sort by

12 publications mentioning hsa-mir-1238

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-1238. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 234
We found that miR-1238 level was down-regulated in 62.0% (31/50) of NSCLC tissues, 24 of which (77.4%) showed up-regulated expression of LHX2 mRNA. [score:9]
In deed, Haj-Ahmad et al. also found that miR-1238 was over-expressed in 38% of the initial prostate cancer samples, and suspected that miR-1238 may target SASH1 (SAM & SH3 domain containing protein 1) [26] which was down-regulated in breast cancer [28]. [score:8]
Mechanistically, miR-1238 inhibits LHX2 expression by directly targeting LHX2 3′-UTR, and thereby represses NSCLC cell proliferation. [score:8]
Secondly, overexpression of miR-1238 in NSCLC cells significantly inhibited LHX2 mRNA and protein expression. [score:7]
In conclusion, this is the first report that miR-1238 is down-regulated in NSCLC, which is reversely correlated with the expression of LHX2. [score:6]
Of 31 NSCLC tissues with low miR-1238 level, 24 tumors (77.4%) showed high expression of LHX2 mRNA (Figure 2D), suggesting a regulatory role of miR-1238 in LHX2 expression in NSCLCs. [score:6]
Considering our findings described above and the facts that miR-1238 was down-regulated in HNPCC and pancreatic cancer cells [17, 19], we hypothesized that miR-1238 may serve as a tumor suppressor in NSCLC. [score:6]
miR-1238 reduces LHX2 expression by directly targeting LHX2 3′-UTR. [score:6]
miR-1238 overexpression inhibits NSCLC cell proliferation and knockdown of LHX2 represses NSCLC cell proliferation. [score:6]
Given the facts that miR-1238 is frequently down-regulated not only in human cancer tissues [17- 18], but also in human epithelia-derived cancer cells [19, 26] and our data that LHX2 is required for NSCLC cell proliferation (Figure 5), leading us consider the possibility that miR-1238 may inhibit NSCLC cell proliferation. [score:6]
Figure 3miR-1238 reduces LHX2 expression by directly targeting LHX2 3′-UTR A. Schematic graph showing the subcloning of the predicted miR-1238 binding sites (positions 176-182 and 244-251) of LHX2 3′-UTR into psiCHECK-2 luciferase construct. [score:6]
In the present study, for the first time, we examined the relationship between miR-1238 and LHX2 expression, and explored the mechanistic role of miR-1238 in regulating the expression of LHX2 in NSCLCs. [score:6]
Besides, using computational algorithms, we predicted that miR-1238 can directly target the 3′-untranslated region (3′-UTR) of LHX2. [score:6]
Of note, 77.4% of NSCLC tissues with low expression of miR-1238 displayed high expression of LHX2 mRNA. [score:5]
Figure 2Level of miR-1238 is reduced in NSCLC cells and tissues and reversely correlated with LHX2 expression in human NSCLC tissues A. MiR-1238 levels expressed in HBE cells and NSCLC A549, LTEP-α-2, H460 and H1299 cells. [score:5]
Overexpression of miR-1238 mimic inhibits NSCLC cell viability and proliferation. [score:5]
Thus, we performed an in silico prediction of microRNA targets and identified that miR-1238 can potentially bind to two target sites of LHX2 3′-UTR. [score:5]
Moreover, cell -based and biochemical analyses revealed that miR-1238 diminished the expression of LHX2 by targeting LHX2 which is required for NSCLC cell proliferation. [score:5]
