sort by

66 publications mentioning hsa-mir-663b

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-663b. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 173
In addition, we overlapped the miR-663 -downregulated gene profiles (P<0.05; Supplementary Figure S4 and Table S8) with both the AICD -downregulated gene expression profile and the Targetscan-predicted genes of miR-663, and revealed that another 11 genes were downregulated by both AICD and miR-663 (Figure 5b). [score:14]
Subsequently, we intersected the miR-663 -downregulated gene profiles (P<0.001) with the AICD -downregulated gene expression profile, and revealed that seven genes were downregulated by both AICD and miR-663 (Figure 5a). [score:12]
In order to predict and identify the possible target genes of miR-663 among the genes with differential expression, we checked whether any are predicted targets using Targetscan. [score:9]
[29] We found that the predicted direct targets of miR-663 were enriched in the downregulated genes as compared with the total genes in the study, and greatly enriched in the 91 downregulated genes (Figure 4b). [score:9]
Using gene expression microarrays, we found that multiple genes with miR-663 predicted that target sites were downregulated in hNSCs. [score:8]
[31] Moreover, DIANA-mirExTra hexamer analysis confirmed that the direct targets of miR-663 were enriched in the 91 downregulated genes (Figure 4e). [score:7]
46, 47 In addition, miR-663 targets the expression of multiple genes, such as TGFβ1, p21, H-ras, eEF1 and HSPG2, to regulate cancer cell proliferation and chemotherapy resistance. [score:6]
After validation, we identified two direct target genes, FBXL18 and CDK6, which could contribute to the AICD/miR663 inhibition of neurogenesis. [score:6]
The reporter assay result demonstrates that AICD/miR-663 can downregulate the expression of FBXL18 and CDK6 directly. [score:6]
AICD/miR-663 -downregulated genes inhibit neuronal differentiation. [score:6]
Flow cytometry analysis showed that the number of βIII-tubulin -positive cells was significantly decreased in cells overexpressing miR-663 (Figures 3c and d), but not in those overexpressing miR-3648 or miR-3687 (Supplementary Figures S3a and b). [score:5]
After overexpression of AICD, the expression levels of miR-663 significantly increased, and those of both miR-3648 and miR-3687 were significantly decreased (Figure 2f). [score:5]
As multiple different miR-663 target genes have been reported, we hypothesized that miR-663 also targets multiple genes to perform its function in the nervous system. [score:5]
32, 33 To identify the genes targeted by miR-663 in hNSCs, the miR-663 mimics were transfected into hNSCs, and mRNA was purified and profiled on gene expression microarrays (Supplementary Figure S4a). [score:5]
Importantly, we have demonstrated that miR-663 has an important role in suppressing neuronal differentiation of hNSCs in vitro and have identified an AICD downstream mechanism suppressing neurogenesis in hNSCs (Figure 6). [score:5]
To further confirm that AICD inhibits neuronal differentiation through miR-663, we investigated whether inhibition of miR-663 could rescue AICD -mediated suppression of neuronal differentiation. [score:5]
[36] To identify downstream genes of AICD/miR-663 signaling during neurogenesis, we performed gene expression microarray analysis in AICD -overexpressing hNSC cells. [score:5]
To determine which of the AICD-regulated miRNAs are involved in inhibiting neuronal differentiation, we transfected molecular mimics of miR-663, miR-3687 or miR-3648 into hNSCs. [score:4]
29, 30, 31 Interestingly, miR-663, a member of primate-specific miRNA family, has recently been found to be associated with cancer, through the regulation of different target genes in cancer cells. [score:4]
These results demonstrate that, among the AICD-regulated miRNAs, miR-663 mediates suppression of neuronal differentiation in hNSCs. [score:4]
In brief, hNSCs were transduced by AICD, and EGF and bFGF were withdrawn to stimulate cell differentiation at 48 h post transduction, when miR-663 was upregulated (Figure 2f). [score:4]
hNSCs were co -transfected with miR-663 antisense inhibitor and AICD. [score:3]
miR-663 targets multiple genes in hNSCs. [score:3]
As the binding sites for mir-663, mir-3648 and mir-3687 were situated near to the SSS of these miRNAs, the embedded regions were scanned using ChIP in both AICD -overexpressed and wild-type hNSCs. [score:3]
These observations indicate that miR-663 is a mediator for the AICD suppression of neuronal differentiation in hNSCs. [score:3]
This consensus motif was complementary to the positions 2–8 from the 5′ end of miR-663, the crucial seed region required for target recognition (Figure 4d). [score:3]
After differentiation, both flow cytometry and immunohistochemistry showed that the number of βIII-tubulin -positive cells was significantly increased after co-transfection of miR-663 antisense inhibitor with AICD (Figures 3g–j). [score:3]
[44] miR-663, expressed only in Homo sapiens, Macaca mulatta and Pantroglodytes, belongs to the primate-specific miRNAs. [score:3]
