sort by

53 publications mentioning bta-let-7i

Open access articles that are associated with the species Bos taurus and mention the gene name let-7i. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 212
bta-miR-499 upregulated bta-let-7 microRNAs by targeting Lin28B, and subsequent upregulation of bta-let-7 microRNAs inhibited the NF-κB pathway 61, 62. [score:11]
Collectively, placental exosome-derived bta-miR-499, Lin28B, and bta-let-7 miRNAs constitute a loop that negatively regulates NF-κB p65 activation, contributing to the pro/anti-inflammatory balance at the maternal-fetal interface during early pregnancy in cattleIn addition, NF-κB activation upregulated the expression of Lin28B (Fig.   6d), and inhibition of NF-κB activation led to a decrease in the expression of Lin28B (Fig.   7f). [score:11]
Collectively, placental exosome-derived bta-miR-499, Lin28B, and bta-let-7 miRNAs constitute a loop that negatively regulates NF-κB p65 activation, contributing to the pro/anti-inflammatory balance at the maternal-fetal interface during early pregnancy in cattle In addition, NF-κB activation upregulated the expression of Lin28B (Fig.   6d), and inhibition of NF-κB activation led to a decrease in the expression of Lin28B (Fig.   7f). [score:11]
To determine whether bta-miR-499 inhibits activation of NF-κB by upregulating the bta-let-7 family via targeting Lin28B, we determined the effects of bta-miR-499 on the expression of the bta-let-7 family. [score:10]
During early pregnancy, the proinflammatory uterine immune microenvironment leads to the activation of NF-κB and promotes the transcriptional expression of downstream proinflammatory cytokines, such as TNF-α and IL-6. However, to maintain an appropriate, proinflammatory environment, placental exosomes target the Lin28B/let-7-ras signaling axis through miR-499 to directly or indirectly inhibit NF-κB activation and attenuate transcriptional regulation of downstream proinflammatory cytokines, resulting in a mild proinflammatory environment. [score:10]
Taken together, these results indicated that exosome-derived bta-miR-499 inhibits the expression of Lin28B, thereby increasing intracellular bta-let-7 miRNAs levels and impairing the activation of NF-κB, leading to downregulation of proinflammatory cytokine expression. [score:10]
Two-tailed Student’s t-test, * P < 0.05; ** P < 0.01 Let-7 family miRNAs, which include 12 highly conserved let-7 isoforms, inhibit NF-κB activation through multiple pathways by suppressing the expression of a common set of target mRNAs 30, 33. [score:9]
Upregulation of Lin28B significantly inhibited the expression of let-7 miRNAs, thus leading to an increase in IL-6 and contributing to the development of inflammation [63]. [score:9]
However, blocking Lin28B expression upregulated bta-let-7 miRNA levels, which can inhibit NF-κB activation. [score:8]
Bta-miR-499 upregulates bta-let-7 miRNAs via targeting Lin28B. [score:6]
These results indicate that bta-miR-499 upregulates the bta-let-7 family via targeting Lin28B. [score:6]
The above results suggest that the upregulation of bta-let-7 miRNAs in BEND cells partly originates from exosomes and combines with exosome-derived bta-miR-499 to regulate the activation of NF-κB signaling. [score:5]
Finally, cells incubated with exosomes exhibited increased expression of let-7 family members; among these members, bta-let-7a-5p, bta-let-7c and bta-let-7i were significantly upregulated in the placental exosome group compared with those in the non-pregnant group (Fig.   6c). [score:5]
bta-let-7 microRNAs may inhibit the NF-κB pathway in part by targeting Ras, an NF-κB activator [61]. [score:5]
However, in cells transfected with Lin28B siRNA, LPS was no longer able to suppress bta-let-7 miRNA expression (Fig.   6e). [score:5]
These results suggested that bta-let-7 miRNAs inhibit the activation of NF-κB at least partly through targeting Ras. [score:5]
Bta-let-7 miRNAs inhibit activation of NF-κB signaling and expression of proinflammatory cytokines. [score:5]
Bta-let-7 miRNAs inhibit the activation of NF-κB signaling and expression of proinflammatory cytokines. [score:5]
Lin28B, a highly conserved RNA -binding protein that functions as a suppressor of let-7 microRNAs, is thought to play important roles in development, oncogenesis [59], and immune tolerance during pregnancy [60]. [score:4]
b Conservation of the let-7 target sequence in NRAS among different species (upper panel), and a common seed sequence of bta-let-7 miRNA families (lower panel). [score:3]
Two-tailed Student’s t-test, * P < 0.05; ** P < 0.01 Members of the let-7 family are suppressors of NF-κB signaling 18, 30. [score:3]
c qPCR analysis showing the effect of placental exosomes (p-EXO) and non-pregnant exosomes (n-EXO) on the expression of the bta-let-7 family; U6 was used as a control. [score:3]
Members of the let-7 family are suppressors of NF-κB signaling 18, 30. [score:3]
In addition, miR-499 or let-7 may be potential therapeutic agents for pregnancy disorders caused by early uterine inflammation or provide references for the treatment of other inflammatory diseases. [score:3]
The oncogene Ras, an activator of the NF-κB 34, 35, is also a well-known target of let-7 miRNAs [36]. [score:3]
3.1-Lin28B vector in BEND cells, and the expression levels of bta-let-7 family members that were decreased by agomiR-499 were detected by qPCR. [score:3]
Lin-28 homolog B (Lin28B), an RNA -binding protein, promotes degradation of the let-7 family of miRNAs (let-7 miRNAs) [17] and was identified as a target of miR-499 in this study. [score:3]
In vitro, placental exosome-derived bta-miR-499 inhibited the activation of NF-κB via the Lin28B/let-7 axis, thus repressing LPS -induced inflammation in BEND cells. [score:3]
Fig. 6. a BEND cells were transfected with agomiR-499, and the expression of the bta-let-7 family was determined by qPCR. [score:3]
3.1-Lin28B vector led to a significant decrease in the expression of bta-let-7 family members (Fig.   6b). [score:3]
Lin28B is an RNA -binding protein and an inhibitor of let-7 family members 31, 32. [score:3]
Two-tailed Student’s t-test, * P < 0.05; ** P < 0.01 a BEND cells were transfected with agomiR-499, and the expression of the bta-let-7 family was determined by qPCR. [score:3]
However, exosome treatment resulted in the differential expression of let-7a-5p, bta-let-7c and bta-let-7i (Fig.   6c and supplementary Fig.   1), inconsistent with the abundance of bta-let-7 miRNAs carried by exosomes. [score:3]
To determine the effect of bta-let-7 miRNAs on activation of NF-κB, we performed NF-κB -dependent luciferase reporter assays in BEND cells transfected with a p-NF-κB reporter plasmid along with either agomiR-let-7a-5p or agomiR-let-7c for 24 h and then induced by LPS for 1 h. Luciferase activity was downregulated in the presence of agomiR-let-7a-5p or agomiR-let-7c (Fig.   7a). [score:3]
Collectively, these data confirmed a critical role of miR-499 in maintaining an appropriate local immune microenvironment during early pregnancy by targeting the Lin28B/let-7 axis. [score:3]
Transfection of BEND cells with agomiR-499 led to a significant increase in the expression of the bta-let-7 family (Fig.   6a), similar to that observed following Lin28B siRNA treatment (Fig.   6b). [score:3]
Collectively, placental exosome-derived bta-miR-499, Lin28B, and bta-let-7 miRNAs constitute a loop that negatively regulates NF-κB p65 activation, contributing to the pro/anti-inflammatory balance at the maternal-fetal interface during early pregnancy in cattle To further validate the selective sorting of miR-499 into exosomes during early pregnancy, we isolated exosomes from peripheral blood plasma from Institute of Cancer Research (ICR) mice on day 8.5 of pregnancy (day 0.5 = vaginal plug), and mmu-miR-499 was detected by qPCR. [score:2]
Therefore, we hypothesized that placental exosome- delivered miR-499 mediates the inflammatory balance at the maternal-fetal interface by regulating the NF-κB signaling pathway through the Lin28B/let-7 axis, thereby forming an immune-tolerant microenvironment in the uterus that is beneficial for pregnancy maintenance in the first trimester. [score:2]
These results suggest that exosome-derived bta-let-7 miRNAs cooperate with bta-miR-499 to participate in the regulation of NF-κB signaling. [score:2]
Based on these results, bta-miR-499 with the Lin28B/let-7 axis constitutes the key regulatory mechanism in the immune inflammatory response during early pregnancy in cattle. [score:2]
These results demonstrated that placental exosome-derived bta-miR-499, Lin28B, and bta-let-7 miRNAs constitute a loop that negatively regulates NF-κB p65 activation (Fig.   7g). [score:2]
miR-499 and let-7 miRNAs both belong to broadly conserved miRNA families that have unique cross-species advantages. [score:1]
To determine whether treatment with placental exosomes also increased the expression of bta-let-7 miRNA levels in BEND cells, we evaluated bta-let-7 miRNA levels in both non-pregnant and early pregnant exosomes by qPCR. [score:1]
In addition, BEND cells induced by LPS exhibited a significant decrease in bta-let-7 miRNAs (supplementary Fig.   2b) and increased Lin28B levels (Fig.   6d). [score:1]
The luciferase reporter plasmids were co -transfected with the pNF-κB-luc plasmids in 293T cells to determine the impact of let-7 miRNAs on the promoter activities of NF-κB. [score:1]
Moreover, an additional complementary pathway through which placental exosome-derived let-7 miRNAs are involved in this process was identified. [score:1]
For let-7 miRNAs and RNA sequencing data validation, the Poly(A) Plus real-time PCR method was used. [score:1]
Roush S Slack FJ The let-7 family of microRNAsTrends Cell Biol. [score:1]
As shown in Fig.   7b, bta-let-7 miRNAs share a common seed sequence and a highly conserved binding site in the NRAS 3′-UTR. [score:1]
e BEND cells were transfected with Lin28B siRNA for 24 h and then induced by LPS for 1 h; the levels of the bta-let-7 family were determined by qPCR. [score:1]
Wei YB Elevation of Il6 is associated with disturbed let-7 biogenesis in a genetic mo del of depressionTransl. [score:1]
Interestingly, we also observed abundant bta-let-7 microRNAs in both placental exosomes and non-pregnant exosomes, but only bta-let-7c and bta-let-7f differed significantly. [score:1]
[1 to 20 of 52 sentences]
2
[+] score: 109
Similarly, TGs concentration was significantly lower in the bta-let-7i inhibitor group (P<0.01, Fig 9C), and very few differentiated cells treated with bta-let-7i inhibitor expressed perilipin (Fig 9D), in which the expression levels of peroxisome proliferator-activated receptor gamma (PPARG) and perilipin-1 (PLIN1) were markedly decreased (P<0.05, Fig 9F and 9G). [score:9]
The bta-let-7i -inhibitor and its NC were transfected into pre-adipocytes, and bta-let-7i expression significantly downregulated (P<0.01, Fig 9A). [score:8]
The dual luciferase reporter system was then used to validate the target genes described in Fig 7. To determine whether bta-let-7i and bta-miR-2305 can directly target their predicted target genes, including MAP3K1, proheparin -binding epidermal growth factor-like growth factor (HBEGF), serine/threonine-protein kinase (PAK1) and Ras-related C3 botulinum toxin substrate 2 (RAC2), we designed luciferase reporter constructs that included either the wild- or mutant-type 3’-UTR of MAP3K1, HBEGF, PAK1 and RAC2 (Fig 7C). [score:8]
Regarding qRT-PCR used validate relative gene expression of the 8 selected miRNAs, we showed in Fig 5E that miR-let-7i, miR-2305 and miR-2890 were upregulated and the expression of miR-874, miR-1, miR-106b, miR-1296 and miR-362-5p decreased in steers. [score:8]
0185961.g009 Fig 9A: Relative expression levels of bta-let-7i in the bta-let-7i inhibitor and inhibitor-NC groups. [score:7]
