sort by

9 publications mentioning mmu-mir-582

Open access articles that are associated with the species Mus musculus and mention the gene name mir-582. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 51
Our findings indicate that (i) loss of Nrf2 in the heart results in a modest downregulation of transcripts involved in mitochondrial function, redox homeostasis, metabolism, cardiac pathology, and protein folding, (ii) 27 miRNAs (11 up and 16 downregulated) are significantly altered and differentially regulated in the Nrf2 depleted myocardium, (iii) Nrf2 may either directly or indirectly regulate a sub-set of cardiac miRNAs, and (iv) miR-582-5p, miR-208a-5p, miR-350-3p and miR-30b-5p are likely to contribute to basally downregulated genes in Nrf2 [−/−] hearts. [score:14]
A total of 39 downregulated DEGs contained potential miRNA recognition elements for the following upregulated miRNAs; miR-30b-5p, miR-350-3p, miR-582-5p, and miR-208a-5p. [score:7]
Importantly, miR-30b expression in cardiomyocytes contributes to survival and protection against oxidative stress induced mitochondrial fission [51], and miR-582-5p was recently shown to inhibit monocyte apoptosis [52]. [score:5]
In silico target prediction for increased miRNAs suggested that many mRNAs altered in knockout mice may be concurrently regulated by miR-582-5p, miR-208a-5p, miR-350-3p, and miR-30b-5p. [score:5]
Recently, miR-582-5p was shown to inhibit monocyte apoptosis by targeting Foxo1 [52], a transcription factor that induces pro-apoptotic signaling in the heart conferring nitrosative and endoplasmic reticulum stress [66]. [score:5]
High throughput data were integrated using prediction algorithms, and these in silico analyses discovered potential recognition elements within 39 repressed mRNAs which matched the seed sequence for 4 upregulated miRNAs; miR-30b-5p, miR-208a-5p, miR-350-3p, and miR-582-5p. [score:4]
In addition to these pro-hypertrophic miRNAs, miR-30b-5p and miR-582-5p expression was increased in the hearts of Nrf2 knockout mice (Fig. 5a). [score:4]
Using this approach, we discovered 39 transcripts potentially targeted by miR-30b-5p, miR-350-3p, miR-582-5p, and miR-208a-5p. [score:3]
In addition to these pro-hypertrophic miRNAs, miR-582-5p and miR-30b-5p levels were increased in the hearts of Nrf2 [−/−] mice. [score:1]
Therefore, the 4-fold (p < 0.01) and 3-fold (p < 0.05) induction of miR-582-5p and miR-30b-5p (Fig. 5d) may also serve important homeostatic roles contributing to the maintenance of basal cardiac function in Nrf2 [−/−] mice. [score:1]
Expression changes were validated for 12 miRNAs using specific primer assays in real-time and revealed a significant decrease in miR-10b-5p, miR-674-3p, miR-3535, and miR-378c while miR-30b-5p, miR-208a-5p, miR-350-3p, and miR-582-5p, and miR-1249-3p levels were increased. [score:1]
Therefore, the robust co-induction of miR-582-5p and miR-30b-5p in Nrf2 [−/−] mice could serve to maintain cardiomyocyte viability. [score:1]
[1 to 20 of 12 sentences]
2
[+] score: 50
Other miRNAs from this paper: mmu-mir-15b, mmu-mir-144, mmu-mir-879