miR-663 suppresses neuronal differentiation of hNSCs. [score:3]
[55] Therefore, it is possible that miR-663 inhibits neuronal differentiation through CDK6. [score:3]
56, 57 In conclusion, the present study has identified the role of AICD-regulated miR-663 in hNSC differentiation and provided one molecular mechanistic insight into AICD signaling in human neurogenesis in vitro. [score:2]
Our findings show that miR-663 can decrease the number of βIII-tubulin -positive cells during neuronal differentiation. [score:1]
Therefore, the exact role of miR-663 at different stages of the neuronal differentiation needs to be explored in future studies. [score:1]
[51] Briefly, these previous studies provide a clue that miR-663 is able to influence cell proliferation and differentiation; however, its role in the nervous system is not well understood. [score:1]
We found that the index of AICD -binding enrichment was significantly increased at regions of −1150, −154 and +375 bp away from the mir-663 SSS, but not at more distant regions or the control gapdh promoter region (Figure 2g). [score:1]
[45] The function of miR-663 has been reported to be mainly associated with cancer biology. [score:1]
In acute myeloid leukemia patients, the miR-663 promoter is hypermethylated and influences leukemia cell differentiation. [score:1]
Preliminary result showed that miR-663 did not decreased the length significantly (Supplementary Figure S5c). [score:1]
When co -transfected with the miR-663, repression of the reporter gene was observed in the 3′-UTR of the FBXL18 and 5'-UTR of the CDK6 in comparison with the corresponding mutant UTRs (Figure 5f). [score:1]
32, 33, 48, 49, 50 Moreover, miR-663 is related to smooth muscle cell phenotypic switch in the cardiovascular system. [score:1]
Thus, these data demonstrate that AICD interacts with the chromatin regions of mir-3648, mir-3687, let-7a-1, mir-663, mir-3910, mir-193a and mir-595. [score:1]
[1 to 20 of 41 sentences]
2
[+] score: 116
Li et al. reported that miR-663 was downregulated in glioblastoma tissues and had inhibitory effects on the proliferation, migration, and invasion of glioblastoma cells via targeting TGF- β1 [24]. [score:8]
Moreover, treatment with waltonitone in non-small cell lung cancer led to an upregulation of miR-663, which further caused downregulation of bcl-2 and induces cancer cell apoptosis [28]. [score:7]
Recently, it was reported that miR-663 was upregulated in NPC tissues and cell lines, and knockdown of miR-663 suppressed the growth of NPC cells in vitro and in vivo [19]. [score:7]
Moreover, its expression levels were significantly associated with several important clinicopathological features including grade, lymph node metastasis, and clinical stage, suggesting that the upregulation of serum level of miR-663 may be used as an important biomarker for the malignant progression of NPC. [score:6]
Our study for the first time demonstrates that the serum expression miR-663 is upregulated in NPC, and high serum miR-663 levels are significantly associated with the malignant progression and poor prognosis in NPC patients. [score:6]
Zang et al. indicated that miR-663 could inhibit the tumor growth and invasiveness in pancreatic cancer by directly targeting EEF1A2 [27]. [score:6]
The expression of miR-663 was significantly lower in pediatric acute myeloid leukemia (AML) cells compared to normal bone marrow due to the hypermethylated promoter, suggesting that downregulation of miR-663 may be involved in the development of AML [23]. [score:6]
Liu et al. showed that miR-663 was highly expressed in lung cancer patients and promoted the proliferation of lung cancer cells by directly or indirectly regulating TGFB1, P53, Bax, and Fas [33]. [score:6]
Similar findings were also reported that miR-663 acted as a tumor suppressor in glioblastoma by targeting CXCR4 and PIK3CD [25, 26]. [score:5]
The relative expression of miR-663 was analyzed by the 2 [−ΔΔCt] method that normalized to U6 expression. [score:5]
Therefore, it seems that the role of miR-663 is cancer-specific, and miR-663 plays dual roles in different cancer types, probably because it regulates different target genes in different tumor microenvironments. [score:4]
Besides, other cancer-related factors were also found to be direct targets of miR-663, such as EEF1A2 and HSPG2 [30, 31]. [score:4]
Overexpression of miR-663 significantly decreased the proliferation, migration, and colony formation of multiple myeloma cells [29]. [score:3]
Consistent with our study, the expression of miR-663 was also found to be increased in NPC tissues and cell lines. [score:3]
Sand et al. reported that miR-663 was significantly upregulated in cutaneous malignant melanoma compared to benign melanocytic nevi [32]. [score:3]
All NPC patients were divided into two groups, high serum levels of miR-663 group and low serum levels of miR-663 group, according to the mean expression of serum miR-663 as a cut-off point. [score:3]