Interestingly, our data on targets validation provided strong evidence that MAP3K1 and HBEGF are targets of bta-let-7i, whereas PAK1 and RAC2 are targets of bta-miR-2305 (Fig 7C, 7D, 7E, 7F and 7G). [score:7]
The effects of overexpression or suppression of bta- let-7i or bta-miR-2305 on the levels of mRNA expression of endogenous MAP3K1, HBEGF, PAK1 and RAC2 were further examined. [score:7]
A: Relative expression levels of bta-let-7i in the bta-let-7i inhibitor and inhibitor-NC groups. [score:7]
B: Lipid droplet formation in the inhibitor-NC and bta-let-7i inhibitor groups after differentiation induction (oil red O staining, 200×). [score:5]
These results demonstrated that MAP3K1 and HBEGF are targets of bta-let-7i, whereas PAK1 and RAC2 are targets of bta-miR-2305. [score:5]
F: Effect of bta-let-7i -mimics, mimic-NC or bta-let-7i -inhibitor, inhibitor-NC on MAP3K1 or HBEGF mRNA levels in bovine pre-adipocytes. [score:5]
D: Bovine pre-adipocytes were transfected with bta-let-7i -inhibitor and inhibitor-NC for 6 d and stained for adipocyte perilipin using anti-Perilipin A antibody (green) and DAPI (blue) (400×). [score:5]
However, further research is needed to determine whether the bta-let-7i promotes bovine pre-adipocytes differentiation by directly targeting MAP3K1 and HBEGF. [score:4]
Fig 8 shows that only 9 DE miRNAs (bta-let-7i, bta-miR-1296, bta-miR-141, bta-miR-150, bta-miR-151-3p, bta-miR-193a-3p, bta-miR-224, bta-miR-2890, and bta-miR-454) and 42 DE target genes were observed. [score:3]
The qRT-PCR results showed that bta- let-7i or bta-miR-2305 could markedly affect the expression of MAP3K1, HBEGF, PAK1 and RAC2 mRNA (P<0.05; Fig 7F and 7G). [score:3]
Chemically synthetic bta- let-7i and bta-miR-2305 mimics or inhibitor and the negative control (purchased from Ribobio, Guangzhou, China) were transfected into 293A or primary pre-adipocyte cells using a standard reverse transfection protocol at 50 nM. [score:3]
Bovine pre-adipocytes were transfected with bta- let-7i or bta-miR-2305 mimics, inhibitor and NC. [score:3]
Of note, co-transfection with bta-let-7i and bta-miR-2305 significantly suppressed luciferase activity (Fig 7D and 7E), and wild-type MAP3K1, HBEGF, PAK1, RAC2 groups had approximately 48% (P<0.01), 33% (P<0.01), 22% (P<0.05) and 17% (P<0.05) less luciferase activity, respectively, than the corresponding NC groups. [score:3]
0185961.g008 Fig 8 To investigate whether bta-let-7i are involved in bovine pre-adipocyte differentiation, the expression of bta-let-7i was suppressed. [score:3]
After 6 d of differentiation, the number of lipid droplets was clearly decreased in the group of cells transfected with bta-let-7i inhibitor compared with the NC group (Fig 9B). [score:2]
D, E: Effect of bta- let-7i–mimic or bta-miR-2305 mimic and its mimic-NC on luciferase activity in 293A cells transfected with either the WT 3’UTR or 3’UTR-Mut reporter. [score:1]
From this analysis, bta-let-7i in the molecular network was selected for further analysis. [score:1]
These findings implying that bta-let-7i might affect adipogenesis or lipid metabolism by affecting MAPK signaling pathway, which is supported by our findings from the functional identification of bta-let-7i on bovine pre-adipocytes. [score:1]
These findings indicated that bta-let-7i could promote the differentiation of bovine pre-adipocytes, and also gives supports for the molecular network that helps direct further investigations of the miRNA -mediated physiological regulation in IMF tissue in cattle. [score:1]
[1 to 20 of 24 sentences]
3
[+] score: 52
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-21, hsa-mir-23a, hsa-mir-30a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-196a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-196a-2, hsa-mir-210, hsa-mir-181a-1, hsa-mir-218-1, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-30b, hsa-mir-128-1, hsa-mir-145, hsa-mir-191, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-30c-1, hsa-mir-99b, hsa-mir-296, hsa-mir-30e, hsa-mir-361, hsa-mir-337, hsa-mir-148b, hsa-mir-196b, hsa-mir-425, hsa-mir-20b, hsa-mir-486-1, hsa-mir-488, hsa-mir-181d, hsa-mir-498, hsa-mir-519c, hsa-mir-520a, hsa-mir-526b, hsa-mir-520d, hsa-mir-506, hsa-mir-92b, hsa-mir-608, hsa-mir-617, hsa-mir-625, hsa-mir-641, hsa-mir-1264, hsa-mir-1271, bta-let-7f-2, bta-mir-103-1, bta-mir-148a, bta-mir-21, bta-mir-30d, bta-mir-128-1, bta-mir-145, bta-mir-181a-2, bta-mir-30b, bta-mir-181b-2, bta-mir-20b, bta-mir-30e, bta-mir-92a-2, bta-let-7d, bta-mir-148b, bta-mir-181c, bta-mir-191, bta-mir-210, bta-mir-23a, bta-mir-361, bta-mir-425, bta-let-7g, bta-mir-30a, bta-let-7a-1, bta-let-7f-1, bta-mir-30c, bta-mir-23b, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-99b, hsa-mir-890, hsa-mir-888, hsa-mir-889, hsa-mir-938, hsa-mir-1184-1, hsa-mir-1203, hsa-mir-1204, hsa-mir-1265, hsa-mir-103b-1, hsa-mir-103b-2, bta-mir-128-2, bta-mir-181d, bta-mir-196a-2, bta-mir-196a-1, bta-mir-196b, bta-mir-218-1, bta-mir-296, bta-mir-30f, bta-mir-486, bta-mir-488, bta-mir-92a-1, bta-mir-92b, bta-mir-1271, bta-mir-181a-1, bta-mir-181b-1, bta-mir-148c, hsa-mir-1184-2, hsa-mir-1184-3, hsa-mir-486-2, bta-mir-1264, bta-mir-148d
Consequently, the expression trends of 8 differentially expressed miRNAs (miR-128, miR-1271, miR-181a, let-7i, let-7c and let-7a) in SE animal group were found to show opposite expression pattern relative to their potential target genes (Table  3). [score:9]
Accordingly, the result evidenced that the miRNAs including the let-7 family members showed inverse expression profiles with the expression patterns of their potential target genes. [score:7]
Furthermore, members of the Let-7 miRNA family are believed to regulate the expression of cytokines which are directly or indirectly involved in host-functions [37– 41]. [score:6]
In line to this, we have confirmed that although the dysregulation of miRNA expression patterns both in SE and CE seem to have a similar pattern, significant analysis revealed altered expression profiles of 102 miRNAs including the let-7 family (let-7a, let-7c, let-7d, let-7d*, let-7e, let-7f and let-7i) in SE group 35 miRNAs including let-7e, let-7f, miR1265 and miR-608 in CE animals. [score:6]
Therefore, expression alterations in the Let-7 family miRNAs in cows suffering from endometritis may demonstrate the consequences of bacterial infections on the expression pattern of these miRNAs. [score:5]
In addition, miRNA expression analysis indicated the dysregulation of 35 miRNAs including miR-608, miR-526b* and miR-1265 in CE animals and 102 miRNAs including let-7 family (let-7a, let-7c, let-7d, let-7d*, let-7e, let-7f, let-7i) in SE animals. [score:4]
In deed, one of the interesting findings of the current study was the downregulation of the let-7 miRNA family in animals affected by endometritis. [score:4]
Altered expression of let-7 might result in abnormal cell development and cancer [33]. [score:4]
The let-7 miRNA family is believed to be involved in a wide range of cellular functions and is implicated in modulation of several diseases. [score:3]
Interestingly, the expression level of certain miRNA families namely, the let 7 family (let-7a, let-7c, let-7d, let-7d*, let-7e, let-7f, let-7i), miR-181 family (miR-181a, miR-181b), miR-30 family (miR-30b*, miR-30c-2*, miR-30e ), miR-425 family (miR-425, miR-425*), miR-92 family (miR-92a, miR-92a-1*, miR-92b) and miR-196 family (miR-196a, and miR-196b) were repressed in SE animal group. [score:3]
Similarly, in the current study, miR-148b, miR-486-5p, miR-23b, miR-99b and members of the let-7 families were altered in animals affected by subclinical endometritis. [score:1]
[1 to 20 of 11 sentences]
4
[+] score: 30
We then normalized the relative expression of all miRNAs in eggs, frustrated larvae and female ticks against the expression of rmi-let-7 in female ticks (Additional file 7). [score:5]
Interestingly, among the most abundantly expressed R. microplus miRNAs in salivary glands, only let-7 orthologs were found expressed in human salivary glands [46, 47]. [score:5]
Among the miRNAs expressed in both females and males, 22 were up regulated in females (P < 9.62E-05) including the let-7-complex miRNAs rmi-let-7a, rmi-miR-100 and rmi-miR-125 (let-C miRNAs) (Table 5 and Additional file 9). [score:4]
The expression of let-7 in the salivary glands of ticks and vertebrates suggests a functional role for this miRNA throughout the evolution of this organ. [score:3]
We observed correlated co -expression profiles of tick miRNAs overlapping two D. melanogaster clusters, miR-100:miR-125:let-7 and miR-275:miR-305 indicating that these clusters may also be conserved in the cattle tick genome (Additional file 12). [score:3]
Differential accumulation of these let-7-C miRNAs, which were shown to co-transcribe as a single polycistronic primary transcript [33], may be due to post-transcriptional processing of mature miRNAs from primary transcripts undergoing developmental regulation [34- 36]. [score:3]
We also verified that rmi-let-7 is highly expressed in female ticks as compared to eggs or frustrated larvae samples (Additional file 5). [score:2]
This approach identified 46 R. microplus miRNAs including four duplicated copies for rmi-let-7 (a, f, m and n), and two duplicated copies for rmi-miR-219 and rmi-miR-285. [score:1]
We found tick miRNAs overlapping five of these clusters, including the miR-100:miR-125:let-7, miR-275:miR-305, miR-2a-2:miR-2a-1:miR-2b-2, and miR-310:miR-311:miR-312:miR-313:miR-991:miR-992 clusters (Additional file 12). [score:1]
Some miRNAs are highly conserved throughout evolution including let-7, present in metazoan lineages such as arthropods and vertebrates that diverged 641-686 MYA [16]. [score:1]
Interestingly let-7, miR-100 and miR-125 are known to be clustered in the same genomic location in the D. melanogaster and A. gambiae genomes within 1 kb and 4.5 kb, respectively [30]. [score:1]
Interestingly, loss of function of let-7 in Drosophila specifically affects female reproduction, while males retain fertility levels comparable to that in wild type flies [33]. [score:1]
[1 to 20 of 12 sentences]
5
[+] score: 27
Other miRNAs from this paper: ssc-mir-122, ssc-mir-125b-2, ssc-mir-181b-2, ssc-mir-20a, ssc-mir-23a, ssc-mir-26a, ssc-mir-29b-1, ssc-mir-181c, ssc-mir-214, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-103-1, ssc-mir-107, ssc-mir-21, ssc-mir-29c, ssc-mir-30c-2, bta-mir-26a-2, bta-mir-29a, bta-let-7f-2, bta-mir-103-1, bta-mir-20a, bta-mir-21, bta-mir-26b, bta-mir-30d, bta-mir-499, bta-mir-99a, bta-mir-125b-1, bta-mir-126, bta-mir-181a-2, bta-mir-199a-1, bta-mir-30b, bta-mir-107, bta-mir-10a, bta-mir-127, bta-mir-142, bta-mir-181b-2, bta-mir-30e, bta-mir-92a-2, bta-let-7d, bta-mir-132, bta-mir-138-2, bta-mir-17, bta-mir-181c, bta-mir-192, bta-mir-199b, bta-mir-200a, bta-mir-200c, bta-mir-214, bta-mir-23a, bta-mir-29b-2, bta-mir-29c, bta-mir-455, bta-let-7g, bta-mir-10b, bta-mir-30a, bta-mir-200b, bta-let-7a-1, bta-let-7f-1, bta-mir-122, bta-mir-30c, bta-mir-25, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-125b-2, bta-mir-99b, ssc-mir-99b, ssc-mir-17, ssc-mir-30b, ssc-mir-199b, bta-mir-1-2, bta-mir-1-1, bta-mir-129-1, bta-mir-129-2, bta-mir-133a-2, bta-mir-133a-1, bta-mir-133b, bta-mir-135b, bta-mir-138-1, bta-mir-143, bta-mir-144, bta-mir-146b, bta-mir-146a, bta-mir-181d, bta-mir-190a, bta-mir-199a-2, bta-mir-202, bta-mir-206, bta-mir-211, bta-mir-212, bta-mir-223, bta-mir-26a-1, bta-mir-29d, bta-mir-30f, bta-mir-338, bta-mir-33a, bta-mir-33b, bta-mir-375, bta-mir-429, bta-mir-451, bta-mir-92a-1, bta-mir-92b, bta-mir-29e, bta-mir-29b-1, bta-mir-181a-1, bta-mir-181b-1, ssc-mir-133a-1, ssc-mir-1, ssc-mir-146b, ssc-mir-181a-1, ssc-mir-30a, bta-mir-199c, ssc-mir-206, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-133b, ssc-mir-29a, ssc-mir-30d, ssc-mir-30e, ssc-mir-199a-2, ssc-mir-499, ssc-mir-143, ssc-mir-10a, ssc-mir-10b, ssc-mir-103-2, ssc-mir-181a-2, ssc-mir-181b-1, ssc-mir-181d, ssc-mir-99a, ssc-mir-92a-2, ssc-mir-92a-1, ssc-mir-92b, ssc-mir-192, ssc-mir-142, ssc-mir-127, ssc-mir-202, ssc-mir-129a, ssc-mir-455, ssc-mir-125b-1, ssc-mir-338, ssc-mir-133a-2, ssc-mir-146a, bta-mir-26c, ssc-mir-30c-1, ssc-mir-126, ssc-mir-199a-1, ssc-mir-451, ssc-let-7a-2, ssc-mir-129b, ssc-mir-429, ssc-let-7d, ssc-let-7f-2, ssc-mir-29b-2, ssc-mir-132, ssc-mir-138, ssc-mir-144, ssc-mir-190a, ssc-mir-212, bta-mir-133c, ssc-mir-26b, ssc-mir-200b, ssc-mir-223, ssc-mir-375, ssc-mir-33b