[78] Our study shows that chronic stress via corticosterone upregulates the levels of miRNA-15b-5p, miRNA-144-3p, miRNA-582-5p and miRNA-879-5p as well as downregulates the expression of GAD-67, VGAT and GAT-3 genes and proteins, which impair presynaptic GABA release and uptake. [score:9]
Taken together, our data suggest that GTA-3 is directly targeted by miR-15b-5p and miRNA-879-5p, VGAT is targeted by miRNA-144-3p and miRNA-582-5p, as well as GAD1 is targeted by miRNA-144-3p. [score:8]
Thus, CUMS -induced depression is likely caused by a chain reaction of the stress, the upregulated miRNA-15b-5p, miRNA-144-3p, miRNA-582-5p and miRNA-879-5p, the downregulated mRNAs that encode GAD-67, VGAT and GAT-3 as well as the impaired GABA uptake and synthesis (Figure 6). [score:7]
These results suggest that CUMS -induced depression may be caused by the following molecular cascades, the upregulation of miRNA-15b-5p, miRNA-144-3p, miRNA-582-5p and miRNA-879-5p, the downregulation of mRNAs that encode GAD-67, VGAT and GAT-3 as well as the impairment of GABA synthesis, reuptake and release. [score:7]
In addition, miRNA-15b-5p, miRNA-144-3p, miRNA-582-5p and miRNA-879-5p, which downregulate mRNAs of GAD1, VGAT and GAT-3, respectively, are upregulated (Figures 4 and 5). [score:7]
GAD1, GAT-3 and VGAT are the direct targets of miRNA-15b-5p, miRNA-144-3p, miRNA-582-5p and miRNA-879-5p. [score:4]
It is noteworthy that the VGAT suppression disappears while miRNA-144-3p binding site, but not the miRNA-582-5p -binding site, is mutated, indicating the presence of other putative binding sites in 3′-UTR of VGAT. [score:3]
3′UTRs of VGAT (one area) are targeted by miRNA-582-5p. [score:3]
60, 61, 62, 63 In terms of the changes of miRNAs, we paid attention to analyzing miRNA-15b-5p, miRNA-144-3p, miRNA-582-5p and miRNA-879-5p with high-throughput sequencings and qRT-PCR. [score:1]
Moreover, the luciferase activity of wild-type reporter for VGAT 3′-UTR is significantly lowered by miRNA-144-3p (Figure 5d) or miRNA-582-5p (Figure 5e). [score:1]
[1 to 20 of 10 sentences]
3
[+] score: 26
Predicted target and pathway analysis concluded that miR-101a is targeting TGFBR1 and SMAD3, miR-425 is targeting TGFBR2 and FST, miR-582 is targeting SMAD1 and TGFB2, miR-148 is targeting ACVR1, and miR-199a is targeting AcvR1a gene in the TGF- β signaling pathway. [score:13]
Pathways analysis predicted that miR-101a is targeting TGFBR1 and SMAD3, miR-582 is targeting TGFB2, SMAD1, miR-425 is targeting TGFBR2 and FST, miR-199a is targeting ACVR2a, miR-148 is targeting ACVR1, and miR-103 is targeting BMP2 in TGF- β signaling pathway. [score:13]
[1 to 20 of 2 sentences]
4
[+] score: 21
Figure  4c displays target genes which expression is significantly suppressed by has-miR-582-5p. [score:7]
Of note, also miR582-5p was up-regulated by qRT-PCR (Fig.   5i). [score:4]
Also, the human MON2 gene encoding a protein which controls the traffic between endosomes and the Golgi apparatus [24] is suppressed by S100A8/A9 induced miR-582-5p. [score:3]
Only the hsa-miR-582 reached significant expression values as depicted in Fig.   4a,b. [score:3]
The primers targeted (a) CCR7, (b) IL-32, (c) ICOSLG, (d) PRSS36, (e) SERPINA9, (f) PI15, (g) MMP27, (h) SPOCK2, (i) DSC2, (j) hsa-miR-582-5p, to amplify cDNA using 2x power SYBR Green Mix (Applied Biosystems). [score:2]