miR-1238 reduces LHX2 expression by targeting LHX2 3′-UTR in NSCLC cells. [score:5]
More recently, Balaguer et al. [17] and Lin et al. [18] reported that miR-1238 was down-regulated in tumor tissues from patients with hereditary nonpolyposis colorectal cancer (HNPCC) and cervical cancer, respectively. [score:4]
Taken together, the results suggested that miR-1238 can directly target the 3′-UTR of LHX2. [score:4]
Comparably, 7 or 14 mutational bases were introduced into the two predicted miR-1238 target sites to obtain three mutated fragments. [score:4]
This inspired us to focus on the functional contribution of miR-1238 to the upregulation of LHX2 in NSCLC. [score:4]
This mechanism might partially help us explain the reason for up-regulated miR-1238 in 38.0% of primary NSCLC, albeit further studies are warranted to validate the interaction of miR-1238 and SASH1. [score:4]
D. LHX2 mRNA expression in A549 and LTEP-α-2 cells transfected with miR-1238 mimics or NC. [score:3]
However, no evidence of miR-1238 expression was identified in NSCLC. [score:3]
MiR-1238 -mediated downregulation of LHX2 provides new insight into the therapy strategy for NSCLC. [score:3]
As illustrated in Figure 3B, miR-1238 significantly attenuated the luciferase activities in A549 and LTEP-α-2 cells transfected with the LHX2 3′-UTR wildtype or mutant-1 but did not inhibit the luciferase activities in A549 and LTEP-α-2 cells with the mutant-2 and mutant-1&2 constructs, suggesting that miR-1238 can selectively bind to the sequence (position 244-251) of LHX2 3′-UTR. [score:3]
This provides a strong rationale for our findings that both low miR-1238 and high LHX2 are expressed in NSCLCs. [score:3]
As illustrated in Figure 2A, miR-1238 expression level was significantly lower in A549, LTEP-α-2, H460, and H1299 cells than HBE cells (P < 0.001, P < 0.001, P < 0.001, and P < 0.001, respectively). [score:3]
Expression of miR-1238 is reduced and reversely correlated with LHX2 level in NSCLC cells and tissues. [score:3]
Takikawa et al. also found the reduced expression of miR-1238 in pancreatic cancer Panc-1 cells [19]. [score:3]
Correlation between expression level ratios (T/N) of LHX2 mRNA and miR-1238 was analyzed using the Spearman rank correlation test. [score:3]
org) to predict the targets of miR-1238. [score:3]
C. Difference in miR-1238 level between T and N. D. Correlation between miR-1238 level and LHX2 mRNA expression in 50 paired NSCLC tissues. [score:3]
Thus, we overexpressed miR-1238 in NSCLC cells and then evaluated the role of miR-1238 in cell growth inhibition. [score:3]
Y-axis represents the log [10] transformed fold change of miR-1238 expression ratio (T/N). [score:3]
As predicted, the 3′-UTR of the mRNA encoding LHX2 harbors two miR-1238 binding sites (positions 176-182 and 244-251 in the NM_004789 RefSeq transcript), suggesting that LHX2 could be a potential target of miR-1238. [score:3]
X and y axes represent the log [10] transformed fold change of T/N mRNA expression ratios of miR-1238 and LHX2, respectively. [score:3]
Differences in LHX2 mRNA and miR-1238 expression between NSCLC tissues (T) and adjacent noncancerous lung tissues (N) were assessed by a paired t test (2-tailed). [score:3]
Next, we adopted two methods to confirm whether LHX2 is a bona fide target of miR-1238. [score:3]
Furthermore, overexpression of miR-1238 (Figure 3C) significantly diminished LHX2 mRNA and protein levels in A549 and LTEP-α-2 cells (Figure 3D and 3E). [score:3]