Some muscle miRNAs have well-defined target genes, as miR-206 regulates IGF-1; miR-1, miR-122, and miR-462 control IGF-2a; the let-7 family regulates MSTN; miR-103 and miR-107 modulate GHR and FSHR; and miR-138 and miR-211 control LHR. [score:5]
MiR-118 and let-7i are differentially expressed and target both tlr4 and nfil3-6 genes. [score:5]
Let-7i is predominantly expressed in the spleen during bacterial infection and displays a noticeable difference in expression between SGC and RGC (Xu et al., 2015). [score:4]
A cellular micro -RNA, let-7i, regulates Toll-like receptor 4 expression and contributes to cholangiocyte immune responses against Cryptosporidium parvum infection. [score:4]
The 21-nucleotide let-7 RNA regulates developmental timing in Caenorhabditis elegans. [score:3]
MicroRNA microarray identifies Let-7i as a novel biomarker and therapeutic target in human epithelial ovarian cancer. [score:2]
The let-7 family is known to regulate multiple genes related to the cell cycle and proliferation (Yang et al., 2008), and let-7i was shown to influence innate immunity (Chen et al., 2007). [score:2]
The first miRNAs, lin-4 and let-7, were both discovered in Caenorhabditis elegans (Lee et al., 1993; Wightman et al., 1993; Reinhart et al., 2000) and have subsequently been found to correspond to a novel and extensive class of small non-coding RNAs (Lagos-Quintana et al., 2001; Lau et al., 2001; Lee and Ambros, 2001). [score:1]
A cellular function for the RNA-interference enzyme Dicer in the maturation of the let-7 small temporal RNA. [score:1]
[1 to 20 of 9 sentences]
6
[+] score: 21
Among the top 10 abundantly expressed miRNAs in each group, 7 miRNAs (bta-miR-26a, bta-miR-10b, bta-let-7a-5p, bta-let-7f, bta-let-7i, bta-miR-27b and bta-miR-191) were commonly expressed in both preovulatory and subordinate follicles (Table 2). [score:5]
Similarly, Miles et al. [35], applied cDNA libraries and massive parallel sequencing, showed members of the let-7 family to be abundantly expressed in bovine ovaries. [score:3]
Similarly, bta-miR-26a, let-7 family, bta-miR-10b and bta-miR-143 were among the top 10 abundantly expressed miRNAs in bovine ovarian and testicular tissues [36]. [score:3]
Interestingly, bta-miR-26a, bta-miR-10b and 3 isoforms of the let-7 family (bta-let-7a-5p, bta-let-7f and bta-let-7i) were among the top 10 abundantly expressed miRNAs in granulosa cells of both preovulatory dominant and subordinate follicles. [score:3]
Previous study in our lab identified that Let-7 family and bta-miR-143 are abundantly expressed in cDNA library cloned from bovine ovary signifying their potential role in bovine ovarian functions [11]. [score:3]
Similarly, bta-let-7f as one of the eight let-7 family isoforms, found to be highly abundant both in dominant and subordinate follicles with slightly higher expression in subordinate follicles. [score:3]
Similarly, three isoforms of the let-7 family (bta-let-7a-5p, bta-let-7f and bta-let-7i) comprised 8.5 and 7.3% of sequence reads aligned to known miRNAs in preovulatory dominant and in subordinate follicles, respectively. [score:1]
[1 to 20 of 7 sentences]
7
[+] score: 21
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26b, hsa-mir-27a, hsa-mir-31, hsa-mir-33a, hsa-mir-99a, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-147a, hsa-mir-34a, hsa-mir-182, hsa-mir-199a-2, hsa-mir-212, hsa-mir-221, hsa-mir-224, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-132, hsa-mir-142, hsa-mir-145, hsa-mir-152, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-127, hsa-mir-134, hsa-mir-200c, hsa-mir-106b, hsa-mir-361, hsa-mir-148b, hsa-mir-20b, hsa-mir-410, hsa-mir-202, hsa-mir-503, hsa-mir-33b, hsa-mir-643, hsa-mir-659, bta-let-7f-2, bta-mir-103-1, bta-mir-148a, bta-mir-21, bta-mir-221, bta-mir-26b, bta-mir-27a, bta-mir-99a, bta-mir-125a, bta-mir-125b-1, bta-mir-145, bta-mir-199a-1, bta-mir-27b, bta-mir-30b, bta-mir-31, bta-mir-127, bta-mir-142, bta-mir-20b, bta-let-7d, bta-mir-132, bta-mir-148b, bta-mir-200c, bta-mir-22, bta-mir-23a, bta-mir-29b-2, bta-mir-361, bta-let-7g, bta-mir-24-2, bta-let-7a-1, bta-let-7f-1, bta-mir-25, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-125b-2, bta-mir-34a, hsa-mir-708, hsa-mir-147b, hsa-mir-877, hsa-mir-940, hsa-mir-548j, hsa-mir-302e, hsa-mir-103b-1, hsa-mir-103b-2, bta-mir-100, bta-mir-106b, bta-mir-130a, bta-mir-134, bta-mir-147, bta-mir-152, bta-mir-153-1, bta-mir-153-2, bta-mir-182, bta-mir-24-1, bta-mir-199a-2, bta-mir-202, bta-mir-212, bta-mir-224, bta-mir-33a, bta-mir-33b, bta-mir-410, bta-mir-708, bta-mir-877, bta-mir-940, bta-mir-29b-1, bta-mir-148c, bta-mir-503, bta-mir-148d
For this a total of six miRNAs representing those whose expression was induced (miR-212, miR-182 & let-7 g) or suppressed (miR-100, miR-877 and miR-200c) due to hyperstimulation were selected for detecting their expression in exosome and Ago2 fractions. [score:7]
As shown in Fig.   4 expression analysis of candidate miRNAs (miR-221, miR-103, let-7 g, miR-134, miR-147 and miR-127-3p) using qRT-PCR revealed the presence of temporal changes in the pattern of expression depending on the time during the estrous cycle as shown in Fig.   4. While four of the candidates namely. [score:5]
However, there is no significant difference in the expression of let-7 g across the estrous days. [score:3]
unst)  Pathways in cancer let-7 g, miR- 20b-3p, −22, −26b-3p, −34a, −221, −181c 1.44E-09 AKT3, PIK3R3, RASSF1, KRAS, MEK, DCC  Wnt signaling pathway let-7 g, miR-221, −32 4.04E-08 WNT1, SMAD2, DKK2, DVL3, VANGL2, CCND1  Neurotrophin signaling pathway let-7 g, miR-22, −181c, −221 6.73E-08 NTRK2, IRS2, AKT3, NGF, PIK3CD, NRAS  Axon guidance miR-34a, −181c, −221 2.19E-07 PLXNC1, DPYSL2, PAK1, MET, KRAS, EFNB1  Endocytosis miR-22, −34a, −130b-3p, −576-5p 1.23E-06 TGFBR1, RAB5A, RAB11FIP4, PDCD6IP, VPS37A  MAPK signaling pathway let-7 g, miR-22, −32, −34a, −221 2.69E-06 RRAS, MAP3K1, MAPK1, MAPK9, SRF, MAP2K4  Colorectal cancer let-7 g, miR-22, −26b-3p, −24-2-5p 4.59E-06 DCC, TGFBR1, KRAS, MAP2K1, AKT3, CASP3  Chronic myeloid leukemia miR-22, −181c, −221 4.98E-06 NRAS, AKT2, BCR, MAPK1, GAB2, BCL2L1  TGF-beta signaling pathway miR-26b-3p, −221, −22, −32 9.63E-06 ACVR2A, TGFBR2, SMAD2, SMAD4, BMP7  ErbB signaling pathway miR-22, −181c, −221 2.96E-05 ERBB4, GAB1, MAP2K1, PAK4, PIK3CD Underexpressed miRNAs (Hyp vs. [score:3]
miR-221, miR-103, miR-134 and miR-127-3p showed a significant increase in abundance at day 7 of the estrous cycle compared to days 0 and 3, miR-147 showed a decreasing pattern from day 0 to day 7. No significant difference in the expression of let-7 g miRNA has been observed between the days during estrous cycle. [score:2]
Data are presented as raw Ct value and Ct value of more than 35 was considered as undetected Here we have tried to detect candidate miRNAs, which were enriched (miR-221, miR-103 & let-7 g) or suppressed (miR-134, miR-147 & miR-127-3p) in blood plasma samples of hyperstimulated animals compared to the unstimulated ones. [score:1]
[1 to 20 of 6 sentences]
8
[+] score: 18
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-98, hsa-mir-99a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-10a, hsa-mir-10b, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-181a-1, hsa-mir-221, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-27b, hsa-mir-30b, hsa-mir-130a, hsa-mir-152, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-185, hsa-mir-193a, hsa-mir-320a, hsa-mir-200c, hsa-mir-1-1, hsa-mir-181b-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-99b, hsa-mir-130b, hsa-mir-30e, hsa-mir-363, hsa-mir-374a, hsa-mir-375, hsa-mir-378a, hsa-mir-148b, hsa-mir-331, hsa-mir-339, hsa-mir-423, hsa-mir-20b, hsa-mir-491, hsa-mir-193b, hsa-mir-181d, hsa-mir-92b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, bta-mir-29a, bta-let-7f-2, bta-mir-148a, bta-mir-18a, bta-mir-20a, bta-mir-221, bta-mir-27a, bta-mir-30d, bta-mir-320a-2, bta-mir-99a, bta-mir-181a-2, bta-mir-27b, bta-mir-30b, bta-mir-106a, bta-mir-10a, bta-mir-15b, bta-mir-181b-2, bta-mir-193a, bta-mir-20b, bta-mir-30e, bta-mir-92a-2, bta-mir-98, bta-let-7d, bta-mir-148b, bta-mir-17, bta-mir-181c, bta-mir-191, bta-mir-200c, bta-mir-22, bta-mir-29b-2, bta-mir-29c, bta-mir-423, bta-let-7g, bta-mir-10b, bta-mir-24-2, bta-mir-30a, bta-let-7a-1, bta-let-7f-1, bta-mir-30c, bta-mir-25, bta-mir-363, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-15a, bta-mir-19a, bta-mir-19b, bta-mir-331, bta-mir-374a, bta-mir-99b, hsa-mir-374b, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, bta-mir-1-2, bta-mir-1-1, bta-mir-130a, bta-mir-130b, bta-mir-152, bta-mir-181d, bta-mir-182, bta-mir-185, bta-mir-24-1, bta-mir-193b, bta-mir-29d, bta-mir-30f, bta-mir-339a, bta-mir-374b, bta-mir-375, bta-mir-378-1, bta-mir-491, bta-mir-92a-1, bta-mir-92b, bta-mir-9-1, bta-mir-9-2, bta-mir-29e, bta-mir-29b-1, bta-mir-181a-1, bta-mir-181b-1, bta-mir-320b, bta-mir-339b, bta-mir-19b-2, bta-mir-320a-1, bta-mir-193a-2, bta-mir-378-2, hsa-mir-378b, hsa-mir-320e, hsa-mir-378c, bta-mir-148c, hsa-mir-374c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-378j, bta-mir-378b, bta-mir-378c, bta-mir-378d, bta-mir-374c, bta-mir-148d
The well-known let-7(a/b/d/f) family is involved in oncogene expression [67], and let-7/miR-98 family members are expressed late in mammalian embryonic development [68]. [score:6]
MiR-320, miR-181a, miR-30a-3p and let-7 were shown to be downregulated in colorectal cancer [74]. [score:4]
Interestingly, all of the let-7 family members (let-7a, let-7c and let-7f) could target CCL25. [score:3]
Most importantly, these miRNAs were highly expressed, and let-7 family members (let-7a/f/c), miR-181a and miR-30a-3p were enriched among the top 10 miRNAs. [score:3]
In our study, 8 miRNA families (let-7, mir-1, mir-17, mir-181, mir-148, mir-30, mir-92 and mir-99) were found with at least 3 members among all exosome miRNAs. [score:1]
The let-7 family had 9 members, miR-181 family had 4 members (miR-181a/b/c/d) and miR-30 family had 5 members (miR-30a/b/c/d/e). [score:1]
[1 to 20 of 6 sentences]
9
[+] score: 18
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-27a, hsa-mir-31, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-16-2, hsa-mir-192, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-181a-2, hsa-mir-205, hsa-mir-181a-1, hsa-mir-214, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-146a, hsa-mir-184, hsa-mir-186, hsa-mir-193a, hsa-mir-194-1, hsa-mir-155, hsa-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-219a-2, hsa-mir-99b, hsa-mir-26a-2, hsa-mir-365a, hsa-mir-365b, hsa-mir-374a, hsa-mir-148b, hsa-mir-423, hsa-mir-486-1, hsa-mir-499a, hsa-mir-532, hsa-mir-590, bta-mir-26a-2, bta-let-7f-2, bta-mir-103-1, bta-mir-148a, bta-mir-16b, bta-mir-21, bta-mir-221, bta-mir-222, bta-mir-27a, bta-mir-499, bta-mir-125b-1, bta-mir-181a-2, bta-mir-205, bta-mir-27b, bta-mir-30b, bta-mir-31, bta-mir-193a, bta-let-7d, bta-mir-148b, bta-mir-186, bta-mir-191, bta-mir-192, bta-mir-200a, bta-mir-214, bta-mir-22, bta-mir-23a, bta-mir-29c, bta-mir-423, bta-let-7g, bta-mir-24-2, bta-let-7a-1, bta-mir-532, bta-let-7f-1, bta-mir-30c, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-125b-2, bta-mir-365-1, bta-mir-374a, bta-mir-99b, hsa-mir-374b, hsa-mir-664a, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-1915, bta-mir-146a, bta-mir-155, bta-mir-16a, bta-mir-184, bta-mir-24-1, bta-mir-194-2, bta-mir-219-1, bta-mir-223, bta-mir-26a-1, bta-mir-365-2, bta-mir-374b, bta-mir-486, bta-mir-763, bta-mir-9-1, bta-mir-9-2, bta-mir-181a-1, bta-mir-2284i, bta-mir-2284s, bta-mir-2284l, bta-mir-2284j, bta-mir-2284t, bta-mir-2284d, bta-mir-2284n, bta-mir-2284g, bta-mir-2339, bta-mir-2284p, bta-mir-2284u, bta-mir-2284f, bta-mir-2284a, bta-mir-2284k, bta-mir-2284c, bta-mir-2284v, bta-mir-2284q, bta-mir-2284m, bta-mir-2284b, bta-mir-2284r, bta-mir-2284h, bta-mir-2284o, bta-mir-664a, bta-mir-2284e, bta-mir-1388, bta-mir-194-1, bta-mir-193a-2, bta-mir-2284w, bta-mir-2284x, bta-mir-148c, hsa-mir-374c, hsa-mir-219b, hsa-mir-499b, hsa-mir-664b, bta-mir-2284y-1, bta-mir-2284y-2, bta-mir-2284y-3, bta-mir-2284y-4, bta-mir-2284y-5, bta-mir-2284y-6, bta-mir-2284y-7, bta-mir-2284z-1, bta-mir-2284aa-1, bta-mir-2284z-3, bta-mir-2284aa-2, bta-mir-2284aa-3, bta-mir-2284z-4, bta-mir-2284z-5, bta-mir-2284z-6, bta-mir-2284z-7, bta-mir-2284aa-4, bta-mir-2284z-2, hsa-mir-486-2, hsa-mir-6516, bta-mir-2284ab, bta-mir-664b, bta-mir-6516, bta-mir-219-2, bta-mir-2284ac, bta-mir-219b, bta-mir-374c, bta-mir-148d