The expression levels of miR-663 were significantly decreased in gastric cancer [17]. [score:3]
Nonparametric t-test was used to analyze the differential expression of serum miR-663 between NPC patients and healthy controls. [score:3]
MiR-663 has previously been reported to be frequently deregulated in several types of human cancers, indicating that miR-663 may play an important role in carcinogenesis. [score:2]
MiR-663 has recently been found to generally play a suppressive role in several kinds of human cancers. [score:2]
Molecular mechanism investigation revealed that miR-663 could promote the proliferation of NPC cells in vitro and in vivo by directly targeted p21(WAF1/CIP1) to promote the cellular G1/S transition [19]. [score:2]
In the present study, we found that the serum miR-663 levels were significantly higher in NPC in patients than in healthy control. [score:1]
Therefore, the serum levels of both miR-663 and miR-774 may be used as important biomarkers for monitoring the treatment response. [score:1]
The Serum miR-663 Levels Are Higher in NPC Patients Than in Healthy Control. [score:1]
The Association between Serum Level of miR-663 and Treatment Response. [score:1]
The Serum Level of miR-663 Is an Independent Predicator for the Prognosis of NPC Patients. [score:1]
Kaplan-Meier analysis with the log-rank test was used to examine the association between the serum level of miR-663 and the 5-year overall survival (OS) and relapse-free survival (RFS). [score:1]
As indicated in Figures 3(a) and 3(b), we found that the serum levels of miR-663 were remarkably decreased in NPC patients after receiving the standard chemoradiotherapy (P < 0.001). [score:1]
These data suggest that the serum levels of miR-663 may be used as an important biomarker for monitoring the treatment response. [score:1]
Therefore, the serum level of miR-663 may become a potential predicator for the clinical outcome of NPC patients. [score:1]
The Serum miR-663 Levels Are Significantly Associated with Grade, Clinical Stage, and Lymph Node Metastasis in NPC. [score:1]
On the contrary, however, several studies also reported that miR-663 played a promoting role in several cancer types [32]. [score:1]
As demonstrated in Table 1, the serum miR-663 levels were not correlated with age (P = 0.980), gender (P = 0.939), T stage (P = 0.112), distant metastasis (P = 0.172), and EBV infection (P = 0.239). [score:1]
Therefore, higher serum level of miR-663 is associated with poor prognosis of NPC patients. [score:1]
Moreover, as demonstrated in Table 3, the serum level of miR-663 (P = 0.025), lymph node metastasis (P = 0.035), and clinical stage (P = 0.001) were found to be independent factors for predicating the prognosis of NPC patients. [score:1]
However, evidence in the serum levels of miR-663 in NPC as well as its clinical significance still remains limited. [score:1]
Chi-square test was used to analyze the association between the serum level of miR-663 and clinicopathological parameters of NPC. [score:1]
Finally, we found that the serum levels of miR-663 were remarkably decreased in NPC patients after receiving the standard chemoradiotherapy. [score:1]
Our data indicated that the serum miR-663 levels were significantly higher (about 3.5-fold) in NPC patients than in healthy control (P < 0.001, Figure 1). [score:1]
Univariate analysis data indicated that the serum level of miR-663 (P = 0.014), as well as the grade (P = 0.021), lymph node metastasis (P = 0.009), and clinical stage (P = 0.001), was significantly associated with the survival (Table 2). [score:1]
Higher Serum Level of miR-663 Is Associated with Poor 5-Year Survival Rates in NPC Patients. [score:1]
In our study, we firstly examined the levels of miR-663 in serum from NPC and healthy controls using real-time PCR. [score:1]
Paired sample t-test was used to analyze the differential amount of miR-663 in serum between NPC patients before treatment and those after treatment. [score:1]
[1 to 20 of 43 sentences]
3
[+] score: 106
Thus, by targeting AP-1 factors as well as TGF β1 and possibly SMAD3, miR-663 might inhibit two of the pathways that upregulate miR-155 expression. [score:10]
Finally, it is probable that, depending on the cell context, resveratrol might either increase the level of TGF β signaling—by inhibiting miRNAs targeting its main effectors—when it is beneficial to the organism, that is, when it works to maintain the integrity of epithelia and impair cell proliferation, or in contrast decrease TGF β1 signaling—by decreasing its production through the upregulation of miR-663—when TGF β1 starts to favor epithelial-to-mesenchymal transition and metastasis. [score:8]
Namely, miR-663 was found to be downregulated in hormone refractory prostate cancer cells, along with miR-146a and miR-146b [90], further supporting the hypothesis that this miRNA is a tumor-suppressor gene whose one of the function is to keep low the expression level of oncogenic miR-155 [47, 48]. [score:8]
Altogether, these results indicate that the anti-inflammatory properties of resveratrol arise, at least in part, from its upregulation of miR-663 and its downregulating effects on miR-155 and that miR-663 might possibly qualify as an anti-inflammatory miRNA. [score:7]
