir-182, bta-mir-183, bta-mir-184, bta-mir-24-1, bta-mir-196a-2, bta-mir-196a-1, bta-mir-199a-2, bta-mir-212, bta-mir-26a-1, bta-mir-28, bta-mir-29d, bta-mir-32, bta-mir-335, bta-mir-338, bta-mir-339a, bta-mir-346, bta-mir-365-2, bta-mir-378-1, bta-mir-383, bta-mir-409a, bta-mir-449a, bta-mir-449b, bta-mir-449c, bta-mir-592, bta-mir-708, bta-mir-92a-1, bta-mir-92b, bta-mir-29e, bta-mir-29b-1, bta-mir-1271, bta-mir-1249, bta-mir-181a-1, bta-mir-181b-1, bta-mir-2285a, bta-mir-2285d, bta-mir-2285b-1, bta-mir-2332, bta-mir-199c, bta-mir-2389, bta-mir-2285c, bta-mir-2404-1, bta-mir-449d, bta-mir-2411, bta-mir-2446, bta-mir-339b, bta-mir-2404-2, bta-mir-2483, bta-mir-424, bta-mir-378-2, bta-mir-409b, bta-mir-2285e-1, bta-mir-2285e-2, bta-mir-2285f-1, bta-mir-2285f-2, bta-mir-2285g-1, bta-mir-2285h, bta-mir-2285i, bta-mir-2285j-1, bta-mir-2285j-2, bta-mir-2285k-1, bta-mir-2285l, bta-mir-2285o-1, bta-mir-2285o-2, bta-mir-2285n-1, bta-mir-2285n-2, bta-mir-2285p, bta-mir-2285m-1, bta-mir-2285m-2, bta-mir-378b, bta-mir-2285n-3, bta-mir-2285n-4, bta-mir-2285o-3, bta-mir-2285o-4, bta-mir-2285m-3, bta-mir-378c, bta-mir-2285m-4, bta-mir-2285o-5, bta-mir-2285m-5, bta-mir-2285n-5, bta-mir-2285n-6, bta-mir-2285n-7, bta-mir-2285k-2, bta-mir-2285k-3, bta-mir-2285k-4, bta-mir-2285k-5, bta-mir-2285q, bta-mir-2285r, bta-mir-2285s, bta-mir-2285t, bta-mir-2285b-2, bta-mir-2285v, bta-mir-2285g-2, bta-mir-2285g-3, bta-mir-2285af-1, bta-mir-2285af-2, bta-mir-2285y, bta-mir-2285w, bta-mir-2285x, bta-mir-2285z, bta-mir-2285u, bta-mir-2285aa, bta-mir-2285ab, bta-mir-2285ac, bta-mir-2285ad, bta-mir-2285ae, bta-mir-378d, bta-mir-2285ag, bta-mir-2285ah, bta-mir-2285ai, bta-mir-2285aj, bta-mir-2285ak, bta-mir-2285al, bta-mir-2285am, bta-mir-2285ar, bta-mir-2285as-1, bta-mir-2285as-2, bta-mir-2285as-3, bta-mir-2285at-1, bta-mir-2285at-2, bta-mir-2285at-3, bta-mir-2285at-4, bta-mir-2285au, bta-mir-2285av, bta-mir-2285aw, bta-mir-2285ax-1, bta-mir-2285ax-2, bta-mir-2285ax-3, bta-mir-2285ay, bta-mir-2285az, bta-mir-2285an, bta-mir-2285ao-1, bta-mir-2285ao-2, bta-mir-2285ap, bta-mir-2285ao-3, bta-mir-2285aq-1, bta-mir-2285aq-2, bta-mir-2285ba-1, bta-mir-2285ba-2, bta-mir-2285bb, bta-mir-2285bc, bta-mir-2285bd, bta-mir-2285be, bta-mir-2285bf-1, bta-mir-2285bf-2, bta-mir-2285bf-3, bta-mir-2285bg, bta-mir-2285bh, bta-mir-2285bi-1, bta-mir-2285bi-2, bta-mir-2285bj-1, bta-mir-2285bj-2, bta-mir-2285bk, bta-mir-2285bl, bta-mir-2285bm, bta-mir-2285bn, bta-mir-2285bo, bta-mir-2285bp, bta-mir-2285bq, bta-mir-2285br, bta-mir-2285bs, bta-mir-2285bt, bta-mir-2285bu-1, bta-mir-2285bu-2, bta-mir-2285bv, bta-mir-2285bw, bta-mir-2285bx, bta-mir-2285by, bta-mir-2285bz, bta-mir-2285ca, bta-mir-2285cb, bta-mir-2285cc, bta-mir-2285cd, bta-mir-2285ce, bta-mir-2285cf, bta-mir-2285cg, bta-mir-2285ch, bta-mir-2285ci, bta-mir-2285cj, bta-mir-2285ck, bta-mir-2285cl, bta-mir-2285cm, bta-mir-2285cn, bta-mir-2285co, bta-mir-2285cp, bta-mir-2285cq, bta-mir-2285cr-1, bta-mir-2285cr-2, bta-mir-2285cs, bta-mir-2285ct, bta-mir-2285cu, bta-mir-2285cv-1, bta-mir-2285cv-2, bta-mir-2285cw-1, bta-mir-2285cw-2, bta-mir-2285cx, bta-mir-2285cy, bta-mir-2285cz, bta-mir-2285da, bta-mir-2285db, bta-mir-2285dc, bta-mir-2285dd, bta-mir-2285de, bta-mir-2285df, bta-mir-2285dg, bta-mir-2285dh, bta-mir-2285di, bta-mir-2285dj, bta-mir-2285dk, bta-mir-2285dl-1, bta-mir-2285dl-2, bta-mir-2285dm