While let-7i directly regulates the expression of toll-like receptor 4 (TLR4) [16], miR-27b targets KH-type splicing regulatory protein (KSRP) to coordinate TLR4 -mediated epithelial immune responses to pathogens [17], indicating that miRNA may act as a critical regulator in epithelial immune responses. [score:9]
Recent studies on human epithelial cells infected by a protozoan parasite (Cryptosporidium parvum) revealed the up-regulation of let-7i or miR-27b. [score:4]
The let-7 miRNA family was identified as the common denominator of Salmonella-regulated miRNAs in macrophages and epithelial cells, thus suggesting that repression of let-7 relieves cytokine IL-6 and IL-10 mRNAs from negative post-transcriptional control, thus establishing a paradigm of miRNA -mediated feed-forward activation of inflammatory factors when mammalian cells are targeted by bacterial pathogens [54]. [score:4]
In addition, the role of Let-7 miRNA family in immunity is well established. [score:1]
[1 to 20 of 4 sentences]
10
[+] score: 16
Over -expression of let-7c in human liver was implicated in hepatocytes oxidant injury [40] while let-7 g was demonstrated to suppress HCC metastasis in a mouse mo del [41]. [score:5]
Five of the thirteen members of the let-7 family are also highly expressed in this study including let-7c, let-7i, let-7 g, miR-3596 and let-7-f. The let-7 family members have been associated with hepatic development and disorders as well as glucose and insulin metabolism [39]. [score:4]
Five out of thirteen let-7 miRNA family members are also among the highly expressed. [score:3]
The most highly expressed liver are all evolutionary conserved and include five members of the 13-member let-7 family (let-7c, let-7i, let-7 g, let-7f-2 and miR-3596). [score:3]
The remaining seven most highly abundant were four members of the let 7 family (let-7c, let-7i, let-7 g and let-7f-2) which accounted for 3% while miR-140 accounted for ~1.5% and both miR-29a and miR-423 made up ~0.5% each (Figure 1). [score:1]
[1 to 20 of 5 sentences]
11
[+] score: 16
Other miRNAs from this paper: bta-mir-26a-2, bta-mir-29a, bta-let-7f-2, bta-mir-151, bta-mir-21, bta-mir-27a, bta-mir-125b-1, bta-mir-205, bta-mir-27b, bta-mir-193a, bta-mir-98, bta-let-7d, bta-mir-17, bta-mir-200a, bta-mir-200c, bta-mir-210, bta-mir-29b-2, bta-mir-29c, bta-let-7g, bta-mir-200b, bta-let-7a-1, bta-mir-150, bta-let-7f-1, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-125b-2, bta-mir-15a, bta-mir-100, bta-mir-130a, bta-mir-146a, bta-mir-155, bta-mir-184, bta-mir-219-1, bta-mir-223, bta-mir-28, bta-mir-494, bta-mir-708, bta-mir-9-1, bta-mir-9-2, bta-mir-29e, bta-mir-29b-1, bta-mir-2284i, bta-mir-2285a, bta-mir-2284s, bta-mir-2285d, bta-mir-2284l, bta-mir-2284j, bta-mir-2284t, bta-mir-2285b-1, bta-mir-2284d, bta-mir-2284n, bta-mir-2284g, bta-mir-2284p, bta-mir-2284u, bta-mir-2284f, bta-mir-2284a, bta-mir-2284k, bta-mir-2284c, bta-mir-2284v, bta-mir-2285c, bta-mir-2284q, bta-mir-2284m, bta-mir-2284b, bta-mir-2284r, bta-mir-2284h, bta-mir-2284o, bta-mir-664a, bta-mir-2284e, bta-mir-2284w, bta-mir-2284x, bta-mir-3596, bta-mir-652, bta-mir-2284y-1, bta-mir-2285e-1, bta-mir-2285e-2, bta-mir-2285f-1, bta-mir-2285f-2, bta-mir-2285g-1, bta-mir-2285h, bta-mir-2285i, bta-mir-2285j-1, bta-mir-2285j-2, bta-mir-2285k-1, bta-mir-2285l, bta-mir-2285o-1, bta-mir-2285o-2, bta-mir-2285n-1, bta-mir-2285n-2, bta-mir-2285p, bta-mir-2285m-1, bta-mir-2285m-2, bta-mir-2284y-2, bta-mir-2285n-3, bta-mir-2285n-4, bta-mir-2284y-3, bta-mir-2285o-3, bta-mir-2285o-4, bta-mir-2285m-3, bta-mir-2284y-4, bta-mir-2284y-5, bta-mir-2284y-6, bta-mir-2285m-4, bta-mir-2285o-5, bta-mir-2285m-5, bta-mir-2285n-5, bta-mir-2285n-6, bta-mir-2284y-7, bta-mir-2285n-7, bta-mir-2284z-1, bta-mir-2284aa-1, bta-mir-2285k-2, bta-mir-2284z-3, bta-mir-2284aa-2, bta-mir-2284aa-3, bta-mir-2285k-3, bta-mir-2285k-4, bta-mir-2284z-4, bta-mir-2285k-5, bta-mir-2284z-5, bta-mir-2284z-6, bta-mir-2284z-7, bta-mir-2284aa-4, bta-mir-2285q, bta-mir-2285r, bta-mir-2285s, bta-mir-2285t, bta-mir-2285b-2, bta-mir-2285v, bta-mir-2284z-2, bta-mir-2285g-2, bta-mir-2285g-3, bta-mir-2285af-1, bta-mir-2285af-2, bta-mir-2285y, bta-mir-2285w, bta-mir-2285x, bta-mir-2285z, bta-mir-2285u, bta-mir-2285aa, bta-mir-2285ab, bta-mir-2284ab, bta-mir-664b, bta-mir-2285ac, bta-mir-2285ad, bta-mir-2284ac, bta-mir-2285ae, bta-mir-2285ag, bta-mir-2285ah, bta-mir-2285ai, bta-mir-2285aj, bta-mir-2285ak, bta-mir-2285al, bta-mir-2285am, bta-mir-2285ar, bta-mir-2285as-1, bta-mir-2285as-2, bta-mir-2285as-3, bta-mir-2285at-1, bta-mir-2285at-2, bta-mir-2285at-3, bta-mir-2285at-4, bta-mir-2285au, bta-mir-2285av, bta-mir-2285aw, bta-mir-2285ax-1, bta-mir-2285ax-2, bta-mir-2285ax-3, bta-mir-2285ay, bta-mir-2285az, bta-mir-2285an, bta-mir-2285ao-1, bta-mir-2285ao-2, bta-mir-2285ap, bta-mir-2285ao-3, bta-mir-2285aq-1, bta-mir-2285aq-2, bta-mir-2285ba-1, bta-mir-2285ba-2, bta-mir-2285bb, bta-mir-2285bc, bta-mir-2285bd, bta-mir-2285be, bta-mir-2285bf-1, bta-mir-2285bf-2, bta-mir-2285bf-3, bta-mir-2285bg, bta-mir-2285bh, bta-mir-2285bi-1, bta-mir-2285bi-2, bta-mir-2285bj-1, bta-mir-2285bj-2, bta-mir-2285bk, bta-mir-2285bl, bta-mir-2285bm, bta-mir-2285bn, bta-mir-2285bo, bta-mir-2285bp, bta-mir-2285bq, bta-mir-2285br, bta-mir-2285bs, bta-mir-2285bt, bta-mir-2285bu-1, bta-mir-2285bu-2, bta-mir-2285bv, bta-mir-2285bw, bta-mir-2285bx, bta-mir-2285by, bta-mir-2285bz, bta-mir-2285ca, bta-mir-2285cb, bta-mir-2285cc, bta-mir-2285cd, bta-mir-2285ce, bta-mir-2285cf, bta-mir-2285cg, bta-mir-2285ch, bta-mir-2285ci, bta-mir-2285cj, bta-mir-2285ck, bta-mir-2285cl, bta-mir-2285cm, bta-mir-2285cn, bta-mir-2285co, bta-mir-2285cp, bta-mir-2285cq, bta-mir-2285cr-1, bta-mir-2285cr-2, bta-mir-2285cs, bta-mir-2285ct, bta-mir-2285cu, bta-mir-2285cv-1, bta-mir-2285cv-2, bta-mir-2285cw-1, bta-mir-2285cw-2, bta-mir-2285cx, bta-mir-2285cy, bta-mir-2285cz, bta-mir-2285da, bta-mir-2285db, bta-mir-2285dc, bta-mir-2285dd, bta-mir-2285de, bta-mir-2285df, bta-mir-2285dg, bta-mir-2285dh, bta-mir-2285di, bta-mir-2285dj, bta-mir-2285dk, bta-mir-2285dl-1, bta-mir-2285dl-2, bta-mir-2285dm
The down-regulation of let-7 family members, for example, was shown to promote expression of IL-10 and IL-6 in HeLa cells infected with Salmonella enterica serovar Typhimurium [64]. [score:6]
For example, bta-let-7 miRNAs were up-regulated at both 4 and 6 hours post-infection with S. uberis. [score:4]
The observed up-regulation of let-7 miRNAs in our study may lead to the repression of anti-inflammatory cytokines to promote innate immunity. [score:4]
These miRNAs represent seven different miRNA families; miR-let-7 (bta-let-7i & bta-miR-3596), miR-21 (bta-miR-21), miR-27 (bta-miR-27a & bta-miR-27b), miR-28 (bta-miR-151), miR-184 (bta-miR-184), miR-200 (bta-miR-200a & bta-miR-200b), and miR-205 (bta-miR-205). [score:1]
The let-7 family has been extensively described in the literature for having a role in immunity. [score:1]
[1 to 20 of 5 sentences]
12
[+] score: 16
Another member of let-7 family, bta-let-7c, which was found to be up-regulated by 3.2 folds in the LPS challenged bubaline PBMCs of the present study have been previously reported [35] to be up-regulated in whole blood of mice 6 h following 100-μg LPS (L3755) injection. [score:7]
For example, Lipopolysaccharide (LPS) treatment results in decrease of let-7 expression along with increased TLR4 expression [7]. [score:5]
Moreover, the miRNA-let7i along with other let-7 family members was observed to be down-regulated in murine macrophages during Salmonella infection [40]. [score:4]
[1 to 20 of 3 sentences]
13
[+] score: 16
The selection of miRNAs examined was based on the sequencing results; four of the selected miRNAs had been highly expressed and showed a moderate difference in expression between ‘non-cleaved’ COCs and COCs that gave rise to a blastocyst, namely let-7g, let-7i, miR-222 and miR-218. [score:5]
Interestingly, let-7 miRNAs are negatively associated with pluripotency [43], although they are highly expressed in oocytes [35, 44]. [score:3]
High expression levels of various let-7 family members have been reported in cumulus cells; among the most abundant let-7 family members were let-7f, let-7i and let-7g. [score:3]
Bussing I. Slack F. J. Grosshans H. let-7 microRNAs in development, stem cells and cancer Trends Mol. [score:2]
In human cumulus cells, members of the let-7 family and miR-21 are also the most abundant miRNAs; however, their functions remain unclear [14]. [score:1]
Different members of the let-7 family, miR-155 and miR-99a-5p also gave more than 100,000 reads in each group (Table 2). [score:1]
Our sequencing results showed that miR-21-5p is the most abundant miRNA in bovine cumulus cells, followed by various members of the let-7 family and miR-155. [score:1]
[1 to 20 of 7 sentences]
14
[+] score: 15
Other miRNAs from this paper: bta-let-7f-2, bta-mir-101-2, bta-mir-103-1, bta-mir-21, bta-mir-27a, bta-mir-30d, bta-mir-320a-2, bta-mir-199a-1, bta-mir-27b, bta-mir-30b, bta-mir-107, bta-mir-140, bta-mir-30e, bta-let-7d, bta-mir-124a-1, bta-mir-199b, bta-mir-200a, bta-mir-200c, bta-let-7g, bta-mir-30a, bta-mir-200b, bta-let-7a-1, bta-let-7f-1, bta-mir-122, bta-mir-30c, bta-mir-25, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-1-2, bta-mir-1-1, bta-mir-101-1, bta-mir-124a-2, bta-mir-124b, bta-mir-133a-2, bta-mir-133a-1, bta-mir-143, bta-mir-152, bta-mir-154a, bta-mir-185, bta-mir-199a-2, bta-mir-206, bta-mir-30f, bta-mir-335, bta-mir-33a, bta-mir-33b, bta-mir-370, bta-mir-378-1, bta-mir-432, bta-mir-9-1, bta-mir-9-2, bta-mir-1224, bta-mir-376b, bta-mir-376d, bta-mir-376c, bta-mir-376a, bta-mir-1839, bta-mir-1185, bta-mir-2284i, bta-mir-2285a, bta-mir-2284s, bta-mir-2285d, bta-mir-2284l, bta-mir-2284j, bta-mir-2284t, bta-mir-2285b-1, bta-mir-2284d, bta-mir-2284n, bta-mir-2284g, bta-mir-199c, bta-mir-2284p, bta-mir-2284u, bta-mir-2363-1, bta-mir-2363-2, bta-mir-2284f, bta-mir-2284a, bta-mir-2284k, bta-mir-2284c, bta-mir-2284v, bta-mir-2285c, bta-mir-2284q, bta-mir-2284m, bta-mir-2284b, bta-mir-320b, bta-mir-2284r, bta-mir-2284h, bta-mir-2284o, bta-mir-2284e, bta-mir-320a-1, bta-mir-378-2, bta-mir-2284w, bta-mir-2284x, bta-mir-3432a-1, bta-mir-3432a-2, bta-mir-3604-1, bta-mir-3604-2, bta-mir-2284y-1, bta-mir-2285e-1, bta-mir-2285e-2, bta-mir-2285f-1, bta-mir-2285f-2, bta-mir-2285g-1, bta-mir-2285h, bta-mir-2285i, bta-mir-2285j-1, bta-mir-2285j-2, bta-mir-2285k-1, bta-mir-2285l, bta-mir-2285o-1, bta-mir-2285o-2, bta-mir-2285n-1, bta-mir-2285n-2, bta-mir-2285p, bta-mir-2285m-1, bta-mir-2285m-2, bta-mir-2284y-2, bta-mir-378b, bta-mir-2285n-3, bta-mir-2285n-4, bta-mir-2284y-3, bta-mir-154c, bta-mir-376e, bta-mir-154b, bta-mir-2285o-3, bta-mir-2285o-4, bta-mir-2285m-3, bta-mir-378c, bta-mir-2284y-4, bta-mir-2284y-5, bta-mir-2284y-6, bta-mir-2285m-4, bta-mir-2285o-