This inhibitory effect of resveratrol on AP-1 activity was partly impaired by 663-I, indicating that it arises at least in part from the upregulation of miR-663 by resveratrol [47]. [score:6]
Of note, among miRNAs upregulated by resveratrol, miR-663 was the only one to target TGF β1 transcripts. [score:6]
The results reported here above also suggested that, due to its targeting of AP-1 factors, known to play a role in tumorigenesis and cell invasion [86, 87] and due to its downregulation of miR-155, whose levels increase in solid as well as in liquid tumors [40], miR-663 may also possibly provide resveratrol with some of its anticancer properties. [score:6]
Accordingly, miR-663 reduced the upregulation of miR-155 by LPS [42], which may be due to miR-663 targeting of transcripts encoding JunB and JunD and also possibly FosB and KSRP, an RNA binding protein implicated in the LPS -induced miR-155 maturation from its primary transcripts BIC [89]. [score:6]
The facts that GAM transcripts contain three consensus target sites for miR-663 and that GAM is sensible to resveratrol treatment (Tili et al., unpublished results) raises the question of the possible existence of a gene regulatory network that would allow miR-663 to impair GAM repressing activity on TGF β1 signaling pathway when TGF β1 works as a tumor suppressor, that is, at the early stages of tumorigenesis but not any more when this pathway starts to favor tumorigenesis and metastasis, that is, on advanced stages of cancers. [score:6]
Given that AP-1 factors include c-Jun, JunB, JunD, FosB, Fra-1, and Fra-2, as well as Jun dimerization partners JDP1 and JDP2 or the closely related ATF2, LRF1/ATF3, and B-ATF, so that potentially about 18 different dimeric combinations may be formed, the capability of resveratrol to specifically target a subset of AP-1 dimers through the upregulation of miR-663 might have profound effects on the levels of the transcriptional activity of promoters to whom different AP-1 factors can compete for binding. [score:6]
In addition, the fact that miR-663, miR-21, miR-155, and TGF β1 have all been implicated in the regulation of cell proliferation, tumor apparition and development, metastasis formation, and innate immunity, strongly suggests that the capability of resveratrol to behave at the same time as an antitumor, antimetastatic, antiproliferation and anti-inflammatory agent most probably arises from its effects on the expression of a small set of critical endogenous miRNAs having the abilities to impact the cell proteome globally. [score:5]
An antisense miR-663 inhibitory RNA (663-I) proved capable of increasing global AP-1 activity in unchallenged THP-1 cells, showing that miR-663 indeed target transcripts encoding AP-1 factors in these cells. [score:5]
Affymetrix microarrays and RNase-protection assays showed that resveratrol treatment of human THP-1 monocytic cells upregulated the expression of LOC284801 transcripts, that contain the sequence of pre-miR-663 and thus represent miR-663 primary transcripts. [score:5]
Thus, MiR-663 impairs the upregulation of miR-155 by inflammatory stimuli [47]. [score:4]
Therefore, the fact that miR-663 may potentially target 5 different sites in TGF β1 3′-UTR suggests that this miRNA could represent a critical TGF β1 regulator which may possibly be called upon action in emergency situations such as those when cells begin to proliferate anarchically or when a stronger immune response is required. [score:4]
org/) suggested that miR-663 may potentially target transcripts encoding factors implicated in (i) the mounting of the immune response, especially JunB, JunD, and FosB, which encode AP-1 factors known to activate many cytokine genes in partnership with NFAT factors [84], (ii) TLR signaling, such as the kinases RIPK1 and IRAK2, and (iii) the differentiation of monocytes, Th1 lymphocytes, and granulocytes. [score:3]
Luciferase assays and Western blots showed that resveratrol downregulated TGF β1 in both a miR-663 -dependent and a miR-663-independent manner [83]. [score:3]
MiR-663 has drown recent attention due to its role not only as an anti-inflammatory miRNA but also as a tumor suppressor miRNA. [score:3]
The multiplicity of miR-663 targets sites in TGF β1 3′-UTR further suggests that the effects of this miRNA might be both dose- and context -dependent, so that resveratrol effects on TGF β1 signaling pathway might well be also context -dependent. [score:3]
Given that miR-663 was only found in primates, the reports by Tili et al. [47, 83] come as a warning that studies in animal may not always allow to predict accurately the molecular effects of resveratrol in human, especially when it comes to miRNAs. [score:1]
Resveratrol treatment also decreased the transcriptional activity of SMADs under TGF β1 signaling, an effect seemingly independent of miR-663 [83]. [score:1]
[1 to 20 of 21 sentences]
4
[+] score: 52