Other miRNAs which were dysregulated in DF between day 7 and day 3 of the estrous cycle namely miR-21, miR-132, miR-191 and miR-99b were also exhibited temporally expression alteration in mural granulosa cells collected from mice treated with eCG for 46 h followed by injection of hCG [72]. [score:4]
Others namely, bta-miR-143, bta-miR-99b, bta-miR-191, bta-miR-16b, bta-miR-99a-5p and bta-miR-30e-5p were expressed by >500 reads counts both at day 3 and day 7 of the estrous cycle. [score:3]
[1 to 20 of 2 sentences]
6
[+] score: 7
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-21, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-99a, mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-99a, mmu-mir-140, mmu-mir-10b, mmu-mir-181a-2, mmu-mir-24-1, mmu-mir-191, hsa-mir-192, hsa-mir-148a, hsa-mir-30d, mmu-mir-122, hsa-mir-10b, hsa-mir-181a-2, hsa-mir-181a-1, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-122, hsa-mir-140, hsa-mir-191, hsa-mir-320a, mmu-mir-30d, mmu-mir-148a, mmu-mir-192, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-21a, mmu-mir-22, mmu-mir-24-2, mmu-mir-26a-1, mmu-mir-92a-2, mmu-mir-25, mmu-mir-181a-1, mmu-mir-26a-2, mmu-mir-92a-1, hsa-mir-26a-2, hsa-mir-423, hsa-mir-451a, mmu-mir-451a, hsa-mir-486-1, mmu-mir-486a, mmu-mir-423, bta-mir-26a-2, bta-let-7f-2, bta-mir-148a, bta-mir-21, bta-mir-30d, bta-mir-320a-2, bta-mir-99a, bta-mir-181a-2, bta-mir-27b, bta-mir-140, bta-mir-92a-2, bta-let-7d, bta-mir-192, bta-mir-22, bta-mir-423, bta-let-7g, bta-mir-10b, bta-mir-24-2, bta-let-7a-1, bta-let-7f-1, bta-mir-122, bta-let-7i, bta-mir-25, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, hsa-mir-1246, bta-mir-24-1, bta-mir-26a-1, bta-mir-451, bta-mir-486, bta-mir-92a-1, bta-mir-181a-1, bta-mir-320a-1, mmu-mir-486b, hsa-mir-451b, bta-mir-1246, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-mir-451b, mmu-let-7k, hsa-mir-486-2
There were eight microRNAs (bta-miR-27b, bta-miR-191, bta-miR-30d, bta-miR-451, bta-miR-25, bta-miR-140, bta-miR-24-3p, and bta-miR-122), that were upregulated in older animals in the present study, and upregulated in fetal muscle tissue of the study. [score:7]
[1 to 20 of 1 sentences]
7
[+] score: 7