5, bta-mir-2285m-5, bta-mir-2285n-5, bta-mir-2285n-6, bta-mir-6526-1, bta-mir-6526-2, bta-mir-503, bta-mir-2284y-7, bta-mir-6526-3, bta-mir-2285n-7, bta-mir-2284z-1, bta-mir-2284aa-1, bta-mir-2285k-2, bta-mir-2284z-3, bta-mir-2284aa-2, bta-mir-2284aa-3, bta-mir-2285k-3, bta-mir-2285k-4, bta-mir-2284z-4, bta-mir-2285k-5, bta-mir-2284z-5, bta-mir-2284z-6, bta-mir-2284z-7, bta-mir-6536-1, bta-mir-2284aa-4, bta-mir-6536-2, bta-mir-2285q, bta-mir-2285r, bta-mir-2285s, bta-mir-2285t, bta-mir-2285b-2, bta-mir-2285v, bta-mir-2284z-2, bta-mir-2285g-2, bta-mir-2285g-3, bta-mir-2285af-1, bta-mir-2285af-2, bta-mir-2285y, bta-mir-2285w, bta-mir-2285x, bta-mir-2285z, bta-mir-2285u, bta-mir-2285aa, bta-mir-2285ab, bta-mir-2284ab, bta-mir-2285ac, bta-mir-2285ad, bta-mir-2284ac, bta-mir-2285ae, bta-mir-378d, bta-mir-3432b, bta-mir-2285ag, bta-mir-2285ah, bta-mir-2285ai, bta-mir-2285aj, bta-mir-2285ak, bta-mir-2285al, bta-mir-2285am, bta-mir-2285ar, bta-mir-2285as-1, bta-mir-2285as-2, bta-mir-2285as-3, bta-mir-2285at-1, bta-mir-2285at-2, bta-mir-2285at-3, bta-mir-2285at-4, bta-mir-2285au, bta-mir-2285av, bta-mir-2285aw, bta-mir-2285ax-1, bta-mir-2285ax-2, bta-mir-2285ax-3, bta-mir-2285ay, bta-mir-2285az, bta-mir-2285an, bta-mir-2285ao-1, bta-mir-2285ao-2, bta-mir-2285ap, bta-mir-2285ao-3, bta-mir-2285aq-1, bta-mir-2285aq-2, bta-mir-2285ba-1, bta-mir-2285ba-2, bta-mir-2285bb, bta-mir-2285bc, bta-mir-2285bd, bta-mir-2285be, bta-mir-2285bf-1, bta-mir-2285bf-2, bta-mir-2285bf-3, bta-mir-2285bg, bta-mir-2285bh, bta-mir-2285bi-1, bta-mir-2285bi-2, bta-mir-2285bj-1, bta-mir-2285bj-2, bta-mir-2285bk, bta-mir-2285bl, bta-mir-2285bm, bta-mir-2285bn, bta-mir-2285bo, bta-mir-2285bp, bta-mir-2285bq, bta-mir-2285br, bta-mir-2285bs, bta-mir-2285bt, bta-mir-2285bu-1, bta-mir-2285bu-2, bta-mir-2285bv, bta-mir-2285bw, bta-mir-2285bx, bta-mir-2285by, bta-mir-2285bz, bta-mir-2285ca, bta-mir-2285cb, bta-mir-2285cc, bta-mir-2285cd, bta-mir-2285ce, bta-mir-2285cf, bta-mir-2285cg, bta-mir-2285ch, bta-mir-2285ci, bta-mir-2285cj, bta-mir-2285ck, bta-mir-2285cl, bta-mir-2285cm, bta-mir-2285cn, bta-mir-2285co, bta-mir-2285cp, bta-mir-2285cq, bta-mir-2285cr-1, bta-mir-2285cr-2, bta-mir-2285cs, bta-mir-2285ct, bta-mir-2285cu, bta-mir-2285cv-1, bta-mir-2285cv-2, bta-mir-2285cw-1, bta-mir-2285cw-2, bta-mir-2285cx, bta-mir-2285cy, bta-mir-2285cz, bta-mir-2285da, bta-mir-2285db, bta-mir-2285dc, bta-mir-2285dd, bta-mir-2285de, bta-mir-2285df, bta-mir-2285dg, bta-mir-2285dh, bta-mir-2285di, bta-mir-2285dj, bta-mir-2285dk, bta-mir-2285dl-1, bta-mir-2285dl-2, bta-mir-2285dm
Such an expression pattern indicates that they may have more dramatic functions, e. g., miR-27 in signaling and immune responses [53], miR-103 in the regulation of neuronal migration by modulating Cyclin -dependent kinase 5, regulatory subunit 1 (CDK5R1) expression [54], and let-7 in developmental timing in Caenorhabditis elegans [55]. [score:8]
In addition, let-7 regulates adipocyte differentiation in part by targeting the transcription factor high-mobility group AT-hook 2 (HMGA2), thereby promoting the transition of preadipocytes from clonal expansion to terminal differentiation [52]. [score:4]
For example, let-7, miR-1, miR-25, miR-9, and miR-25 families have been found in 68, 69, 68, 72, and 68 species, respectively, while miR-2363, miR-3432, miR-3604, miR-6526, and miR-6536 families have only been detected in bos taurus (Table S5). [score:1]
The largest miRNA family size identified was miR-2284, which consisted of 27 members; miR-2285, let-7, miR-30, and miR-376 possessed 22, 8, 6, and 5 members, respectively, whereas other miRNA families such as miR-107, miR-122, miR-140, and miR-1839 had only one member (Table S1). [score:1]
In addition, the most abundant miRNA family was let-7, accounting for about 86% and 82% of the total sequence reads from the fetal and adult libraries, respectively. [score:1]
[1 to 20 of 5 sentences]
15
[+] score: 15
This confirmed a number of known functions e. g. of the let-7 family in suppressing embryonic development and cell cycle progress 22, 23, and the miR-17 family in suppressing cell cycle arrest 24, 25. [score:6]
The let-7 family is known to suppress embryonic development and cell cycle progression 22, 23 and to play a role in DNA damage response 28, 29. [score:4]
The interaction between let-7 and the non-coding H19 RNA was also confirmed (Table  2). [score:1]
Examples of cooperativity among abundant miRNA families included all pairwise combinations of let-7, miR-21 and -27. [score:1]
By analyzing AGO-bound miRNAs in MDBK cells, we found the abundance profile dominated by members of the miR-30, let-7, miR-17, miR-374, miR-21, miR-27 and miR-15 families together accounting for more than 50% (Supplementary Fig.   S2a) [14]. [score:1]
Among protein coding ceRNA-miRNA pairs, we confirmed strong interactions for HMGA2/let-7, KRAS/let-7 and the PTEN network although abundant binding of other miRNAs was also evident for some of these RNAs. [score:1]
Type Gene ceRNA Ann cow miRNA MDBK 3′UTR miRNA chimeras Non-coding H19 Yes let-7 let-7 Coding PTEN PTENP1 No miR-21 Various miRNAs, mostly miR-27 CNOT6L Yes miR-17, miR-19 miR-17 and miR-25 VAPA Yes miR-17, miR-19 miR-17 ZEB2 Yes miR-26, miR-25 None KRAS KRAS1P Yes let-7 let-7 present, but mostly miR-27 and miR-222 HMGA2 No let-7 let-7 TGFBR3 No let-7 let-7 peak in exon, miR-15, -17, -21, -27 and -31 peaks in 3′UTRDefinitions of previously described ceRNAs in human or mouse were obtained from ref. [score:1]
[1 to 20 of 7 sentences]
16
[+] score: 13
These genes are targets of the downregulated miRNAs bta-let-7 and bta-miR-423 (i. e. downregulated in the L group). [score:9]
The miR-423 and let-7 family, upregulated in the high (H) IMF group, have been previously reported to be associated with obesity in humans and disorders in glucose metabolism in mice [16, 34] and have been implicated as possible biomarkers for risk of obesity [16, 34]. [score:4]
[1 to 20 of 2 sentences]
17
[+] score: 13
In contrast, three of the measured targets were significantly down-regulated during acute FMDV infection: bta-let-7 g (−1.96 fold decrease), bta-miR-1281 (−2.50 fold decrease), and bta-miR-26b (-3.09 fold decrease) (Table  2 and Fig.   2a). [score:4]
In contrast, the ViTa algorithm found that more of these miRNAs could potentially target the genome, adding bta-miR-205, bta-miR-26b, bta-let-7 g, bta-miR-34a, bta-miR-144, bta-miR-181b, and bta-miR-147 to the list. [score:3]
Of the differentially regulated miRNAs, 16 (bta-miR-23b-5p, let-7 g, bta-miR-22-5p, bta-miR-1224, bta-miR-144, bta-miR-497, bta-miR-455-3p, bta-miR-154a, bta-miR-369-3p, bta-miR-26b, bta-miR-34a, bta-miR-205, bta-miR-181b, bta-miR-146a, bta-miR-17-5p, and bta-miR-31) have previously been described to play a role in cellular proliferation or apoptosis (Fig.   6b, orange circle). [score:2]
Despite that, the miRNA profiles generated from human serum collected from individuals infected with related + ssRNA viruses (Dengue virus and HCV) showed some dysregulated miRNAs shared with the ones reported for FMDV here, which included: let-7 g, miR-22-5p, miR-23b-5p, miR-146a, and miR-497 [51, 52]. [score:2]
The non-clustered miRNAs included: let-7 g, bta-miR-26b, bta-miR-150, bta-miR-34a, bta-miR-146a, bta-miR-147, bta-miR-205, bta-miR-455-3p, bta-miR-1224, bta-miR-1281, and bta-miR-31. [score:1]
The remaining 8 miRNAs are encoded within intronic regions: bta-miR-26b, bta-miR-455-3p, bta-miR-23b-5p, bta-let-7 g, bta-miR-22-5p, bta-miR-147, bta-miR-369-3p, and bta-miR-1224. [score:1]
[1 to 20 of 6 sentences]
18
[+] score: 12
Both are affected by retinoic acid, though let-7 is up-regulated [32] and miRNA-146 is inhibited by retinoic acid [31]. [score:6]
Let-7 appears to induce differentiation pathways through the inhibition of Lin28, among several other targets [32]. [score:4]
For instance, the let-7 family and miRNA-146 regulate spermatogonia differentiation [31], [32], though through different mechanisms. [score:2]
[1 to 20 of 3 sentences]
19
[+] score: 12
microRNA miRBase Accession Mature Sequence (5'-3') Reference bta-let-7a MIMAT0003844 UGAGGUAGUAGGUUGUAUAGUU[29] bta-let-7b MIMAT0004331 UGAGGUAGUAGGUUGUGUGGUU[29] bta-let-7e MIMAT0004333 UGAGGUAGGAGGUUGUAUAGU[29] bta-let-7f MIMAT0003519 UGAGGUAGUAGAUUGUAUAGUU[29] bta-let-7g MIMAT0003838 UGAGGUAGUAGUUUGUACAGUU[29] bta-let-7i MIMAT0003851 UGAGGUAGUAGUUUGUGCUGUU[29] bta-miR-98 MIMAT0003809 UGAGGUAGUAAGUUGUAUUGUU[30] bta-miR-145 MIMAT0003542 GUCCAGUUUUCCCAGGAAUCCCU[29] Approximately 160 kb were sequenced from the 0.6 Mb to 3.9 Mb polled region on BTA01 for polymorphism detection by targeting known gene coding and regulatory regions as well as putative regulatory regions (Table 1). [score:5]
Six of the eight microRNAs (Table 5) are members of a microRNA family, bta-let-7. The let-7 microRNA family has been found to function in late development timing in C. elegans, and one of multiple targets of the let-7 microRNA in C. elegans is a nuclear hormone receptor daf-12 in the seam cells of the hypodermis [21]. [score:4]
All bta-let-7 and the bta-mir-98 microRNA seed sequences (2–8 bp from the 5' end of the microRNA) [18] are disrupted with the bSYNJ1_C3981T allele concordant with the horn phenotype ('C'). [score:1]
microRNA miRBase Accession Mature Sequence (5'-3') Reference bta-let-7a MIMAT0003844 UGAGGUAGUAGGUUGUAUAGUU[29] bta-let-7b MIMAT0004331 UGAGGUAGUAGGUUGUGUGGUU[29] bta-let-7e MIMAT0004333 UGAGGUAGGAGGUUGUAUAGU[29] bta-let-7f MIMAT0003519 UGAGGUAGUAGAUUGUAUAGUU[29] bta-let-7g MIMAT0003838 UGAGGUAGUAGUUUGUACAGUU[29] bta-let-7i MIMAT0003851 UGAGGUAGUAGUUUGUGCUGUU[29] bta-miR-98 MIMAT0003809 UGAGGUAGUAAGUUGUAUUGUU[30] bta-miR-145 MIMAT0003542 GUCCAGUUUUCCCAGGAAUCCCU[29] A total of 13 novel SNPs concordant with the polled trait in Holsteins (Table 2) were identified. [score:1]
All bta-let-7 and bta-mir-98 microRNA seed sequences appear functionally intact with the bSYNJ1_C3981T allele concordant with the polled phenotype ('T'). [score:1]
[1 to 20 of 5 sentences]
20
[+] score: 11
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-21, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-99a, mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-99a, mmu-mir-140, mmu-mir-10b, mmu-mir-181a-2, mmu-mir-24-1, mmu-mir-191, hsa-mir-192, hsa-mir-148a, hsa-mir-30d, mmu-mir-122, hsa-mir-10b, hsa-mir-181a-2, hsa-mir-181a-1, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-122, hsa-mir-140, hsa-mir-191, hsa-mir-320a, mmu-mir-30d, mmu-mir-148a, mmu-mir-192, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-21a, mmu-mir-22, mmu-mir-24-2, mmu-mir-26a-1, mmu-mir-92a-2, mmu-mir-25, mmu-mir-181a-1, mmu-mir-26a-2, mmu-mir-92a-1, hsa-mir-26a-2, hsa-mir-423, hsa-mir-451a, mmu-mir-451a, hsa-mir-486-1, mmu-mir-486a, mmu-mir-423, bta-mir-26a-2, bta-let-7f-2, bta-mir-148a, bta-mir-21, bta-mir-30d, bta-mir-320a-2, bta-mir-99a, bta-mir-181a-2, bta-mir-27b, bta-mir-140, bta-mir-92a-2, bta-let-7d, bta-mir-191, bta-mir-192, bta-mir-22, bta-mir-423, bta-let-7g, bta-mir-10b, bta-mir-24-2, bta-let-7a-1, bta-let-7f-1, bta-mir-122, bta-mir-25, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, hsa-mir-1246, bta-mir-24-1, bta-mir-26a-1, bta-mir-451, bta-mir-486, bta-mir-92a-1, bta-mir-181a-1, bta-mir-320a-1, mmu-mir-486b, hsa-mir-451b, bta-mir-1246, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-mir-451b, mmu-let-7k, hsa-mir-486-2
It has been reported that members of the let-7 family target, and directly inhibit, interleukin-6 (IL-6). [score:6]
Disease specific enrichment of circulating let-7 family microRNA in MuSK+ myasthenia gravis. [score:3]
During tumorgenesis, NF-κB mediates the inflammatory response, reducing transcription of let-7 family members. [score:1]
IL-6 increases when let-7 family members are depleted [27]. [score:1]
[1 to 20 of 4 sentences]
21
[+] score: 11