The up-regulated and down-regulated miRNAs (miR-20b, miR-92a-3p, miR-92b, miR-376c-3p, miR-150, miR-342-3p, and miR-663) may be involved in the regulation of transcription, DNA -dependent positive regulation of transcription from RNA polymerase II promoter, protein amino acid phosphorylation, and negative regulation of transcription from RNA polymerase II promoter. [score:10]
b Relationship among target genes predicted by miR-150, miR-342-3p, and miR-663 Fig. 5GO and pathway analysis result of the target genes predicted by differentially expressed miRNAs which are involved in HBV -induced HCC. [score:7]
In addition, all down-regulated miRNAs (miR-150, miR-342-3p, and miR-663) target baculoviral IAP repeat containing 5 (BIRC5), CCND1, and protein tyrosine kinase 2 (PTK2). [score:6]
Similarly, the processes targeted by at least two of several miRNAs (miR-150, miR-342-3p, and miR-663) were cellular response to starvation, positive regulation of transcription from RNA polymerase II promoter, regulation of transcription, DNA -dependent protein amino acid phosphorylation, and negative regulation of transcription from RNA polymerase II promoter (Fig.   5b). [score:6]
All down-regulated miRNAs (miR-150, miR-342-3p, and miR-663) target B-cell lymphoma/leukemia 2 (BCL2), BIRC5 and PTK2. [score:6]
Our data indicates that the unique 7 miRNAs (miR-150, miR-342-3p, miR-663, miR-20b, miR-92a-3p, miR-376c-3p and miR-92b) expression signature could be involved in the development of HBV- related HCC, suggesting interesting potential novel therapeutic options. [score:4]
The predicted target genes of miR-150, miR-342-3p, and miR-663 were related to MAPK signaling pathway, cytokine-cytokine receptor interaction, focal adhesion, insulin signaling pathway, and regulation of actin cytoskeleton (Fig.   5d). [score:4]
By miRNA expression profile, we found that miR-150, miR-342-3p, miR-663, miR-20b, miR-92a-3p, miR-376c-3p, and miR-92b are specifically altered in HBV-related HCC. [score:3]
b Main biological processes influenced by genes targeted by two or more miRNAs from miR-150, miR-342-3p, and miR-663. [score:3]
Ultimately, miR-20b, miR-92a-3p, miR-92b, miR-376c-3p, miR-150, miR-342-3p, and miR-663 were selected. [score:1]
Eight miRNAs (miR-223, miR-98, miR-15b, miR-199a-5p, miR-19b, miR-22, miR-451, and miR-101) were involved in HBV-unrelated HCC, 5 miRNAs (miR-98, miR-375, miR-335, miR-199a-5p, and miR-22) were involved in HBV infection, and 7 miRNAs (miR-150, miR-342-3p, miR-663, miR-20b, miR-92a-3p, miR-376c-3p and miR-92b) were specifically altered in HBV-related HCC. [score:1]
The identity of the 12 miRNAs is as follows: miR-21, miR-20b, miR-92a-3p, miR-92b, miR-376c-3p, miR-150, miR-451, miR-101, miR-424, miR-342-3p, miR-122a, and miR-663. [score:1]
[1 to 20 of 12 sentences]
5
[+] score: 27
Conversely, increasing miR-663 expression induced the FLS proliferation and the expression MMP3 and fibronectin during disease development [74]. [score:8]
Among these, the miR-152 and miR-375 were downregulated, and the miR-663 was upregulated in RA patients or rat mo dels. [score:7]
In this context, the expression of miR-663 was significantly upregulated and APC expression was decreased in synovium from RA patients compared with controls. [score:7]
Using a similar approach, the author further revealed that miRNA-663 could activate the canonical Wnt signaling by directly targeting APC [74]. [score:4]
Recently, a series of investigations conducted by Miao et al. demonstrated that several miRNAs, including miR-152, miR-375, and miR-663, were involved in the pathogenesis of RA by targeting Wnt signaling pathways [35, 74, 77, 78]. [score:1]
[1 to 20 of 5 sentences]
6
[+] score: 25
Although miR-663 can be induced by the anti-inflammatory drug resveratrol, and acts as a tumor-suppressor miRNA in human THP1 monocyte cells as well as in human blood monocytes by targeting AP-1 and preventing LPS -mediated upregulation of the oncogenic miR-155 [44], in nasopharyngeal carcinoma miR-663 promotes cancer proliferation by targeting p21 (WAF1/CIP1) [45], and in prostate cancer overexpression of miR-663 is associated with increased castration-resistance [46]. [score:12]
339 also had lower expression of miR-339 and miR-663b, but higher levels of CCNE2 mRNA (Fig.   7d). [score:3]
A dual nature both as an oncogene and as a tumor-suppressor gene has also been reported for miR-663. [score:3]
Using such rationale and strategy, we designed Δ117-CTCCC-121 for miR-339-3p TRE and Δ249-TCCCG-253 for miR-663b-3p TRE deletions. [score:1]
Of the three interacting miRNAs, miR-339-3p is very conserved among species, miR-95-5p is conserved in humans, pig, dog, cow, and horse, but not in mouse; so it evolved after the mouse appearance, but long before humans, whereas miR-663b-3p is primate specific. [score:1]
For miR-339-3p, probe # 38578-15 (Exiqon) and for miR-663b-3p, probe # 21359-15 (Exiqon) were used. [score:1]
339, miR-339, miR-663b, and CCNE2 in two nude mice injected subcutaneously with A549 LV-E or A549 LV- uc. [score:1]
339 called M1 and M2, lacking the TRE in the proximity of miR-339 and miR-663b binding sites, respectively (Fig.   8a, b). [score:1]