Intriguingly, miR-1238 level was reduced in NSCLC cells and tissues, which was significantly inversely correlated with LHX2 expression. [score:3]
To test this, we subcloned LHX2 3′-UTR containing the wildtype/mutants of the two miR-1238 target sites into psiCHECK-2 vector (Figure 3A) and cotransfected the luciferase construct with miR-1238 mimics into A549 and LTEP-α-2 cells. [score:3]
Although several miRNAs including miR-1238 were reported to be implicated in colon cancer, the targets of miR-1238 has not yet been identified [25]. [score:3]
The results imply that miR-1238 functionally contributes to the expression of LHX2 in NSCLCs. [score:3]
Level of miR-1238 is reduced in NSCLC cells and tissues and reversely correlated with LHX2 expression in human NSCLC tissues. [score:3]
Firstly, a luciferase reporter assay showed that miR-1238 can selectively target one putative site of LHX2 3′-UTR. [score:2]
A. MiR-1238 levels expressed in HBE cells and NSCLC A549, LTEP-α-2, H460 and H1299 cells. [score:2]
CCK-8 assays showed that the proliferation ability of NSCLC cells overexpressing miR-1238 was significantly lower than that of control cells (P < 0.01; Figure 4A). [score:2]
A 219-bp fragment of human LHX2 3′-UTR containing two predicted miR-1238 target sites (positions 176-182 and 244-251) was amplified using the following primers: forward, 5′-CCGCTCGAGGAGCAACTAACTAACCACA-3′ (XhoI); reverse, 5′-ATTTGCGGCCGCCGTGGCAGTCTTTGAAAAT-3′ (NotI), and subcloned into a psiCHECK-2 vector with restriction enzymes XhoI and NotI (underscored; Fermentas, Hanover, MD, USA) to create a psiCHECK-2- LHX2-3′-UTR-wildtype. [score:2]
MiR-1238 levels are expressed as a relative index normalized against U6. [score:2]
Primer sequences for LHX2 mRNA, miR-1238, β-actin and U6 detection are described in Table 1. Relative expression levels of LHX2 mRNA and miR-1238 were determined following normalization to β-actin and U6, respectively. [score:2]
MiR-1238 and LHX2 mRNA levels are expressed as relative index normalized against U6 and β-actin, respectively. [score:2]
These findings suggested that miR-1238 is associated with human cancers. [score:1]
A. Schematic graph showing the subcloning of the predicted miR-1238 binding sites (positions 176-182 and 244-251) of LHX2 3′-UTR into psiCHECK-2 luciferase construct. [score:1]
Briefly, 1,000∼2,000 cells transfected with miR-1238 mimics and si-LHX2 or NC were seeded into each well of a 96-well plate. [score:1]
Our findings shed light on the mechanistic interaction of miR-1238 and LHX2 in NSCLC carcinogenesis. [score:1]
Briefly, cells transfected with miR-1238 mimics and si-LHX2 or NC were diluted in complete culture medium with a grad of 200 cells and reseeded in a 60 mm plate. [score:1]
Importantly, the ratio of miR-1238 level (T/N) was inversely correlated with that of LHX2 mRNA level (T/N) in 50 paired tissues (P < 0.0001; Figure 2D). [score:1]
C. Bar charts showing clonogenic growth of A549 and LTEP-α-2 cells transfected with miR-1238 mimics or NC. [score:1]
B. Luciferase activities of the construct containing the wildtype or mutant LHX2 3′-UTR reporter gene in A549 and LTEP-α-2 cells cotransfected with negative control (NC) or miR-1238. [score:1]