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-27a, hsa-mir-31, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-101-1, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-16-2, hsa-mir-192, hsa-mir-199a-1, hsa-mir-30c-2, hsa-mir-199a-2, hsa-mir-223, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-125b-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-140, hsa-mir-141, hsa-mir-152, hsa-mir-191, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-149, hsa-mir-150, hsa-mir-320a, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-101-2, hsa-mir-99b, hsa-mir-26a-2, hsa-mir-379, hsa-mir-423, hsa-mir-451a, hsa-mir-486-1, hsa-mir-496, hsa-mir-520a, hsa-mir-525, hsa-mir-518b, hsa-mir-516b-2, hsa-mir-516b-1, hsa-mir-516a-1, hsa-mir-516a-2, hsa-mir-92b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, bta-mir-26a-2, bta-let-7f-2, bta-mir-101-2, bta-mir-103-1, bta-mir-16b, bta-mir-20a, bta-mir-21, bta-mir-27a, bta-mir-320a-2, bta-mir-125a, bta-mir-125b-1, bta-mir-199a-1, bta-mir-31, bta-mir-140, bta-mir-92a-2, bta-let-7d, bta-mir-132, bta-mir-192, bta-mir-22, bta-mir-23a, bta-mir-29c, bta-mir-423, bta-let-7g, bta-mir-24-2, bta-let-7a-1, bta-mir-150, bta-let-7f-1, bta-mir-30c, bta-let-7i, bta-mir-23b, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-125b-2, bta-mir-99b, hsa-mir-1249, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, bta-mir-101-1, bta-mir-133a-2, bta-mir-133a-1, bta-mir-141, bta-mir-152, bta-mir-16a, bta-mir-24-1, bta-mir-199a-2, bta-mir-223, bta-mir-26a-1, bta-mir-379, bta-mir-451, bta-mir-486, bta-mir-496, bta-mir-92a-1, bta-mir-92b, bta-mir-1249, bta-mir-320b, bta-mir-320a-1, hsa-mir-320e, hsa-mir-23c, hsa-mir-451b, bta-mir-149, hsa-mir-486-2
Out of the most abundant miRNAs in bovine plasma, miR-486 and miR-92a are reportedly expressed primarily in erythrocytes, and miR-191 is expressed primarily in platelets [31, 35]. [score:5]
b Expression level of the 20 most abundant miRNAs in bovine plasma (calculated as 2 [^(40-Ct)]) Comparing the 20 most abundant miRNAs in each of the PCR array and sequencing datasets, only 6 miRNAs (miR-486, miR-22-3p, miR-191, miR-92a, miR-140 and miR-451) were common. [score:1]
b Expression level of the 20 most abundant miRNAs in bovine plasma (calculated as 2 [^(40-Ct)])Comparing the 20 most abundant miRNAs in each of the PCR array and sequencing datasets, only 6 miRNAs (miR-486, miR-22-3p, miR-191, miR-92a, miR-140 and miR-451) were common. [score:1]
[1 to 20 of 3 sentences]
8
[+] score: 6
Among the 10 most abundant miRNAs in plasma (Fig 1C), miR-486 (the most abundant) and miR-92a are reportedly expressed primarily in red blood cells [37], whereas miR-191 is highly expressed in platelets [38]. [score:5]
Out of the 20 most abundant miRNAs in each of the sequencing and PCR array datasets, only six (miR-451, miR-486, miR-22-3p, miR-92a, miR-191 and miR-140) were common to both datasets (20% overlap). [score:1]
[1 to 20 of 2 sentences]
9
[+] score: 6
In addition, miR-191 and miR-103 have been used as endogenous reference miRNAs in human tissues [8]; however, in our study, miR-191 failed to meet the endogenous normalizer criteria, and miR-103 was expressed at a low level in bovine serum. [score:3]