339 structure using the ViennaRNA Package 2, and identified two elements in close proximity with, but located outside of the miR-339 and the miR-663b binding sites, whose deletion completely changed the predicted secondary RNA structure of the uc. [score:1]
In bold, the predicted miRNA -binding elements (MBEs) for miR-339 or miR-663b. [score:1]
[1 to 20 of 10 sentences]
7
[+] score: 23
There were 354 putative targets for miR-583 and 68 putative targets for miR-663. [score:5]
In addition, it is unclear that whether serum miR-583 and miR-663 are liver derived or originated from immune cells involved in the antiviral responses that accompany the development of liver diseases. [score:4]
To investigate the function of the miR-583 and miR-663, we predicted miRNA targets using TargetScan 6.2 database. [score:3]
Using a bioinformatics approach, we analyzed potential targets of the miR-583 and miR-663. [score:3]
It indicates that the miR-583 and miR-663 have some important functions by regulating these pathways in liver cells. [score:2]
These results thus also show that the levels of miR-583 and miR-663 may distinguish LGDHS from LKYDS in CHB patients. [score:1]
miR-663 was 9.61-fold higher in all 53 CHB comparing to Ctrls (P = 0.0019) (Figure 1(c)). [score:1]
ROC curve areas of miR-583 and miR-663 were 0.776 (95% CI: 0.65–0.90) and 0.923 (95% CI: 0.84–1.00) (Figures 2(a) and 2(b)). [score:1]
Further study will investigate the expression of miR-583 and miR-663 in a variety of clinical liver biopsies and related cell lines. [score:1]
Among them, the median levels of serum miR-583, miR-663, miR-1299, miR-494, miR-140-3p and miR-936, and so forth were higher in 3 CHB patients with LGDHS than those in 3 CHB patients with LKYDS (Table 2). [score:1]
MiR-583 or miR-663 was able to distinguish between LGDHS and LKYDS (Figures 1(a) and 1(d)). [score:1]
[1 to 20 of 11 sentences]
8
[+] score: 21
It is also notable that miR-663 is located in the heterochromatin close to the centromere of Chromosome 20, potentially limiting its expression in many contexts. [score:3]
0025044.g009 Figure 9Effect of miR-663 and -744 transfection on endogenous TGF-β [1] protein and message expression. [score:3]
Interestingly a second miR, miR-663, shows considerable seed region homology with miR-744, and exhibits overlapping potential targeting sites within the TGF-β [1] UTR (Fig. 7a). [score:3]
Effect of miR-663 and -744 transfection on endogenous TGF-β [1] protein and message expression. [score:3]
In order to test for microRNA-directed regulation of TGF-β [1] synthesis, TGF-β [1] was quantified in the cell culture supernatant of HK-2 cells transfected with miR-663 and -744 precursors. [score:3]
However, while miR-744 appears highly conserved in vertebrates, this is not the case for miR-663 (Fig. 7b). [score:1]
Effect of miR-663 and miR-744 transfection on TGF-β [1] short UTR reporter vector. [score:1]
Transfection with miR-744 precursor led to a significant decrease in TGF-β [1] release (Fig. 9a, control transfection 118.5pg/ml, miR-663 precursor transfection 87.0 pg/ml (p = n. s. ), miR-744 precursor transfection 71.7 pg/ml (p<0.05)). [score:1]
0025044.g010 Figure 10Effect of miR-663 and miR-744 transfection on TGF-β [1] short UTR reporter vector. [score:1]
Co-transfection of miR-744 precursor with pGL3short led to reduction in reporter vector activity (Fig. 10a, miR-663 precursor transfection, 15.8% reduction vs. [score:1]
Multiple sites were identified for miR-663 and miR-744. [score:1]
[1 to 20 of 11 sentences]
9
[+] score: 20
At 6-hour post-infection, it was found that miR-483-3p was up-regulated (>3-fold, p<0.05) in H5N1 infected cells while miR-663 was found to be up-regulated (>1.5-fold, p<0.05) in H1N1 infected cells. [score:7]
Among the listed profiles of differentially up-regulated miRNA, it was found that miR-141, miR-181c*, miR-210, miR29b, miR-324-5p, and miR-663 were up-regulated (>1.5-fold, p<0.05) at 3-hour post-infection with subtype H5 as compared with non-infected control cells. [score:6]
At 18 and 24-hour post-infection, miR-923, miR-1246, miR-574-3p, and miR-663 were up-regulated (>3-fold, p<0.05) in H5N1 infected cells. [score:4]
As a summary, miR-1246, miR-663 and miR-574-3p were up-regulated (>3-fold, p<0.05) at 24-hour post-infection with subtype H5 as compared with non-infected control cells. [score:3]
[1 to 20 of 4 sentences]
10
[+] score: 19
Similar results were observed in p53 [+/+] and p53 [−/−] cells (Figure 2c): the expression levels of miR-3151 and miR-663b were upregulated in p53 [−/−] cells, while the expression levels of miR-140, miR-30b, miR-506, miR-124 and miR-30c were downregulated in p53 [−/−] cells compared with that in p53 [+/+] cells. [score:10]
In p53 [mut] cell line HT29, the expression levels were significantly downregulated except miR-3151 and miR-663b (which were significantly upregulated), compared with p53 [wt] cell line R KO (Figure 2b). [score:8]