C. qRT-PCR analysis of miR-1238 levels in A549 and LTEP-α-2 cells transfected with miR-1238 mimics or NC for 72 h. U6 was used as internal control. [score:1]
Predicted duplex formation between miR-1238 and wildtype/mutant of miR-1238 binding sites is indicated. [score:1]
Of course, we can not exclude the opposite role of miR-1238 played in other types of cancer, because a single miRNA may have different functions depending on the cellular context [27]. [score:1]
E. LHX2 protein levels in A549 and LTEP-α-2 cells transfected with miR-1238 mimics or NC. [score:1]
Then, 50 ng of the above-described luciferase constructs were cotransfected into cells with 20 nM of either miR-1238 mimic (5′-CUUCCUCGUCUGUCUGCCCC-3′) or negative control (NC), respectively. [score:1]
B. Relative miR-1238 levels in 50 NSCLC tissues (T) and paired noncancerous lung tissues (N). [score:1]
As expected, this is first evidence of identifying the cytostatic role of miR-1238 in NSCLC cells, further improving our understanding of the tumor-promoting function of LHX2. [score:1]
[1 to 20 of 69 sentences]
2
[+] score: 52
Among D3 UM with liver metastasis (n = 6), higher expressions of miR-149* (83.3%), miR-1238 (83.3%), miR-199a (100%); moderate expressions in miR-134 (50%), miR-214 (50.0%), while lower expressions of miR-146b (33.33%) and let-7b (25%) and negative expression in miR-143 (100%) were observed. [score:9]
Among M3 UM with liver metastasis (n = 11), higher expressions of miR-149* (72.72%), miR-1238 (100%), miR-134 (100%), miR-214 (54.54%), miR-146b (54.54%), miR-199a (100%) while moderate expression of miR-143 (45.45%) and negative expression of let-7b (100%) was observed. [score:7]
Further, gene targets prediction of the differentially expressed miRNAs revealed the negative regulation of gene lists namely (i) SMAD4, WISP1, HDAC8 and C-KIT by miR-146b, (ii) WISP1 by miR-1238, miR-134 and (iii) SMAD4 by miR-199a (Fig 4). [score:6]
Among M3 UM with no history of liver metastasis (n = 40), higher expressions of miR-149* (90.0%), miR-1238 (97.5%) and miR-134 (57.5%), miR-214 (62.5%), miR-146b (67.5%), miR-143 (65.0%), miR-199a (90.0%) and lower expression of let-7b (30.0%) were observed. [score:5]
Among D3 UM with no liver metastasis (n = 29), higher expressions of miR-149* (72.41%), miR-1238 (86.2%), miR-199a (82.75%), miR-134 (41.37%), miR-214 (41.37%) and miR-146b (58.62%), while lower expression of miR-143 (37.93%), let-7b (13.79%) were observed (S6 Table and Fig 3). [score:5]
Top 10 up-regulated miRNAs with maximum score and high fold change were: miR-317-5p, miR-373, miR-1268, miR-191*, miR-150, miR-1275, miR-188-5p, miR-1238, miR-134 and miR-296-5p. [score:4]
Gene target prediction revealed SMAD4, WISP1, HIPK1, HDAC8 and C-KIT as the post-transcriptional regulators of miR-146b, miR-199a, miR-1238 and miR-134. [score:4]
MiR-1238 is known to regulate SASH1 (SAM and SH3 domain-containing protein 1, a tumor suppressor gene), contributing to breast cancer aggressiveness [25]. [score:3]
Although miR-1238 expression among the two UM groups were not significant, a higher percentage of miR-1238 (94.18%) suggests its possible role in uveal melanoma tumorigenesis. [score:3]
Differential expression of 8 miRNAs: miR-214, miR-149*, miR-143, miR-146b, miR-199a, let7b, miR-1238 and miR-134 were studied. [score:3]
miR-134, miR-1238, miR-149* are the common select miRNAs observed from this study. [score:1]