Other miRNAs from this paper: bta-mir-29a, bta-let-7f-2, bta-mir-27a, bta-mir-320a-2, bta-mir-99a, bta-mir-125a, bta-mir-181a-2, bta-mir-27b, bta-mir-10a, bta-mir-139, bta-mir-140, bta-mir-181b-2, bta-mir-487a, bta-let-7d, bta-mir-124a-1, bta-mir-181c, bta-mir-29b-2, bta-mir-29c, bta-mir-423, bta-let-7g, bta-mir-10b, bta-let-7a-1, bta-mir-487b, bta-let-7f-1, bta-mir-122, bta-mir-25, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-195, bta-mir-34a, bta-mir-1-2, bta-mir-1-1, bta-mir-124a-2, bta-mir-124b, bta-mir-133a-2, bta-mir-133a-1, bta-mir-133b, bta-mir-154a, bta-mir-181d, bta-mir-184, bta-mir-206, bta-mir-29d, bta-mir-335, bta-mir-33a, bta-mir-33b, bta-mir-486, bta-mir-495, bta-mir-95, bta-mir-9-1, bta-mir-9-2, bta-mir-29e, bta-mir-29b-1, bta-mir-1271, bta-mir-1249, bta-mir-181a-1, bta-mir-181b-1, bta-mir-2284i, bta-mir-2286, bta-mir-2300a, bta-mir-2300b, bta-mir-2284s, bta-mir-2284l, bta-mir-2284j, bta-mir-2284t, bta-mir-2284d, bta-mir-2319a, bta-mir-2319b, bta-mir-2284n, bta-mir-2284g, bta-mir-2329-1, bta-mir-2329-2, bta-mir-2284p, bta-mir-2284u, bta-mir-2363-1, bta-mir-2363-2, bta-mir-2284f, bta-mir-2284a, bta-mir-2284k, bta-mir-2284c, bta-mir-2284v, bta-mir-2396, bta-mir-2285c, bta-mir-2284q, bta-mir-2404-1, bta-mir-2284m, bta-mir-2284b, bta-mir-320b, bta-mir-2284r, bta-mir-2443, bta-mir-2284h, bta-mir-2450c, bta-mir-2450b, bta-mir-2450a, bta-mir-2404-2, bta-mir-2284o, bta-mir-2484, bta-mir-2284e, bta-mir-320a-1, bta-mir-2887-1, bta-mir-2887-2, bta-mir-2284w, bta-mir-3431, bta-mir-2284x, bta-mir-3432a-1, bta-mir-3432a-2, bta-mir-574, bta-mir-2284y-1, bta-mir-2284y-2, bta-mir-2284y-3, bta-mir-154c, bta-mir-154b, bta-mir-2284y-4, bta-mir-2284y-5, bta-mir-2284y-6, bta-mir-6526-1, bta-mir-6526-2, bta-mir-503, bta-mir-2284y-7, bta-mir-6526-3, bta-mir-2284z-1, bta-mir-2284aa-1, bta-mir-2284z-3, bta-mir-2284aa-2, bta-mir-2284aa-3, bta-mir-2284z-4, bta-mir-2284z-5, bta-mir-2284z-6, bta-mir-2284z-7, bta-mir-6536-1, bta-mir-2284aa-4, bta-mir-6536-2, bta-mir-2284z-2, bta-mir-133c, bta-mir-2284ab, bta-mir-2284ac, bta-mir-3432b, bta-mir-2450d
The results showed that miR-29a, miR-27a, and let-7i were highly expressed in MDSC-P; in contrast, miR-320, miR-1, and miR-206 were highly expressed in MDSC-D3. [score:5]
The ubiquitously expressed let-7 members, let-7a-5p, let-7f, and let-7b, followed, and miR-1 had the fifth greatest count. [score:3]
For example, the let-7, miR-25, miR-1, miR-10, miR-8, miR-9, and miR-124 families have been found in 68, 68, 69, 70, 71, 72, and 73 species, respectively, while the miR-2484, miR-2300, miR-2319, miR-2329, miR-2363, miR-2404, miR-2450, miR-2887, miR-3432, miR-2604, miR-6526, and miR-6536 families have only been detected in cattle (Additional file 8). [score:1]
The largest miRNA family identified was miR-2284, which consisted of 63 members, and miR-154, let-7, and miR-181/30 possessed 18, 12, and 6 members, respectively; other miRNA families, such as miR-122, miR-1249, miR-140, and miR-486, had only one member, whereas miR-1940, miR-2286, miR-3431, and miR-574 did not belong to any gene family (Additional file 8). [score:1]
This was also the case for some other miRNA families, such as bta-let-7 (1442–1,331,479 reads), bta-miR-10 (24–10,950 reads), bta-miR-29 (1–153,254 reads) and bta-miR-181 (1–4694 reads). [score:1]
[1 to 20 of 5 sentences]
22
[+] score: 11
In the MC fraction 18 miRNAs (up regulation: Bta-miR-25, -106b, -93, -140, 15a, -652, -26b, -221, -223, bta-let-7i, down regulation: Bta-miR-125a, -125b, -2898, -193a-5p, 320a, 100, -200c, -200b) and in SM 7 miRNAs (Bta-miR-92a, -20a, -25, -29b, -29c, -140, 21-5p) were found to be regulated (Fig 3A and 3B, Table 3). [score:4]
13 miRNAs (bta-miR-25, bta-miR-93, bta-miR-106b, bta-miR-125b, bta-miR-193a-5p, bta-miR-200b, bta-miR-200c, bta-miR-221, bta-miR-2898, bta-let-7i (MC); bta-miR-20a, bta-miR-29b, bta-miR-92 (SM)) which were found to be regulated during early pregnancy using NGS resutling, in case of MC miRNAs, in separation of cyclic and pregnant animals in PCA, were validated with RT-qPCR. [score:2]
C) PCA of log2 fold-change of the miRNAs: bta-miR-25, bta-miR-93, bta-miR-106b, bta-miR-125b, bta-miR-193a-5p, bta-miR-200b, bta-miR-200c, bta-miR-221, bta-miR-2898, bta-let-7i between days 4 and 18 (Day 18/Day 4) showing the separation of cyclic and pregnant animals. [score:1]
Nevertheless, many potential biomarkers we found (MC: Bta-miR-25, -106b, -93, -221, -223 -193a-5p, -125a/b, -200c, -200b, bta-let-7i; SM: Bta-miR-92a, -20a, -29b/c) have been described to be involved in pregnancy in earlier studies [17, 18, 52– 54]. [score:1]
Consequently, Day 18/Day 4 ratios of cyclic (18c/4c) and pregnant animals (18p/4p) of a set of miRNAs (bta-miR-25, bta-miR-93, bta-miR-106b, bta-miR-125b, bta-miR-193a-5p, bta-miR-200b, bta-miR-200c, bta-miR-221, bta-miR-2898, bta-let-7i) were used in a PCA. [score:1]
Using day 18 to day 4 ratio in MC sequencing data of a set of ten miRNAs (bta-miR-25, bta-miR-93, bta-miR-106b, bta-miR-125b, bta-miR-193a-5p, bta-miR-200b, bta-miR-200c, bta-miR-221, bta-miR-2898, bta-let-7i) discrimination between pregnant and cyclic animals was achieved in a PCA. [score:1]
With the exception of bta-let-7i in MC and bta-miR-20a in SM, a significant correlation was confirmed for all miRNAs including the housekeeping miRNAs. [score:1]
[1 to 20 of 7 sentences]
23
[+] score: 8
Similarly, Network 2 has miRNAs known to regulate adipogenesis, such as the highly expressed let-7 family which has been reported to regulate the transition from clonal expansion to terminal differentiation of adipocytes [53]. [score:5]
The identification of let-7a, let-7b, let-7d, let-7 g, let-7f, and miR-98 in Network 2 also gives credibility to the identification of miRNAs co -expression by Relevant Network Analysis as all miRNAs cited above are members of the let-7 family of miRNAs. [score:3]
[1 to 20 of 2 sentences]
24
[+] score: 7
Other miRNAs from this paper: bta-mir-26a-2, bta-mir-29a, bta-let-7f-2, bta-mir-16b, bta-mir-21, bta-mir-221, bta-mir-222, bta-mir-30d, bta-mir-99a, bta-mir-145, bta-mir-181a-2, bta-mir-199a-1, bta-mir-27b, bta-mir-142, bta-mir-181b-2, bta-mir-30e, bta-mir-92a-2, bta-let-7d, bta-mir-132, bta-mir-181c, bta-mir-191, bta-mir-199b, bta-mir-214, bta-mir-29b-2, bta-mir-29c, bta-mir-455, bta-let-7g, bta-mir-10b, bta-mir-24-2, bta-let-7a-1, bta-mir-150, bta-let-7f-1, bta-mir-122, bta-mir-34c, bta-mir-363, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-195, bta-mir-34a, bta-mir-365-1, bta-mir-99b, bta-mir-100, bta-mir-129-1, bta-mir-129-2, bta-mir-130a, bta-mir-130b, bta-mir-133a-2, bta-mir-133a-1, bta-mir-143, bta-mir-146b, bta-mir-146a, bta-mir-155, bta-mir-181d, bta-mir-182, bta-mir-183, bta-mir-184, bta-mir-24-1, bta-mir-196a-2, bta-mir-196a-1, bta-mir-199a-2, bta-mir-212, bta-mir-26a-1, bta-mir-28, bta-mir-29d, bta-mir-32, bta-mir-335, bta-mir-338, bta-mir-339a, bta-mir-346, bta-mir-365-2, bta-mir-378-1, bta-mir-383, bta-mir-409a, bta-mir-449a, bta-mir-449b, bta-mir-449c, bta-mir-592, bta-mir-708, bta-mir-92a-1, bta-mir-92b, bta-mir-29e, bta-mir-29b-1, bta-mir-1271, bta-mir-1249, bta-mir-181a-1, bta-mir-181b-1, bta-mir-2285a, bta-mir-2285d, bta-mir-2285b-1, bta-mir-2332, bta-mir-199c, bta-mir-2389, bta-mir-2285c, bta-mir-2404-1, bta-mir-449d, bta-mir-2411, bta-mir-2446, bta-mir-339b, bta-mir-2404-2, bta-mir-2483, bta-mir-424, bta-mir-378-2, bta-mir-409b, bta-mir-2285e-1, bta-mir-2285e-2, bta-mir-2285f-1, bta-mir-2285f-2, bta-mir-2285g-1, bta-mir-2285h, bta-mir-2285i, bta-mir-2285j-1, bta-mir-2285j-2, bta-mir-2285k-1, bta-mir-2285l, bta-mir-2285o-1, bta-mir-2285o-2, bta-mir-2285n-1, bta-mir-2285n-2, bta-mir-2285p, bta-mir-2285m-1, bta-mir-2285m-2, bta-mir-378b, bta-mir-2285n-3, bta-mir-2285n-4, bta-mir-2285o-3, bta-mir-2285o-4, bta-mir-2285m-3, bta-mir-378c, bta-mir-2285m-4, bta-mir-2285o-5, bta-mir-2285m-5, bta-mir-2285n-5, bta-mir-2285n-6, bta-mir-2285n-7, bta-mir-2285k-2, bta-mir-2285k-3, bta-mir-2285k-4, bta-mir-2285k-5, bta-mir-2285q, bta-mir-2285r, bta-mir-2285s, bta-mir-2285t, bta-mir-2285b-2, bta-mir-2285v, bta-mir-2285g-2, bta-mir-2285g-3, bta-mir-2285af-1, bta-mir-2285af-2, bta-mir-2285y, bta-mir-2285w, bta-mir-2285x, bta-mir-2285z, bta-mir-2285u, bta-mir-2285aa, bta-mir-2285ab, bta-mir-2285ac, bta-mir-2285ad, bta-mir-2285ae, bta-mir-378d, bta-mir-2285ag, bta-mir-2285ah, bta-mir-2285ai, bta-mir-2285aj, bta-mir-2285ak, bta-mir-2285al, bta-mir-2285am, bta-mir-2285ar, bta-mir-2285as-1, bta-mir-2285as-2, bta-mir-2285as-3, bta-mir-2285at-1, bta-mir-2285at-2, bta-mir-2285at-3, bta-mir-2285at-4, bta-mir-2285au, bta-mir-2285av, bta-mir-2285aw, bta-mir-2285ax-1, bta-mir-2285ax-2, bta-mir-2285ax-3, bta-mir-2285ay, bta-mir-2285az, bta-mir-2285an, bta-mir-2285ao-1, bta-mir-2285ao-2, bta-mir-2285ap, bta-mir-2285ao-3, bta-mir-2285aq-1, bta-mir-2285aq-2, bta-mir-2285ba-1, bta-mir-2285ba-2, bta-mir-2285bb, bta-mir-2285bc, bta-mir-2285bd, bta-mir-2285be, bta-mir-2285bf-1, bta-mir-2285bf-2, bta-mir-2285bf-3, bta-mir-2285bg, bta-mir-2285bh, bta-mir-2285bi-1, bta-mir-2285bi-2, bta-mir-2285bj-1, bta-mir-2285bj-2, bta-mir-2285bk, bta-mir-2285bl, bta-mir-2285bm, bta-mir-2285bn, bta-mir-2285bo, bta-mir-2285bp, bta-mir-2285bq, bta-mir-2285br, bta-mir-2285bs, bta-mir-2285bt, bta-mir-2285bu-1, bta-mir-2285bu-2, bta-mir-2285bv, bta-mir-2285bw, bta-mir-2285bx, bta-mir-2285by, bta-mir-2285bz, bta-mir-2285ca, bta-mir-2285cb, bta-mir-2285cc, bta-mir-2285cd, bta-mir-2285ce, bta-mir-2285cf, bta-mir-2285cg, bta-mir-2285ch, bta-mir-2285ci, bta-mir-2285cj, bta-mir-2285ck, bta-mir-2285cl, bta-mir-2285cm, bta-mir-2285cn, bta-mir-2285co, bta-mir-2285cp, bta-mir-2285cq, bta-mir-2285cr-1, bta-mir-2285cr-2, bta-mir-2285cs, bta-mir-2285ct, bta-mir-2285cu, bta-mir-2285cv-1, bta-mir-2285cv-2, bta-mir-2285cw-1, bta-mir-2285cw-2, bta-mir-2285cx, bta-mir-2285cy, bta-mir-2285cz, bta-mir-2285da, bta-mir-2285db, bta-mir-2285dc, bta-mir-2285dd, bta-mir-2285de, bta-mir-2285df, bta-mir-2285dg, bta-mir-2285dh, bta-mir-2285di, bta-mir-2285dj, bta-mir-2285dk, bta-mir-2285dl-1, bta-mir-2285dl-2, bta-mir-2285dm
For instance, the let-7 family members (bta-let-7f, bta-let-7a-5p, bta-let-7g and let-7i), bta-miR-10b, bta-miR-26a, bta-miR-99b and bta-miR-27b were among the highly expressed miRNAs in all follicular stages at both day 3 and day 7 of the estrous cycle. [score:3]
Indeed, the role of these miRNAs during folliculogenesis is not clearly known, but the let-7 family members are believed to be involved in cell proliferation by targeting multiple genes [32]. [score:3]
Among these, bta-miR-10b, bta-miR-26a, bta-miR-99b, bta-miR-27b, let-7 families (bta-let-7f, and bta-let-7a-5p) and bta-miR-92a appeared ≥10000 read counts in each sample (Figure 2). [score:1]
[1 to 20 of 3 sentences]
25
[+] score: 7
Several target genes for the miR Let-7 and Let-7a-5p were down-regulated in the animals on the Nutr diet (S5 Table), supporting previous evidence concerning the role of the Let-7 family of miRNA in regulating glucose metabolism in the liver [47]. [score:7]
[1 to 20 of 1 sentences]
26
[+] score: 6
Among them, the more expressed let-7, miR-142, miR-196b and lower expressed miR-320a have been reported to regulate lipid metabolism. [score:6]
[1 to 20 of 1 sentences]
27
[+] score: 5
Similar study in zebra fish also indicated that suppression of endogenous let-7 miRNA was associated with retarded embryo development, a lack of proper eye development, and a reduced tail with yolk sac extension [69]. [score:5]
[1 to 20 of 1 sentences]
28
[+] score: 5
Among those, we detected well studied miRNAs including miR-103 which has a pro-adipogenic role [33], miRNA let-7, reported to have an anti-adipogenic role in 3T3-L1 adipocyte cell culture regulating HMGA2 [34] and miR-27b which regulates the expression of PPARγ, considered the master regulator of adipogenesis [35]. [score:5]
[1 to 20 of 1 sentences]
29
[+] score: 4
H19 functions as a post-transcriptional suppressor or miRNA sponge for let-7, helping to regulate the Igf2 signaling pathway [9, 10]. [score:4]