Several miRNAs were proposed, among which seven of them were reported to be related to p53: miR-140, miR-30b, miR-3151, miR-506, miR-124, miR-30c, and miR-663b 19, 20, 21, 22, 23, 24 (Figure 2a). [score:1]
[1 to 20 of 3 sentences]
11
[+] score: 19
Other miRNAs from this paper: hsa-mir-34a, hsa-mir-9-3, hsa-mir-1-1, hsa-mir-596, hsa-mir-663a
Our results confirm that of bisulfite treated genomic DNA provides reliable high quality quantitative methylation data and identify MAL, hsa-mir-9-3, hsa-mir-596, and hsa-mir-663 as new targets of aberrant DNA methylation in human hepatocelluar carcinoma. [score:3]
In order to explore the feasibility of quantitative methylation studies using, a range of genomic loci was selected for in-depth analysis: tumor-suppressor genes reported to be frequently hypermethylated in hepatocellular carcinoma (p16 [INK4a], RASSF1A, SOCS-1, GSTπ1, [12] and references therein), classical non-protein coding CIMP loci also reported to be methylated in HCC (MINT31, [13]), and microRNA genes identified by our own group to be aberrantly methylated in HCC (mir-9-3, mir-34a, mir-596, mir-663). [score:3]
The methylation results for LINE-1 elements, hsa-mir-1-1 and the newly identified targets MAL, hsa-mir-9-3, hsa-mir-596, and hsa-mir-663, are also compiled in Table 1. Table 1 Methylation profile of all loci across the 10 HCC samples analyzed in this study. [score:3]
The methylation results for LINE-1 elements, hsa-mir-1-1 and the newly identified targets MAL, hsa-mir-9-3, hsa-mir-596, and hsa-mir-663, are also compiled in Table 1. Table 1 Methylation profile of all loci across the 10 HCC samples analyzed in this study. [score:3]
One sample (HCC 9) for miR-663 was left out from analysis because the quality control criteria of the methylation data analysis software were not met (see also legend to Figure 2). [score:1]
RASSF1A SOCS1 MINT31 LINE1 GSTP1 P16 MAL miR596 miR663 miR9-3 miR1-1 miR34a 1 10% 8% 4% 61% 9% 3% 6% 5% 21% 10% 11% 7% 2 75% 50% 53% 20% 22% 2% 2% 7% 19% 10% 10% 5% 3 81% 79% 67% 20% 21% 52% 2% 4% 24% 8% 18% 3% 4 28% 24% 15% 54% 11% 4% 6% 12% 10% 8% 15% 6% 5 75% 62% 64% 30% 10% 46% 2% 19% 27% 4% 10% 4% 6 88% 61% 76% 54% 74% 1% 30% 50% 79% 25% 20% 2% 7 89% 71% 37% 42% 28% 1% 12% 16% 18% 28% 17% 3% 8 66% 80% 74% 54% 53% 2% 61% 81% 75% 36% 22% 4% 9 84% 8% 64% 53% 67% 1% 38% 50% N/A 58% 24% 3% 10 91% 59% 59% 38% 35% 59% 2% 55% 54% 31% 30% 2% The percentages are the mean methylation values for a given locus in an individual sample (454 sequencing result). [score:1]
For more details see Additional File 5. Analysis of the miR-663 gene gave the worst congruence between pyrosequencing and. [score:1]
Only for GSTπ1, miR-663, p16 [INK4a], and RASSF1A could potentially informative SNPs be found. [score:1]
To this end the methylation patterns of 12 loci (GSTπ1, p16 [INK4a], RASSF1A, SOCS1, MAL, hsa-mir-1-1, hsa-mir-9-3, hsa-mir-34a, hsa-mir-596, hsa-mir-663, MINT31, and LINE-1) were analyzed in ten primary hepatocellular carcinoma specimens. [score:1]
A few amplicons did not produce a sufficient number of high-quality reads for the quantification of cytosine methylation (i. e., miR-663). [score:1]
For more details see Additional File 5. Analysis of the miR-663 gene gave the worst congruence between pyrosequencing and. [score:1]
[1 to 20 of 11 sentences]
12
[+] score: 16
Our data also reiterate the senescence -associated up-regulation of miR-373* and miR-663 and down-regulation of miR-197 observed in WI-38 cells [5] although less is known about the targets of these miRNAs. [score:9]
Our data also corroborate the up-regulation of miR-373* and miR-663 and down-regulation of miR-197 observed in senescent and quiescent WI-38 cells [5]. [score:7]
[1 to 20 of 2 sentences]
13
[+] score: 14
[14, 15] MiR-135a*, miR-188-5p, miR-663 and miR-483-5p were downregulated in plasma cell leukemia. [score:4]
[16] Moreover, miR-483-5p, miR-663 and miR-630 had been reported to have tumor suppressor properties in other cancers. [score:3]
Moreover, we report tumor suppressor functions of miR-198, miR-135a*, miR-200c, miR-663 and miR-483-5p in myeloma, that they reduced cell viability, migration and colony formation. [score:3]
MiR-155, miR-198, miR-200c, miR-483-5p and miR-663 significantly suppressed colony formation in MM cells (Figure 3B). [score:3]
At the same time, many other miRNAs were unmasked, including miR-125a-3p, miR-155, miR-135a*, miR-198, miR-200c, miR-188-5p, miR-630, miR-663 and miR-483-5p. [score:1]
[1 to 20 of 5 sentences]
14
[+] score: 14