As shown, miR-127 (M = 0.41) and miR-93 (M = 0.45) were the most stable miRNAs, followed by miR-192, miR-23a, miR-191, miR-16, miR-195, miR-451, let-7a, and miR-101. [score:1]
As shown in Fig 3, NormFinder ranked the ten candidate miRNAs from lowest to highest stability value as follows: miR-127, miR-93, miR-192, miR-191, miR-23a, let-7a, miR-16, miR-195, miR-451, and miR-101. [score:1]
For instance, miR-23a and miR-191 are used for normalization in profiling studies of human cervical tissues [9], and let-7a and miR-16 are selected as reference genes in human breast cancer tissues [11]. [score:1]
[1 to 20 of 4 sentences]
10
[+] score: 5
Variant expression followed two main patterns as seen in other studies [40] those miRNAs with a strong predominant isomiR, such as bta-miR-191 and bta-miR-103; and those miRNAs where there is no predominant isomiR, such as bta-miR-486 and bta-miR-320a. [score:3]
In order of decreasing abundance, the top five were miR-486, miR-423-5p, miR-92a, miR-22-3p and miR-191. [score:1]
22_13473 was 99% conserved in all species and was found to be reverse complementary to the bta-miR-191 gene. [score:1]
[1 to 20 of 3 sentences]
11
[+] score: 5
The expression levels of miR-25, miR-155, miR-182, miR-191, miR-221, miR-223, and/or miR-375 have been reported to change in the mammary gland tissues of cows [7], goats [8], milk from pigs [3], and rat milk whey [29] during lactation, and therefore we also analyzed these miRNAs. [score:3]
In particular, the content of miR-148a in bovine milk is elevated during 5 months of lactation [2, 3], whereas those of let-7a, miR-25, miR-30d, miR-182, miR-191, miR-200c, and miR-375 are reduced within the first month of lactation [2]. [score:1]
The top 20 miRNAs in the milk exosome were let-7b (12.7 %), miR-200c (10.9 %), miR-26a (8.8 %), let-7c (7.5 %), let-7a-5p (6.3 %), miR-30a-5p (3.1 %), miR-320a (2.7 %), miR-103 (2.5 %), miR-107 (2.2 %), let-7d (1.9 %), miR-23-3p (1.6 %), miR-191 (1.6 %), miR-23a (1.6 %), miR-20a (1.5 %), miR-1777b (1.5 %), miR-151-5p (1.4 %), miR-24-3p (1.3 %), miR-320b (1.3 %), miR-200b (1.2 %), and miR-141 (1.2 %) (Fig.   2). [score:1]
[1 to 20 of 3 sentences]
12
[+] score: 5
Among the top 10 abundantly expressed miRNAs in each group, 7 miRNAs (bta-miR-26a, bta-miR-10b, bta-let-7a-5p, bta-let-7f, bta-let-7i, bta-miR-27b and bta-miR-191) were commonly expressed in both preovulatory and subordinate follicles (Table 2). [score:5]
[1 to 20 of 1 sentences]
13
[+] score: 5
The geometric means of expression for the reference miRNAs miR-26a, miR-191 and let-7a were used for normalization of the target miRNAs. [score:5]
[1 to 20 of 1 sentences]
14
[+] score: 4