Three miRNAs: miR-149*, miR-1238 and miR-134 (which were in common with supervised and unsupervised data analysis; Fig 1C) and 5 miRNAs: miR-214, miR-143, miR146b, miR-199a and let7b (earlier shown as class 1/ class 2 discriminators) [13] were selected for validation. [score:1]
The data derived from metastasis-free survival analysis is presented in S6 Table and Fig 5. These results indicate that the expression of miR-214, miR-149*, miR-146b, miR-199a, miR-1238 and miR-134 can be used to evaluate the metastasis-free survival in UM patients. [score:1]
[1 to 20 of 13 sentences]
3
[+] score: 29
To understand the role of immunological and genetic factors involved in the transition of brucellosis into chronic infection, target pathway prediction of miR-1238-3p, miR-494, miR-6069, and miR-139-3p was performed according to KEGG function annotations, which increased miRNA (miR-1238-3p) of target genes involved in immunologically effective pathways as shown in Figure 2. miRNAs (miR-494, miR-6069, and miR-139-3p) that were downregulated in the chronic group were considered common. [score:7]
To understand the role of immunological and genetic factors involved in the transition of brucellosis into chronic infection, target pathway prediction of miR-1238-3p, miR-494, miR-6069, and miR-139-3p was performed according to KEGG function annotations, which increased miRNA (miR-1238-3p) of target genes involved in immunologically effective pathways as shown in Figure 2. miRNAs (miR-494, miR-6069, and miR-139-3p) that were downregulated in the chronic group were considered common. [score:7]
miR-1238-3p was upregulated, while miR-494, miR-6069, and miR-139-3p were downregulated in the chronic group compared with the active group. [score:6]
In the present study, we uniquely determined that reduced expression of miR-139-3p, miR-6069, and miR-494 and induced expression of miR-1238-3p were significantly associated with chronic brucellosis. [score:5]
The only upregulated miRNA in chronic brucellosis was miR-1238-3p. [score:4]
[1 to 20 of 5 sentences]
4
[+] score: 19
White vertical boxplots represent data from healthy tissues; gray from tumors Table 3 Expression of mirtronic miRNAs in colorectal, stomach, and pancreatic cancerous tissues compared to healthy tissues Cancerous tissue miRNAs of mirtron origin Non-mirtronic miRNA miR-1226-3p miR-1227-3p miR-1229-3p miR-1236-3p miR-1238-3p Colorectal − No change No change No change No change Stomach + No change No change No change No change Pancreatic No change − No change − No changeData were considered significant for p < 0.05 − reduced expression compared to the non-cancerous tissue, + increased expression Despite a considerable progress in the study of biogenesis of mirtron-derived miRNAs, the factors responsible for mirtronic intron splicing are not known. [score:4]
The levels of canonical hsa-miR-1238-3p expression in the majority of cancer cells, with the exception of SU. [score:3]
86.86, T3M4, stomach KATOIII, colon HCT116) or the excretory system (kidney CaKi-1, 786-O) were chosen to define whether the expression of the human mirtronic miRNAs hsa-miR-1226-3p, hsa-miR-1227-3p, hsa-miR-1229-3p, and hsa-miR-1236-3p and canonical hsa-miR-1238-3p varies between the cancerous cells. [score:3]