[1 to 20 of 1 sentences]
30
[+] score: 4
Other miRNAs from this paper: bta-mir-29a, bta-let-7f-2, bta-mir-103-1, bta-mir-151, bta-mir-30d, bta-mir-320a-2, bta-mir-126, bta-mir-181a-2, bta-mir-27b, bta-mir-30b, bta-mir-31, bta-mir-34b, bta-mir-107, bta-mir-15b, bta-mir-181b-2, bta-mir-30e, bta-let-7d, bta-mir-124a-1, bta-mir-138-2, bta-mir-181c, bta-mir-214, bta-mir-455, bta-mir-93, bta-let-7g, bta-mir-10b, bta-mir-30a, bta-let-7a-1, bta-mir-487b, bta-let-7f-1, bta-mir-122, bta-mir-30c, bta-mir-25, bta-mir-34c, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-15a, bta-mir-34a, bta-mir-1-2, bta-mir-1-1, bta-mir-105b, bta-mir-124a-2, bta-mir-124b, bta-mir-133a-2, bta-mir-133a-1, bta-mir-133b, bta-mir-138-1, bta-mir-152, bta-mir-181d, bta-mir-196a-2, bta-mir-196a-1, bta-mir-206, bta-mir-30f, bta-mir-409a, bta-mir-432, bta-mir-486, bta-mir-495, bta-mir-543, bta-mir-9-1, bta-mir-9-2, bta-mir-1185, bta-mir-1271, bta-mir-181a-1, bta-mir-181b-1, bta-mir-2284i, bta-mir-2284s, bta-mir-2284l, bta-mir-2284j, bta-mir-2284t, bta-mir-2284d, bta-mir-2284n, bta-mir-2284g, bta-mir-2284p, bta-mir-2284u, bta-mir-2363-1, bta-mir-2363-2, bta-mir-2284f, bta-mir-2284a, bta-mir-2284k, bta-mir-2284c, bta-mir-2384, bta-mir-2284v, bta-mir-2284q, bta-mir-2404-1, bta-mir-2284m, bta-mir-2284b, bta-mir-320b, bta-mir-2424, bta-mir-2284r, bta-mir-2284h, bta-mir-2404-2, bta-mir-2284o, bta-mir-2284e, bta-mir-320a-1, bta-mir-424, bta-mir-2284w, bta-mir-2284x, bta-mir-409b, bta-mir-2284y-1, bta-mir-2284y-2, bta-mir-2284y-3, bta-mir-2284y-4, bta-mir-2284y-5, bta-mir-2284y-6, bta-mir-2284y-7, bta-mir-2284z-1, bta-mir-2284aa-1, bta-mir-2284z-3, bta-mir-2284aa-2, bta-mir-2284aa-3, bta-mir-2284z-4, bta-mir-2284z-5, bta-mir-2284z-6, bta-mir-2284z-7, bta-mir-2284aa-4, bta-mir-2284z-2, bta-mir-133c, bta-mir-2284ab, bta-mir-2284ac
In contrast, five conserved miRNAs (bta-miRNA-543, miRNA-432, let-7i, miRNA-320, and miRNA-152) and seven novel miRNAs (bta-miRn16, miRn18, miRn33, miRn65, miRn70, miRn73, and miRn73) could be quantified from all tissues and several of them (e. g., bta-miRNA-320, miRn33 and miRn65) were relatively consistent across all nine tissue types. [score:1]
For example, let-7, miR-1, miR-34, miR-9, and miR-25 families have been found in 64, 61, 56, 65 and 62 species, respectively, while miR-2363, miR-2384, miR-2404, miR-2424, and miR-409 families have only been detected in bos taurus (Additional file 8). [score:1]
The largest miRNA family size identified was miR-2284, which consisted of 12 members, and let-7, miR-30, and miR-181/376 possessed 9, 7, and 4 members, respectively; whereas other miRNA families such as miR-1, miR-31, miR-93, and miR-206 had only one member (Additional file 1). [score:1]
This was also the case for some other miRNA families, such as bta-let-7 (from 6 to 1,434,682 reads), bta-miR-30 (from 34 to 12,681 reads) and bta-miR-181 (from 376 to 20,258 reads). [score:1]
[1 to 20 of 4 sentences]
31
[+] score: 4
Pasquinelli AE Conservation of the sequence and temporal expression of let-7 heterochronicregulatory RNANature. [score:4]
[1 to 20 of 1 sentences]
32
[+] score: 4
Intriguingly, metformin acts by upregulating miRNA let-7 through AMPK activation, leading to degradation of H19 lncRNA, which normally binds to and inactivates SAHH. [score:4]
[1 to 20 of 1 sentences]
33
[+] score: 4
Other miRNAs from this paper: mmu-let-7g, mmu-let-7i, mmu-mir-23b, mmu-mir-29b-1, mmu-mir-30b, mmu-mir-99a, mmu-mir-126a, mmu-mir-132, mmu-mir-141, mmu-mir-181a-2, mmu-mir-185, mmu-mir-193a, mmu-mir-199a-1, mmu-mir-200b, mmu-mir-34c, mmu-let-7d, mmu-mir-196a-1, mmu-mir-196a-2, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-20a, mmu-mir-22, mmu-mir-23a, mmu-mir-26a-1, mmu-mir-26b, mmu-mir-34a, mmu-mir-200c, mmu-mir-212, mmu-mir-181a-1, mmu-mir-26a-2, mmu-mir-29b-2, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-378a, mmu-mir-451a, mmu-mir-674, mmu-mir-423, mmu-mir-146b, bta-mir-26a-2, bta-let-7f-2, bta-mir-16b, bta-mir-20a, bta-mir-26b, bta-mir-99a, bta-mir-126, bta-mir-181a-2, bta-mir-199a-1, bta-mir-30b, bta-mir-193a, bta-let-7d, bta-mir-132, bta-mir-199b, bta-mir-200a, bta-mir-200c, bta-mir-22, bta-mir-23a, bta-mir-29b-2, bta-mir-423, bta-let-7g, bta-mir-200b, bta-let-7a-1, bta-let-7f-1, bta-mir-23b, bta-mir-34c, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-34a, bta-mir-141, bta-mir-146b, bta-mir-16a, bta-mir-185, bta-mir-196a-2, bta-mir-196a-1, bta-mir-199a-2, bta-mir-212, bta-mir-26a-1, bta-mir-29b-1, bta-mir-181a-1, bta-mir-2284i, bta-mir-2284s, bta-mir-2284l, bta-mir-2284j, bta-mir-2284t, bta-mir-2284d, bta-mir-2284n, bta-mir-2284g, bta-mir-2284p, bta-mir-2284u, bta-mir-2284f, bta-mir-2284a, bta-mir-2284k, bta-mir-2284c, bta-mir-2284v, bta-mir-2284q, bta-mir-2284m, bta-mir-2284b, bta-mir-2284r, bta-mir-2284h, bta-mir-2284o, bta-mir-2284e, bta-mir-2284w, bta-mir-2284x, bta-mir-2284y-1, mmu-let-7j, bta-mir-2284y-2, bta-mir-2284y-3, bta-mir-2284y-4, bta-mir-2284y-5, bta-mir-2284y-6, bta-mir-2284y-7, bta-mir-2284z-1, bta-mir-2284aa-1, bta-mir-2284z-3, bta-mir-2284aa-2, bta-mir-2284aa-3, bta-mir-2284z-4, bta-mir-2284z-5, bta-mir-2284z-6, bta-mir-2284z-7, bta-mir-2284aa-4, bta-mir-2285t, bta-mir-2284z-2, mmu-let-7k, mmu-mir-126b, bta-mir-2284ab, bta-mir-2284ac
For example, six are members of the let-7 gene family known to be ubiquitously expressed and involved in regulating cell proliferation and differentiation (reviewed in [57]). [score:4]
[1 to 20 of 1 sentences]
34
[+] score: 3
Other miRNAs from this paper: bta-let-7f-2, bta-mir-21, bta-mir-221, bta-mir-222, bta-mir-26b, bta-mir-125a, bta-mir-125b-1, bta-mir-128-1, bta-mir-181a-2, bta-mir-27b, bta-mir-30b, bta-mir-140, bta-mir-15b, bta-mir-92a-2, bta-let-7d, bta-let-7g, bta-mir-30a, bta-let-7a-1, bta-let-7f-1, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-125b-2, bta-mir-374a, bta-mir-128-2, bta-mir-146b, bta-mir-152, bta-mir-155, bta-mir-181d, bta-mir-24-1, bta-mir-223, bta-mir-374b, bta-mir-500, bta-mir-708, bta-mir-92a-1, bta-mir-9-1, bta-mir-9-2, bta-mir-1249, bta-mir-181a-1, bta-mir-2285a, bta-mir-2285d, bta-mir-2285b-1, bta-mir-2285c, bta-mir-2478, bta-mir-2898, bta-mir-2285e-1, bta-mir-2285e-2, bta-mir-2285f-1, bta-mir-2285f-2, bta-mir-2285g-1, bta-mir-2285h, bta-mir-2285i, bta-mir-2285j-1, bta-mir-2285j-2, bta-mir-2285k-1, bta-mir-2285l, bta-mir-2285o-1, bta-mir-2285o-2, bta-mir-2285n-1, bta-mir-2285n-2, bta-mir-2285p, bta-mir-2285m-1, bta-mir-2285m-2, bta-mir-2285n-3, bta-mir-2285n-4, bta-mir-2285o-3, bta-mir-2285o-4, bta-mir-2285m-3, bta-mir-2285m-4, bta-mir-2285o-5, bta-mir-2285m-5, bta-mir-2285n-5, bta-mir-2285n-6, bta-mir-2285n-7, bta-mir-2285k-2, bta-mir-2285k-3, bta-mir-2285k-4, bta-mir-2285k-5, bta-mir-2285q, bta-mir-2285r, bta-mir-2285s, bta-mir-2285t, bta-mir-2285b-2, bta-mir-2285v, bta-mir-2285g-2, bta-mir-2285g-3, bta-mir-2285af-1, bta-mir-2285af-2, bta-mir-2285y, bta-mir-2285w, bta-mir-2285x, bta-mir-2285z, bta-mir-2285u, bta-mir-2285aa, bta-mir-2285ab, bta-mir-2285ac, bta-mir-2285ad, bta-mir-2285ae, bta-mir-2285ag, bta-mir-2285ah, bta-mir-2285ai, bta-mir-2285aj, bta-mir-2285ak, bta-mir-2285al, bta-mir-2285am, bta-mir-2285ar, bta-mir-2285as-1, bta-mir-2285as-2, bta-mir-2285as-3, bta-mir-2285at-1, bta-mir-2285at-2, bta-mir-2285at-3, bta-mir-2285at-4, bta-mir-2285au, bta-mir-2285av, bta-mir-2285aw, bta-mir-2285ax-1, bta-mir-2285ax-2, bta-mir-2285ax-3, bta-mir-2285ay, bta-mir-2285az, bta-mir-2285an, bta-mir-2285ao-1, bta-mir-2285ao-2, bta-mir-2285ap, bta-mir-2285ao-3, bta-mir-2285aq-1, bta-mir-2285aq-2, bta-mir-2285ba-1, bta-mir-2285ba-2, bta-mir-2285bb, bta-mir-2285bc, bta-mir-2285bd, bta-mir-2285be, bta-mir-2285bf-1, bta-mir-2285bf-2, bta-mir-2285bf-3, bta-mir-2285bg, bta-mir-2285bh, bta-mir-2285bi-1, bta-mir-2285bi-2, bta-mir-2285bj-1, bta-mir-2285bj-2, bta-mir-2285bk, bta-mir-2285bl, bta-mir-2285bm, bta-mir-2285bn, bta-mir-2285bo, bta-mir-2285bp, bta-mir-2285bq, bta-mir-2285br, bta-mir-2285bs, bta-mir-2285bt, bta-mir-2285bu-1, bta-mir-2285bu-2, bta-mir-2285bv, bta-mir-2285bw, bta-mir-2285bx, bta-mir-2285by, bta-mir-2285bz, bta-mir-2285ca, bta-mir-2285cb, bta-mir-2285cc, bta-mir-2285cd, bta-mir-2285ce, bta-mir-2285cf, bta-mir-2285cg, bta-mir-2285ch, bta-mir-2285ci, bta-mir-2285cj, bta-mir-2285ck, bta-mir-2285cl, bta-mir-2285cm, bta-mir-2285cn, bta-mir-2285co, bta-mir-2285cp, bta-mir-2285cq, bta-mir-2285cr-1, bta-mir-2285cr-2, bta-mir-2285cs, bta-mir-2285ct, bta-mir-2285cu, bta-mir-2285cv-1, bta-mir-2285cv-2, bta-mir-2285cw-1, bta-mir-2285cw-2, bta-mir-2285cx, bta-mir-2285cy, bta-mir-2285cz, bta-mir-2285da, bta-mir-2285db, bta-mir-2285dc, bta-mir-2285dd, bta-mir-2285de, bta-mir-2285df, bta-mir-2285dg, bta-mir-2285dh, bta-mir-2285di, bta-mir-2285dj, bta-mir-2285dk, bta-mir-2285dl-1, bta-mir-2285dl-2, bta-mir-2285dm
The highest expressed miRNA was bta-miR-21-5p, while four of the most abundant miRNAs belong to the bta-let-7 family (i. e., bta-let-7f, bta-let-7a-5p, bta-let-7 g and bta-let-7i). [score:3]
[1 to 20 of 1 sentences]
35
[+] score: 3
As reflected by the total counts of miRNA-derived sequence reads, known miRNAs had a very broad range of expression which varied from thousands sequence reads for the most abundant miRNAs such as ubiquitous let-7 miRNA family, bta-mir-21, and bta-mir-140 to zero for the approximately one quarter of known cow miRNAs that have not been detected in our small RNA libraries (Supplemental Table S1). [score:3]
[1 to 20 of 1 sentences]
36
[+] score: 3
Disease specific enrichment of circulating let-7 family microRNA in MuSK+ myasthenia gravis. [score:3]
[1 to 20 of 1 sentences]
37
[+] score: 3
Finally, several members of the let-7 family known to be expressed in the human placenta [36] were present across multiple genomic clusters (Table 5). [score:3]
[1 to 20 of 1 sentences]
38
[+] score: 3
For example, p53 is targeted by the let-7 family of miRNAs, and p53 is wi dely known to be involved in cell-cycle checkpoints [36] and to be present in the early bovine embryo [37]. [score:3]
[1 to 20 of 1 sentences]
39
[+] score: 2
Among these eight miRNAs, the levels of two miRNAs (bta-let-7i and bta-miR-24-3p) changed during the course of pregnancy from days-7 to 21 in the C-LTP group only, as shown in the graphics below (Fig.   2C). [score:1]
We detected that eight exosomal-miRNAs (bta-let-7i, bta-miR-140, bta-miR-193a-5p, bta-miR-222, bta-miR-23a, bta-miR-24-3p, bta-miR-423-5p and bta-miR-658) were with different abundance levels among the cows at embryo transfer. [score:1]
[1 to 20 of 2 sentences]
40
[+] score: 2
These results are similar to a recent report [40] that mentioned miRNA regulations in mammalian host cells challenged with various microbial pathogens, such as let-7 were significant decreased in patients with H. pylori infection. [score:2]
[1 to 20 of 1 sentences]
41
[+] score: 2
Additionally, Vitamin D3, a steroidogenic regulator, the micro RNA let-7, and the oncogene RB1, were all also predicted to be activated in atretic thecal tissue. [score:2]
[1 to 20 of 1 sentences]
42
[+] score: 2
In addition, the combination of let-7d, let-7g, and let-7i was recently reported as a normalizer of human serum miRNAs [16]. [score:1]
The combination of miR-16 and miR-93 is an adequate reference in human gastric cancer samples [5], and a combination of let-7d, let-7g, and let-7i in human serum is superior to the other single reference genes commonly used for normalization [16]. [score:1]
[1 to 20 of 2 sentences]
43
[+] score: 2
The discovery of the regulatory miRNA let-7 in C. elegans in 2000 [10], with homologs in other species including humans, caused researchers to reconsider the idea that miRNAs may have a more widespread function within cells. [score:2]
[1 to 20 of 1 sentences]
44
[+] score: 2
One of the sequences, let-7, is also found in our datasets but we do not confidently assign this to nematode origin given its conservation in the mammalian host. [score:1]