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-27a, hsa-mir-31, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-16-2, hsa-mir-192, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-181a-2, hsa-mir-205, hsa-mir-181a-1, hsa-mir-214, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-146a, hsa-mir-184, hsa-mir-186, hsa-mir-193a, hsa-mir-194-1, hsa-mir-155, hsa-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-219a-2, hsa-mir-99b, hsa-mir-26a-2, hsa-mir-365a, hsa-mir-365b, hsa-mir-374a, hsa-mir-148b, hsa-mir-423, hsa-mir-486-1, hsa-mir-499a, hsa-mir-532, hsa-mir-590, bta-mir-26a-2, bta-let-7f-2, bta-mir-103-1, bta-mir-148a, bta-mir-16b, bta-mir-21, bta-mir-221, bta-mir-222, bta-mir-27a, bta-mir-499, bta-mir-125b-1, bta-mir-181a-2, bta-mir-205, bta-mir-27b, bta-mir-30b, bta-mir-31, bta-mir-193a, bta-let-7d, bta-mir-148b, bta-mir-186, bta-mir-192, bta-mir-200a, bta-mir-214, bta-mir-22, bta-mir-23a, bta-mir-29c, bta-mir-423, bta-let-7g, bta-mir-24-2, bta-let-7a-1, bta-mir-532, bta-let-7f-1, bta-mir-30c, bta-let-7i, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-125b-2, bta-mir-365-1, bta-mir-374a, bta-mir-99b, hsa-mir-374b, hsa-mir-664a, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-1915, bta-mir-146a, bta-mir-155, bta-mir-16a, bta-mir-184, bta-mir-24-1, bta-mir-194-2, bta-mir-219-1, bta-mir-223, bta-mir-26a-1, bta-mir-365-2, bta-mir-374b, bta-mir-486, bta-mir-763, bta-mir-9-1, bta-mir-9-2, bta-mir-181a-1, bta-mir-2284i, bta-mir-2284s, bta-mir-2284l, bta-mir-2284j, bta-mir-2284t, bta-mir-2284d, bta-mir-2284n, bta-mir-2284g, bta-mir-2339, bta-mir-2284p, bta-mir-2284u, bta-mir-2284f, bta-mir-2284a, bta-mir-2284k, bta-mir-2284c, bta-mir-2284v, bta-mir-2284q, bta-mir-2284m, bta-mir-2284b, bta-mir-2284r, bta-mir-2284h, bta-mir-2284o, bta-mir-664a, bta-mir-2284e, bta-mir-1388, bta-mir-194-1, bta-mir-193a-2, bta-mir-2284w, bta-mir-2284x, bta-mir-148c, hsa-mir-374c, hsa-mir-219b, hsa-mir-499b, hsa-mir-664b, bta-mir-2284y-1, bta-mir-2284y-2, bta-mir-2284y-3, bta-mir-2284y-4, bta-mir-2284y-5, bta-mir-2284y-6, bta-mir-2284y-7, bta-mir-2284z-1, bta-mir-2284aa-1, bta-mir-2284z-3, bta-mir-2284aa-2, bta-mir-2284aa-3, bta-mir-2284z-4, bta-mir-2284z-5, bta-mir-2284z-6, bta-mir-2284z-7, bta-mir-2284aa-4, bta-mir-2284z-2, hsa-mir-486-2, hsa-mir-6516, bta-mir-2284ab, bta-mir-664b, bta-mir-6516, bta-mir-219-2, bta-mir-2284ac, bta-mir-219b, bta-mir-374c, bta-mir-148d
Most of the detected top expressed miRNAs are conserved in human, mouse, and bovine, and belong to several miRNA families, vis, miR-31, miR-26a, miR-27a-3p/27b, let-7a-5p/7f/7i, miR-21-5p, miR-22-3p, miR-184, miR-186, miR-191, miR-205 and miR221/222. [score:3]
48164101:+ bta-miR-191′-5pbta-mir-191′bta-miR-1915.540gaacgaaauccaagcgcagcug220gcugcuuuugggauuccguugcc2322:51543481.. [score:1]
[1 to 20 of 2 sentences]
15
[+] score: 3
Several of the reported top 10 miRNA expressed in both high and low fertility bulls were consistent with our sequencing results (miR-191, −125b, and −100) while others were not (miR-638 and −289). [score:3]
[1 to 20 of 1 sentences]
16
[+] score: 3
Other miRNAs from this paper: hsa-mir-191
Similarly, miR-191 was found to be highly expressed in the culture media of chromosomally abnormal aneuploid embryos in comparison to euploid embryos (Rosenbluth et al., 2014). [score:3]