Dendrogram of hierarchy clustering analysis is presented at the left Table 2 Differential expression of mirtronic miRNAs in pancreas, kidney, colon, and stomach cancer cell lines Organ Cell line miRNAs of mirtron origin Non-mirtronic miRNA miR-1226-3p miR-1227-3p miR-1229-3p miR-1236-3p miR-1238-3p Pancreas PANC-1−2.8 ± 1.8 [a] −1.7 ± 0.3 [a] −2.8 ± 0.9 [a] −1.4 ± 0.2 −1.2 ± 0.6 SU. [score:3]
The hsa-miR-1238-3p expression level in the cell lines containing the intron excision -deficient MUT variant of minigene was more than 400-fold higher as compared to that in cells lacking the minigene. [score:2]
Schemes represent protein-coding genes, harboring reside-verified mirtronic miRNA hsa-miR-1226-3p, putative conventional mirtronic miRNAs hsa-miR-1227-3p, hsa-miR-1229-3p, and hsa-miR-1238-3p, mirtronic miRNAs, located in 5′-tailed mirtrons hsa-miR-3064-5p and hsa-miR-6515-5p and mirtronic miRNAs, located in 3′-tailed mirtrons hsa-miR-3940-5p and hsa-miR-6850-5p. [score:1]
Putative human conventional mirtron-derived hsa-miR-1227-3p, hsa-miR-1229-3p, hsa-miR-1236-3p, and hsa-miR-1238-3p [15] and 3′-tailed mirtron-derived hsa-miR-3940-5p and hsa-miR-6850-5p were identified in short 69–102 nucleotide introns, whereas hsa-miR-3064-5p and hsa-miR-6515-5p were processed from both long (1236 nt) and short (88 nt) 5′-tailed mirtrons [12]. [score:1]
Introns containing validated mirtronic miRNA hsa-mir-1226-3p or predicted miRNAs hsa-mir-1227-3p, hsa-mir-1229-3p, hsa-mir-1236-3p, and hsa-mir-1238-3p processed from conventional; hsa-miR-3064-5p and hsa-miR-6515-5p from 5′-tailed; and hsa-miR-3940-5p and hsa-miR-6850-5p from 3′-tailed mirtrons are depicted as red lines. [score:1]
Meanwhile, splicing was not strictly required for the maturation of hsa-miR-1238-3p, previously annotated as mirtron-encoded miRNA [12, 15]. [score:1]
[1 to 20 of 9 sentences]
5
[+] score: 11
In our recent study, we have shown that reduced expression of miR-139-3p, miR-6069 and miR-494 and induced expression of miR-1238-3p were significantly associated with chronic brucellosis [43]. [score:5]
In our previous study, more than 2000 miRNAs were screened in peripheral blood mononuclear cells of patients with acute or chronic brucellosis and we determined that while the expression level of miR-1238-3p was increased, miR-494, miR-6069 and miR-139-3p were decreased in the chronic group in comparison to the acute infection group [43]. [score:3]
Altered expressions of miR-1238-3p, miR-494, miR-6069 and miR-139-3p in the formation of Chronic Brucellosis. [score:3]
[1 to 20 of 3 sentences]
6
[+] score: 11
HHV-6A infection, but not -6B or −7 infections, induced a decrease in miR-155_2 expression and an increase in miR-1238 expression in thyrocytes, as well as an increase in the expression levels of several autoimmunity -associated miRNAs in T lymphocytes, including miR-16_1, miR34a, miR-130a, miR-143_1, miR-202, miR-301b, miR-302c, miR-449b, miR-451_1, and miR-1238_2. [score:7]
No data are instead available on miR-1238 potential functions in immunity, as it was so far recognized only as a tumor-suppressor factor [22]. [score:3]
However, it was identified as a marker of AITD [23], together with miR-143_1, and the strong increase observed in both thyroid and lymphoid HHV-6A infected cells suggest a potential role of miR-1238 in the modulation of immune response, and deserves further studies. [score:1]
[1 to 20 of 3 sentences]
7
[+] score: 8