Of note, miR-92 and let-7 were detected in some of the libraries however the mature miRNAs are perfectly conserved between nematodes and mammals. [score:1]
[1 to 20 of 2 sentences]
45
[+] score: 2
For example, miR-199a, miR-145, miR-125b and let-7 clusters were found to be the most differentially regulated miRNAs in human ovarian cancer [74, 75]. [score:2]
[1 to 20 of 1 sentences]
46
[+] score: 2
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-32, hsa-mir-33a, hsa-mir-99a, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, mmu-let-7g, mmu-let-7i, mmu-mir-15b, mmu-mir-99a, mmu-mir-126a, mmu-mir-128-1, mmu-mir-130a, mmu-mir-140, mmu-mir-154, mmu-mir-204, mmu-mir-143, hsa-mir-204, hsa-mir-211, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-222, hsa-mir-223, mmu-mir-301a, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-128-1, hsa-mir-130a, hsa-mir-140, hsa-mir-143, hsa-mir-126, hsa-mir-129-2, hsa-mir-154, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-26a-1, mmu-mir-26b, mmu-mir-29a, mmu-mir-29c, mmu-mir-27a, mmu-mir-129-2, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-340, mmu-mir-107, mmu-mir-32, mmu-mir-218-1, mmu-mir-218-2, mmu-mir-223, mmu-mir-26a-2, mmu-mir-211, mmu-mir-222, mmu-mir-128-2, hsa-mir-128-2, hsa-mir-29c, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-26a-2, hsa-mir-379, mmu-mir-379, hsa-mir-340, mmu-mir-409, hsa-mir-409, hsa-mir-499a, hsa-mir-455, hsa-mir-670, mmu-mir-1249, mmu-mir-670, mmu-mir-499, mmu-mir-455, bta-mir-26a-2, bta-mir-29a, bta-let-7f-2, bta-mir-101-2, bta-mir-103-1, bta-mir-16b, bta-mir-222, bta-mir-26b, bta-mir-27a, bta-mir-499, bta-mir-99a, bta-mir-126, bta-mir-128-1, bta-mir-34b, bta-mir-107, bta-mir-140, bta-mir-15b, bta-mir-218-2, bta-let-7d, bta-mir-29c, bta-mir-455, bta-let-7g, bta-let-7a-1, bta-let-7f-1, bta-mir-34c, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-204, hsa-mir-1249, hsa-mir-1306, hsa-mir-103b-1, hsa-mir-103b-2, bta-mir-128-2, bta-mir-129-2, bta-mir-130a, bta-mir-143, bta-mir-154a, bta-mir-211, bta-mir-218-1, bta-mir-223, bta-mir-26a-1, bta-mir-301a, bta-mir-32, bta-mir-33a, bta-mir-340, bta-mir-379, bta-mir-409a, bta-mir-670, mmu-mir-1306, bta-mir-1306, bta-mir-1249, bta-mir-2284i, bta-mir-2285a, bta-mir-2284s, bta-mir-2285d, bta-mir-2284l, bta-mir-2284j, bta-mir-2284t, bta-mir-2285b-1, bta-mir-2284d, bta-mir-2284n, bta-mir-2284g, bta-mir-2284p, bta-mir-2284u, bta-mir-2284f, bta-mir-2284a, bta-mir-2284k, bta-mir-2284c, bta-mir-2284v, bta-mir-2285c, bta-mir-2284q, bta-mir-2284m, bta-mir-2284b, bta-mir-2284r, bta-mir-2284h, bta-mir-2284o, bta-mir-2284e, hsa-mir-1260b, bta-mir-2284w, bta-mir-2284x, bta-mir-409b, hsa-mir-499b, bta-mir-1260b, bta-mir-2284y-1, bta-mir-2285e-1, bta-mir-2285e-2, bta-mir-2285f-1, bta-mir-2285f-2, bta-mir-2285g-1, bta-mir-2285h, bta-mir-2285i, bta-mir-2285j-1, bta-mir-2285j-2, bta-mir-2285k-1, bta-mir-2285l, bta-mir-6119, mmu-let-7j, bta-mir-2285o-1, bta-mir-2285o-2, bta-mir-2285n-1, bta-mir-2285n-2, bta-mir-2285p, bta-mir-2285m-1, bta-mir-2285m-2, bta-mir-2284y-2, bta-mir-2285n-3, bta-mir-2285n-4, bta-mir-2284y-3, bta-mir-154c, bta-mir-154b, bta-mir-2285o-3, bta-mir-2285o-4, bta-mir-2285m-3, bta-mir-2284y-4, bta-mir-2284y-5, bta-mir-2284y-6, bta-mir-2285m-4, bta-mir-2285o-5, bta-mir-2285m-5, bta-mir-2285n-5, bta-mir-2285n-6, bta-mir-2284y-7, bta-mir-2285n-7, bta-mir-2284z-1, bta-mir-2284aa-1, bta-mir-2285k-2, bta-mir-2284z-3, bta-mir-2284aa-2, bta-mir-2284aa-3, bta-mir-2285k-3, bta-mir-2285k-4, bta-mir-2284z-4, bta-mir-2285k-5, bta-mir-2284z-5, bta-mir-2284z-6, bta-mir-2284z-7, bta-mir-2284aa-4, bta-mir-2285q, bta-mir-2285r, bta-mir-2285s, bta-mir-2285t, bta-mir-2285b-2, bta-mir-2285v, bta-mir-2284z-2, mmu-let-7k, mmu-mir-126b, bta-mir-2285g-2, bta-mir-2285g-3, bta-mir-2285af-1, bta-mir-2285af-2, bta-mir-2285y, bta-mir-2285w, bta-mir-2285x, bta-mir-2285z, bta-mir-2285u, bta-mir-2285aa, bta-mir-2285ab, bta-mir-2284ab, bta-mir-2285ac, bta-mir-2285ad, bta-mir-2284ac, bta-mir-2285ae, chi-let-7a, chi-let-7b, chi-let-7c, chi-let-7d, chi-let-7e, chi-let-7f, chi-let-7g, chi-let-7i, chi-mir-103, chi-mir-107, chi-mir-1249, chi-mir-126, chi-mir-1306, chi-mir-130a, chi-mir-140, chi-mir-143, chi-mir-154a, chi-mir-154b, chi-mir-15b, chi-mir-16b, chi-mir-204, chi-mir-211, chi-mir-222, chi-mir-223, chi-mir-2284a, chi-mir-2284b, chi-mir-2284c, chi-mir-2284d, chi-mir-2284e, chi-mir-26a, chi-mir-26b, chi-mir-27a, chi-mir-29a, chi-mir-29c, chi-mir-301a, chi-mir-33a, chi-mir-340, chi-mir-34b, chi-mir-34c, chi-mir-379, chi-mir-409, chi-mir-455, chi-mir-499, chi-mir-99a, bta-mir-2285ag, bta-mir-2285ah, bta-mir-2285ai, bta-mir-2285aj, bta-mir-2285ak, bta-mir-2285al, bta-mir-2285am, bta-mir-2285ar, bta-mir-2285as-1, bta-mir-2285as-2, bta-mir-2285as-3, bta-mir-2285at-1, bta-mir-2285at-2, bta-mir-2285at-3, bta-mir-2285at-4, bta-mir-2285au, bta-mir-2285av, bta-mir-2285aw, bta-mir-2285ax-1, bta-mir-2285ax-2, bta-mir-2285ax-3, bta-mir-2285ay, bta-mir-2285az, bta-mir-2285an, bta-mir-2285ao-1, bta-mir-2285ao-2, bta-mir-2285ap, bta-mir-2285ao-3, bta-mir-2285aq-1, bta-mir-2285aq-2, bta-mir-2285ba-1, bta-mir-2285ba-2, bta-mir-2285bb, bta-mir-2285bc, bta-mir-2285bd, bta-mir-2285be, bta-mir-2285bf-1, bta-mir-2285bf-2, bta-mir-2285bf-3, bta-mir-2285bg, bta-mir-2285bh, bta-mir-2285bi-1, bta-mir-2285bi-2, bta-mir-2285bj-1, bta-mir-2285bj-2, bta-mir-2285bk, bta-mir-2285bl, bta-mir-2285bm, bta-mir-2285bn, bta-mir-2285bo, bta-mir-2285bp, bta-mir-2285bq, bta-mir-2285br, bta-mir-2285bs, bta-mir-2285bt, bta-mir-2285bu-1, bta-mir-2285bu-2, bta-mir-2285bv, bta-mir-2285bw, bta-mir-2285bx, bta-mir-2285by, bta-mir-2285bz, bta-mir-2285ca, bta-mir-2285cb, bta-mir-2285cc, bta-mir-2285cd, bta-mir-2285ce, bta-mir-2285cf, bta-mir-2285cg, bta-mir-2285ch, bta-mir-2285ci, bta-mir-2285cj, bta-mir-2285ck, bta-mir-2285cl, bta-mir-2285cm, bta-mir-2285cn, bta-mir-2285co, bta-mir-2285cp, bta-mir-2285cq, bta-mir-2285cr-1, bta-mir-2285cr-2, bta-mir-2285cs, bta-mir-2285ct, bta-mir-2285cu, bta-mir-2285cv-1, bta-mir-2285cv-2, bta-mir-2285cw-1, bta-mir-2285cw-2, bta-mir-2285cx, bta-mir-2285cy, bta-mir-2285cz, bta-mir-2285da, bta-mir-2285db, bta-mir-2285dc, bta-mir-2285dd, bta-mir-2285de, bta-mir-2285df, bta-mir-2285dg, bta-mir-2285dh, bta-mir-2285di, bta-mir-2285dj, bta-mir-2285dk, bta-mir-2285dl-1, bta-mir-2285dl-2, bta-mir-2285dm
Among these, 16 precursors were found amongst the 43 conserved between human, mouse, cow and goat in our analysis (let-7 g, mir-101-2, mir-103, mir-107, mir-128-1, mir-1306, mir-140, mir-15b, mir-16b, mir-211, mir-218-1, mir-26a-1, mir-32, mir-33a, mir-455, let-7-2), so the location of these precursors appears to be highly conserved in all vertebrates. [score:1]
In the present case, several members of the same family (such as the let-7 family) were identified as being clustered, as well as the largest miRNA gene cluster localized on CHI 21 which contained 16 members of the mir-154 family. [score:1]
[1 to 20 of 2 sentences]
47
[+] score: 2
ESCC miRNAs have been shown to maintain ESC self-renewal in the presence of differentiation-inducing miRNAs (let-7 family) (24). [score:1]
They are reportedly able to oppose differentiation-affiliated miRNAs (let-7 family) in ESCs. [score:1]
[1 to 20 of 2 sentences]
48
[+] score: 2
The Let-7 family of miRNA has been implicated in the regulation of the inflammatory reponse, through mediation of IL-6 and IL-10 cytokines [43] and bta-let-7c is significantly elevated in CE cows at 7 DPP in this study. [score:2]
[1 to 20 of 1 sentences]
49
[+] score: 2
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-27a, hsa-mir-31, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-101-1, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-16-2, hsa-mir-192, hsa-mir-199a-1, hsa-mir-30c-2, hsa-mir-199a-2, hsa-mir-223, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-125b-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-140, hsa-mir-141, hsa-mir-152, hsa-mir-191, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-149, hsa-mir-150, hsa-mir-320a, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-101-2, hsa-mir-99b, hsa-mir-26a-2, hsa-mir-379, hsa-mir-423, hsa-mir-451a, hsa-mir-486-1, hsa-mir-496, hsa-mir-520a, hsa-mir-525, hsa-mir-518b, hsa-mir-516b-2, hsa-mir-516b-1, hsa-mir-516a-1, hsa-mir-516a-2, hsa-mir-92b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, bta-mir-26a-2, bta-let-7f-2, bta-mir-101-2, bta-mir-103-1, bta-mir-16b, bta-mir-20a, bta-mir-21, bta-mir-27a, bta-mir-320a-2, bta-mir-125a, bta-mir-125b-1, bta-mir-199a-1, bta-mir-31, bta-mir-140, bta-mir-92a-2, bta-let-7d, bta-mir-132, bta-mir-191, bta-mir-192, bta-mir-22, bta-mir-23a, bta-mir-29c, bta-mir-423, bta-let-7g, bta-mir-24-2, bta-let-7a-1, bta-mir-150, bta-let-7f-1, bta-mir-30c, bta-mir-23b, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-125b-2, bta-mir-99b, hsa-mir-1249, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, bta-mir-101-1, bta-mir-133a-2, bta-mir-133a-1, bta-mir-141, bta-mir-152, bta-mir-16a, bta-mir-24-1, bta-mir-199a-2, bta-mir-223, bta-mir-26a-1, bta-mir-379, bta-mir-451, bta-mir-486, bta-mir-496, bta-mir-92a-1, bta-mir-92b, bta-mir-1249, bta-mir-320b, bta-mir-320a-1, hsa-mir-320e, hsa-mir-23c, hsa-mir-451b, bta-mir-149, hsa-mir-486-2
Finally, let-7 and miR-125b among other miRNAs have been shown to control mammary gland development and lactation [14]. [score:2]
[1 to 20 of 1 sentences]
50
[+] score: 1
Other miRNAs from this paper: ssc-mir-122, ssc-mir-135-1, ssc-mir-135-2, ssc-mir-148a, ssc-mir-19a, ssc-mir-20a, ssc-mir-224, ssc-mir-24-1, ssc-mir-323, ssc-mir-140, ssc-mir-183, ssc-mir-214, ssc-mir-27a, ssc-mir-325, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-103-1, ssc-mir-107, ssc-mir-136, ssc-mir-153, ssc-mir-18a, ssc-mir-186, ssc-mir-196a-2, ssc-mir-204, ssc-mir-21, bta-mir-18b, bta-let-7f-2, bta-mir-101-2, bta-mir-103-1, bta-mir-148a, bta-mir-18a, bta-mir-20a, bta-mir-21, bta-mir-221, bta-mir-27a, bta-mir-27b, bta-mir-107, bta-mir-140, bta-mir-20b, bta-mir-215, bta-let-7d, bta-mir-17, bta-mir-186, bta-mir-199b, bta-mir-210, bta-mir-214, bta-mir-450a-2, bta-let-7g, bta-mir-24-2, bta-let-7a-1, bta-let-7f-1, bta-mir-122, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-15a, bta-mir-19a, bta-mir-204, ssc-mir-15a, ssc-mir-17, ssc-mir-199b, ssc-mir-210, ssc-mir-221, bta-mir-101-1, bta-mir-133a-2, bta-mir-133a-1, bta-mir-135a-2, bta-mir-135a-1, bta-mir-135b, bta-mir-136, bta-mir-146b, bta-mir-153-1, bta-mir-153-2, bta-mir-183, bta-mir-24-1, bta-mir-196a-2, bta-mir-196a-1, bta-mir-196b, bta-mir-224, bta-mir-323, ssc-mir-101-1, ssc-mir-101-2, ssc-mir-133a-1, ssc-mir-450a, ssc-mir-146b, ssc-mir-215, bta-mir-1343, bta-mir-2320, bta-mir-2326, bta-mir-2366, bta-mir-2411, bta-mir-2483, bta-mir-450a-1, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-103-2, ssc-mir-27b, ssc-mir-24-2, ssc-mir-196b-1, ssc-mir-450b, ssc-mir-450c, ssc-mir-133a-2, ssc-let-7a-2, ssc-mir-18b, ssc-mir-1343, ssc-mir-2320, bta-mir-450b, ssc-let-7d, ssc-let-7f-2, ssc-mir-20b-1, ssc-mir-20b-2, ssc-mir-196a-1, ssc-mir-196b-2, ssc-mir-2366-1, ssc-mir-2366-2, ssc-mir-2411, ssc-mir-2483
Several miRNAs such as let-7, miR-27 and miR-103 are reported to perform very important functions in adipogenesis [33]– [35]. [score:1]
[1 to 20 of 1 sentences]
51
[+] score: 1
MiR-122 was the most abundant miRNA in the FBS, followed by miR-1246, miR-423-5p, miR-148a-3p, and let-7 family (Fig. 1f). [score:1]
[1 to 20 of 1 sentences]
52
[+] score: 1
In total, 22 miRNAs (bta-miR-21-5p, -miR-143, -miR-10b, -let-7i, -miR-202, -miR-148a, -let-7f, -miR-3600, -miR-99a55p, -let-7a-5p, -miR-27b, -miT-100, -let7g, -miR-26a, -miR-378, -miR-30d, -miR-125b, -450a, -miR-30e-5p, -let-7b, -miR-199a-3p, and -miR-26c) contributed to the top twenty most abundantly sequenced miRNAs in the bovine CL. [score:1]
[1 to 20 of 1 sentences]
53
[+] score: 1
Let-7b is a member of the Let-7 family of miRNAs shown to affect cell cycle molecules [39]. [score:1]
[1 to 20 of 1 sentences]