[1 to 20 of 1 sentences]
17
[+] score: 3
Other miRNAs from this paper: bta-mir-34c, bta-mir-100
It had been previously identified in sperm, testis, ovary, zygote and it was also reported that hsa-miR-191 was not regulated epigenetically. [score:2]
In Tables  3 and 4, hsa-miR-191 was also found in the Krawetz et al. study. [score:1]
[1 to 20 of 2 sentences]
18
[+] score: 2
Three miRNA endogenous controls (microRNA 16b (miR-16b), microRNA-191 (miR-191), and RNA, U6 Small Nuclear 6 (RNU6B)) were tested and the best individual or combination of endogenous control was chosen using NormFinder (24). [score:1]
The geometric mean of miR-16b and miR-191 was used to normalize the data. [score:1]
[1 to 20 of 2 sentences]
19
[+] score: 1
The comparison of the relative abundance of top 10 annotated miRNAs showed that sera and exosomes had similar profiles of abundant miRNAs except miR-191 in sera and miR-10b in exosmes (Fig.   3a, b). [score:1]
[1 to 20 of 1 sentences]
20
[+] score: 1
In order of decreasing abundance, the top five were miR-486, miR-423-5p, miR-92a, miR-22-3p and miR-191. [score:1]
[1 to 20 of 1 sentences]
21
[+] score: 1
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-21, hsa-mir-23a, hsa-mir-30a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-196a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-196a-2, hsa-mir-210, hsa-mir-181a-1, hsa-mir-218-1, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-30b, hsa-mir-128-1, hsa-mir-145, hsa-mir-191, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-30c-1, hsa-mir-99b, hsa-mir-296, hsa-mir-30e, hsa-mir-361, hsa-mir-337, hsa-mir-148b, hsa-mir-196b, hsa-mir-425, hsa-mir-20b, hsa-mir-486-1, hsa-mir-488, hsa-mir-181d, hsa-mir-498, hsa-mir-519c, hsa-mir-520a, hsa-mir-526b, hsa-mir-520d, hsa-mir-506, hsa-mir-92b, hsa-mir-608, hsa-mir-617, hsa-mir-625, hsa-mir-641, hsa-mir-1264, hsa-mir-1271, bta-let-7f-2, bta-mir-103-1, bta-mir-148a, bta-mir-21, bta-mir-30d, bta-mir-128-1, bta-mir-145, bta-mir-181a-2, bta-mir-30b, bta-mir-181b-2, bta-mir-20b, bta-mir-30e, bta-mir-92a-2, bta-let-7d, bta-mir-148b, bta-mir-181c, bta-mir-210, bta-mir-23a, bta-mir-361, bta-mir-425, bta-let-7g, bta-mir-30a, bta-let-7a-1, bta-let-7f-1, bta-mir-30c, bta-let-7i, bta-mir-23b, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-99b, hsa-mir-890, hsa-mir-888, hsa-mir-889, hsa-mir-938, hsa-mir-1184-1, hsa-mir-1203, hsa-mir-1204, hsa-mir-1265, hsa-mir-103b-1, hsa-mir-103b-2, bta-mir-128-2, bta-mir-181d, bta-mir-196a-2, bta-mir-196a-1, bta-mir-196b, bta-mir-218-1, bta-mir-296, bta-mir-30f, bta-mir-486, bta-mir-488, bta-mir-92a-1, bta-mir-92b, bta-mir-1271, bta-mir-181a-1, bta-mir-181b-1, bta-mir-148c, hsa-mir-1184-2, hsa-mir-1184-3, hsa-mir-486-2, bta-mir-1264, bta-mir-148d
php) and normalization was performed using the geometric mean of miR-23a, miR-103, miR-191 and SNORD49A. [score:1]
[1 to 20 of 1 sentences]