Additionally, hsa-miR-365, hsa-miR-1238, hsa-miR-184 are all down-regulated in [ER−|PR−]HER2−, and up-regulated in [ER−|PR−]HER2+. [score:7]
Most of the feature genes are shared with Dai’s diff-genes (Table 5), except for C8orf85, CENPW, CENPV, CXCL14, and has-miR-1238, which are revealed only from the decision tree. [score:1]
[1 to 20 of 2 sentences]
8
[+] score: 7
In basal conditions (day 0), up-regulated miRNAs were: miR-1225-3p, miR-1305, miR-1238, miR-425, miR-191* and miR-34a, while miR-378 was the only down-regulated miR. [score:7]
[1 to 20 of 1 sentences]
9
[+] score: 5
Altered expressions of miR-1238-3p, miR-494, miR-6069, and miR-139-3p in the formation of chronic brucellosis. [score:3]
In one of our previous studies, more than 2,000 miRNAs were screened in peripheral blood mononuclear cells of patients with acute or chronic brucellosis, and we determined that while the expression level of miR-1238-3p increased, miR-494, miR-6069, and miR-139-3p decreased in the chronic group compared to the acute group. [score:2]
[1 to 20 of 2 sentences]
10
[+] score: 3
Yang et al. [81] used immunohistochemical methods to study breast tumor subtypes and found that there is expression differences on hsa-miR-365, hsa-miR-1238 and hsa-miR-184. [score:3]
[1 to 20 of 1 sentences]
11
[+] score: 2
miRNA Sequence miR-574-5pUGA GUGUGUGUGUGUGA GUGUGU miR-941CACCCGGCU GUGUGCACAU GUGC miR-3149UUU GUAUGGAUAU GUGUGUGUAU miR-1238-5p GUGA GUGGGAGCCCCA GUGUGUG miR-545-3pUCAGCAAACAUUUAU UGUGUGC miR-2278GAGAGCA GUGUGUGUUGCCUGG miR-3148UGGAAAAAACUG GUGUGUGCUU let-7b-5pUGAG GUA GUAG GUU GUGUG GUU miR-493-3pUGAAG GUCUACU GUGUGCCAGG miR-1180UUUCCGGCUCGC GUGG GUGUGU miR-539-5pGGAGAAAUUAUCCUUG GUGUGU miR-32-3pCAAUUUA GUGUGUGUGAUAUUU miR-206UGGAAU GUAAGGAA GUGUGUGG miR-1299UUCUGGAAUUC UGUGUGAGGGA miR-3911U GUGUGGAUCCUGGAGGAGGCA miR-297AUGUAU GUGUGCAU GUGCAUG miR-610UGAGCUAAAU GUGUGCUGGGA miR-1228-5p GUGGGCGGGGGCAG GUGUGUG miR-595GAA GUGUGCC GUG GUGUGUCU miR-4455AGG GUGUGUGUGUUUUU miR-3650AG GUGUGUCU GUAGA GUCC miR-147a GUGUGUGGAAAUGCUUCUGC miR-660-3pACCUCCU GUGUGCAUGGAUUAInterestingly, most of the trinucleotide repeats contain base “U” and “G”, although it can be noticed that this type of SSR is less represented. [score:1]
miRNA Sequence miR-574-5pUGA GUGUGUGUGUGUGA GUGUGU miR-941CACCCGGCU GUGUGCACAU GUGC miR-3149UUU GUAUGGAUAU GUGUGUGUAU miR-1238-5p GUGA GUGGGAGCCCCA GUGUGUG miR-545-3pUCAGCAAACAUUUAU UGUGUGC miR-2278GAGAGCA GUGUGUGUUGCCUGG miR-3148UGGAAAAAACUG GUGUGUGCUU let-7b-5pUGAG GUA GUAG GUU GUGUG GUU miR-493-3pUGAAG GUCUACU GUGUGCCAGG miR-1180UUUCCGGCUCGC GUGG GUGUGU miR-539-5pGGAGAAAUUAUCCUUG GUGUGU miR-32-3pCAAUUUA GUGUGUGUGAUAUUU miR-206UGGAAU GUAAGGAA GUGUGUGG miR-1299UUCUGGAAUUC UGUGUGAGGGA miR-3911U GUGUGGAUCCUGGAGGAGGCA miR-297AUGUAU GUGUGCAU GUGCAUG miR-610UGAGCUAAAU GUGUGCUGGGA miR-1228-5p GUGGGCGGGGGCAG GUGUGUG miR-595GAA GUGUGCC GUG GUGUGUCU miR-4455AGG GUGUGUGUGUUUUU miR-3650AG GUGUGUCU GUAGA GUCC miR-147a GUGUGUGGAAAUGCUUCUGC miR-660-3pACCUCCU GUGUGCAUGGAUUA Interestingly, most of the trinucleotide repeats contain base “U” and “G”, although it can be noticed that this type of SSR is less represented. [score:1]
[1 to 20 of 2 sentences]
12
[+] score: 1
We also downgraded 4 mirtrons in mirBase which failed the 50 total reads criteria (hsa-mir-1178, hsa-mir-7107, hsa-mir-1238), or lacked both star reads and Ago-IP reads (hsa-mir-4641). [score:1]
[1 to 20 of 1 sentences]