Identification of miR-582-5p involved in the S100A8/A9 induced MSC fingerprint. [score:1]
Finally, the NFAT5 gene encoding the transcription factor NFAT5 is significantly reduced by the S100A8/A9 induced miR-582-5p. [score:1]
[1 to 20 of 7 sentences]
5
[+] score: 12
Through sequencing miRNAs for their quantifications, we show that some known miRNAs (miR-148b-5p, miR-879-5p, miR-144-3p, miR-540-5p, miR-582-5p, miR-15b-5p, miR-210-5p, miR-871-3p, miR-3103-5p, miR-16-1-3p, miR-470-5p, miR-190b-5p, miR-384-5p and miR-490-5p) are upregulated in CUMS -induced depression mice (Table 3), which degrade mRNAs listed in Table 1. In other words, the analysis from miRNA sequencing is consistent to the analysis from mRNA sequencing. [score:4]
In order to validate the finding by miRNA sequencing analysis, four upregulated miRNAs (mmu-miR-879-5p, mmu-miR-582-5p, mmu-miR-144-3p, mmu-miR-15b-5p) were selected for doing qRT-PCR. [score:4]
These upregulated miRNAs include certain known miRNAs (mmu-miR-148b-5p, mmu-miR-879-5p, mmu-miR-144-3p, mmu-miR-540-5p, mmu-miR-582-5p, mmu-miR-15b-5p, mmu-miR-210-5p, mmu-miR-871-3p, mmu-miR-3103-5p, mmu-miR-16-1-3p, mmu-miR-470-5p, mmu-miR-190b-5p, mmu-miR-384-5p and mmu-miR-490-5p), as well as some novel miRNAs (novel_mir_46, novel_mir_214 and novel_mir_213) with their stem loop structures by Miredp (S3 Fig). [score:4]
[1 to 20 of 3 sentences]
6
[+] score: 10
Thus, both miR-335 and miR-582 were down-regulated at 7 dpi; while miR-21 was up-regulated, miR-34b and miR-542 were down-regulated at 15 dpi. [score:10]
[1 to 20 of 1 sentences]
7
[+] score: 4
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-26b, hsa-mir-29a, hsa-mir-30a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, mmu-let-7g, mmu-let-7i, mmu-mir-15b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-130a, mmu-mir-138-2, mmu-mir-181a-2, mmu-mir-182, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-10a, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-181a-1, mmu-mir-297a-1, mmu-mir-297a-2, mmu-mir-301a, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, mmu-mir-106a, mmu-mir-106b, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-138-2, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-138-1, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-26b, mmu-mir-29a, mmu-mir-29c, mmu-mir-34a, rno-mir-301a, rno-let-7d, rno-mir-344a-1, mmu-mir-344-1, rno-mir-346, mmu-mir-346, rno-mir-352, hsa-mir-181b-2, mmu-mir-10a, mmu-mir-181a-1, mmu-mir-29b-2, mmu-mir-138-1, mmu-mir-181b-1, mmu-mir-181c, mmu-mir-125b-1, hsa-mir-106b, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-30e, hsa-mir-362, mmu-mir-362, hsa-mir-369, hsa-mir-374a, mmu-mir-181b-2, hsa-mir-346, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-10a, rno-mir-15b, rno-mir-26b, rno-mir-29b-2, rno-mir-29a, rno-mir-29b-1, rno-mir-29c-1, rno-mir-30c-1, rno-mir-30e, rno-mir-30b, rno-mir-30d, rno-mir-30a, rno-mir-30c-2, rno-mir-34b, rno-mir-34c, rno-mir-34a, rno-mir-106b, rno-mir-125a, rno-mir-125b-1, rno-mir-125b-2, rno-mir-130a, rno-mir-138-2, rno-mir-138-1, rno-mir-181c, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-181a-1, hsa-mir-449a, mmu-mir-449a, rno-mir-449a, mmu-mir-463, mmu-mir-466a, hsa-mir-483, hsa-mir-493, hsa-mir-181d, hsa-mir-499a, hsa-mir-504, mmu-mir-483, rno-mir-483, mmu-mir-369, rno-mir-493, rno-mir-369, rno-mir-374, hsa-mir-579, hsa-mir-582, hsa-mir-615, hsa-mir-652, hsa-mir-449b, rno-mir-499, hsa-mir-767, hsa-mir-449c, hsa-mir-762, mmu-mir-301b, mmu-mir-374b, mmu-mir-762, mmu-mir-344d-3, mmu-mir-344d-1, mmu-mir-673, mmu-mir-344d-2, mmu-mir-449c, mmu-mir-692-1, mmu-mir-692-2, mmu-mir-669b, mmu-mir-499, mmu-mir-652, mmu-mir-615, mmu-mir-804, mmu-mir-181d, mmu-mir-879, mmu-mir-297a-3, mmu-mir-297a-4, mmu-mir-344-2, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-493, mmu-mir-504, mmu-mir-466d, mmu-mir-449b, hsa-mir-374b, hsa-mir-301b, rno-mir-466b-1, rno-mir-466b-2, rno-mir-466c, rno-mir-879, rno-mir-181d, rno-mir-182, rno-mir-301b, rno-mir-463, rno-mir-673, rno-mir-652, mmu-mir-466l, mmu-mir-669k, mmu-mir-466i, mmu-mir-669i, mmu-mir-669h, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-466j, mmu-mir-1193, mmu-mir-767, rno-mir-362, rno-mir-504, rno-mir-582, rno-mir-615, mmu-mir-3080, mmu-mir-466m, mmu-mir-466o, mmu-mir-466c-2, mmu-mir-466b-4, mmu-mir-466b-5, mmu-mir-466b-6, mmu-mir-466b-7, mmu-mir-466p, mmu-mir-466n, mmu-mir-344e, mmu-mir-344b, mmu-mir-344c, mmu-mir-344g, mmu-mir-344f, mmu-mir-374c, mmu-mir-466b-8, hsa-mir-466, hsa-mir-1193, rno-mir-449c, rno-mir-344b-2, rno-mir-466d, rno-mir-344a-2, rno-mir-1193, rno-mir-344b-1, hsa-mir-374c, hsa-mir-499b, mmu-mir-466q, mmu-mir-344h-1, mmu-mir-344h-2, mmu-mir-344i, rno-mir-344i, rno-mir-344g, mmu-let-7j, mmu-mir-30f, mmu-let-7k, mmu-mir-692-3, rno-let-7g, rno-mir-15a, rno-mir-762, mmu-mir-466c-3, rno-mir-29c-2, rno-mir-29b-3, rno-mir-344b-3, rno-mir-466b-3, rno-mir-466b-4
Of these miRNAs, 12 were upregulated (miR-34b, miR-138, miR-297a, miR-301, miR-449, miR-466, miR-493, miR-579, miR-582, miR. [score:4]
[1 to 20 of 1 sentences]
8
[+] score: 3
001 Down 42 TGCATGACGGCCTGC Chrl2 MIMAT0001418 110828676 − 110828689  mmu-miR-466b-3p <0.001 Down 71 TCTTATGTGTGCGTGTA Chr2 MIMAT0004876 10395901 − 10395917 mmu-miR-467 a * <0.001 Down 169 TGTAGGTGTGTGTATGTATA Chr2 MIMAT0002108 10398019 − 10398038  mmu-miR-467b <0.001 Down 227 CATATACATGCAGGCACT Chr2 MIMAT0005448 10402887 − 10402903  mmu-miR-467e <0.001 Down 73 ACATATACATGCTCACACT Chr2 MIMAT0005293 10427362 − 10427379  mmu-miR- 5103 <0.001 Down 59 CCTCAGGGGATCCC Chr1 MIMAT0020610 34490035 + 34490023  mmu-miR- 5117 <0.001 Up 204 TAACTTTATTGATCATCACTAAC Chr1 MIMAT0020625 162967492 − 162967513  mmu-miR-582-5p <0.001 Down 69 AGTAACTGGTTGAACAACTGTA Chrl3 MIMAT0005291 110114949 − 110114969  mmu-miR-711 <0.001 Down 44 CTTACATCTCTCCCCG Chr9 MIMAT0003501 108872022 − 108872036 mmu-miR-99a * <0.001 Down 40 AGACCCATAGAAACGAGC Chrl6 MIMAT0016981 77599226 − 77599242Differentially expressed miRNAs (P < 0.05) between high- (C57L/J) and low-active (C3H/HeJ) mice strains in nucleus accumbens, EDL, and soleus. [score:3]
[1 to 20 of 1 sentences]
9
[+] score: 3
Therapeutic effects of microRNA-582-5p and-3p on the inhibition of bladder cancer progression. [score:3]
[1 to 20 of 1 sentences]