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-29a, hsa-mir-31, hsa-mir-99a, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-192, hsa-mir-199a-1, hsa-mir-208a, hsa-mir-30c-2, hsa-mir-147a, hsa-mir-10a, hsa-mir-34a, hsa-mir-181b-1, hsa-mir-199a-2, hsa-mir-203a, hsa-mir-204, hsa-mir-217, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-200b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-132, hsa-mir-140, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-146a, hsa-mir-150, hsa-mir-185, hsa-mir-193a, hsa-mir-195, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, hsa-mir-30c-1, hsa-mir-219a-2, hsa-mir-296, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-302d, hsa-mir-374a, hsa-mir-375, hsa-mir-378a, hsa-mir-330, hsa-mir-328, hsa-mir-342, hsa-mir-325, hsa-mir-424, hsa-mir-429, hsa-mir-450a-1, hsa-mir-486-1, hsa-mir-146b, hsa-mir-497, hsa-mir-520e, hsa-mir-520f, hsa-mir-520a, hsa-mir-520b, hsa-mir-520c, hsa-mir-520d, hsa-mir-520g, hsa-mir-520h, hsa-mir-450a-2, hsa-mir-503, hsa-mir-608, hsa-mir-625, hsa-mir-629, hsa-mir-663a, hsa-mir-1271, hsa-mir-769, hsa-mir-378d-2, hsa-mir-675, hsa-mir-147b, hsa-mir-374b, hsa-mir-378b, hsa-mir-378c, hsa-mir-374c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-4661, hsa-mir-219b, hsa-mir-203b, hsa-mir-378j, hsa-mir-486-2
THP-1 cells were incubated with resveratrol (30 or 50 µM) for 14 h. As a result, resveratrol upregulated antiinflammatory miR-663, which directly targets two AP-1 factors (JunB and JunD), decreasing AP-1 activity. [score:7]
In contrast, pro-inflammatory miR-155 was down-regulated by resveratrol and by upregulated miR-663. [score:7]
[1 to 20 of 2 sentences]
15
[+] score: 13
The present study also showed that the expression of HSPG2 was suppressed by up-regulation of miR-663 in HMM cells. [score:8]
Likewise, hypomethylation and concordant overexpression of miR-663 reduces the drug sensitivity of human breast cancer cells by repressing the expression of heparan sulfate proteoglycan 2 (HSPG2) [29]. [score:5]
[1 to 20 of 2 sentences]
16
[+] score: 13
Predicted targets for the top 5 annotated miRNA in exosomes (miR-663, miR-503, miR-492, miR-498 and miR-671–5p) were searched using TargetScan and subsequently the target mRNAs were analysed by IPA software to determine predicted canonical pathways, networks and biofunctions regulated by the exosomal miRNAs (Fig. 5 and Additional Information, Table S6. [score:8]
TargetScanHuman 5.1 was applied to predict mRNA targets for the top 5 annotated microRNAs detected in exosomes (miR-663, miR-503, miR-492, miR-498 and miR-671–5p), which generated a list of 500 mRNA. [score:5]
[1 to 20 of 2 sentences]
17
[+] score: 10
According to previous reports, rRNA-contained miRNAs such as miR-663, miR-1275, miR-3648, miR-3656, miR-3687, miR-4417, and miR-4516 are associated with tumor suppression, carcinomas, neuronal differentiation, breast cancer, breast cancer/neuronal differentiation, breast cancer, and regulation of signal transducer and activator of transcription 3, respectively [103– 108]. [score:4]
According to Son et al., mmu-miR-712 is located at ITS2 of mouse rRNA gene (Rn45s) and hsa-miR-663 is located at ITS1 region of human rRNA gene (RNA45S) [48]. [score:1]
Son et al. also discovered that mmu-miR-712 is coded in ITS2 of mouse 45S precursor RNA (Rn45s) and hsa-miR-663 is coded in the ITS1 region of human RNA45S [48]. [score:1]
Of twelve putative pre-rmiRs, pre-rmiR-663a showed the highest similarity to pre-miR-663b in both base sequence and precursor structure (Supplemental Figure  1A). [score:1]
Subsequently, seventeen RNA alignments identical to human mature miRNAs, namely, miR-663a, miR-663b-3p, miR-1268a, miR-1268b, miR-1275, miR-3648, miR-3656-3p, miR-3687-3p, miR-4417, miR-4466, miR-4488, miR-4492-3p, miR-4508, miR-4516, miR-4532, miR-6087, and miR-6724, were detected from the human rRNA sequences (Table 1). [score:1]
However, some miRNAs, such as mmu-miR-712, dme-miR-10404, and hsa-miR-663, are typical resident miRNAs because they do not require specific transcriptional factors or nucleases to exert their functions [47, 48]. [score:1]
In our research, miR-712 was likewise found in ITS2 of Rn45s; however, hsa-miR-663 was not found in ITS1 but 5′ ETS of RNA45S. [score:1]
[1 to 20 of 7 sentences]
18
[+] score: 10
76, 77 miR-663 was found to be upregulated in nasopharyngeal carcinoma, and acts as oncogene to promote the cellular G1/S transition in vitro and in vivo by directly targeting p21 [CIP1]. [score:7]
Similar to p27 [Kip1], p21 [CIP1] and p16 [INK4a] are also regulated by miRNAs such as miR-663, miR-302 family and miR-24. [score:2]
Therefore, the miR-663/p21 [CIP1] axis clarifies the molecular mechanism of nasopharyngeal carcinoma cell proliferation. [score:1]
[1 to 20 of 3 sentences]
19
[+] score: 8
In the work led by Tilghman et al., DTT (10 μM) or BPA (10 μM) activate ERα in MCF-7 breast cancer cells which down-regulated the expression of miR-21, let-7a-f, miR-15b, and miR-28b and increased the expression miR-638, miR-663, and miR-1915 (Tilghman et al., 2012). [score:8]
[1 to 20 of 1 sentences]
20
[+] score: 8
In coronary artery disease patients with type 2 diabetes and hypertension, RES treatment (grape extract containing 8 mg RES for 12 months) lowered the expression of proinflammatory cytokines by acting via inflammation-related miRNAs (i. e., miR-21, miR-181b, miR-663, miR-30c2, miR-155 and miR-34a), which supports an immunomodulatory effect of RES in these patients [125]. [score:5]
RES effects on inflammation could involve the modification of the expression of miRNAs that can be anti-inflammatory (e. g., miR-663) or pro-inflammatory (e. g., miR-155) [38]. [score:3]
[1 to 20 of 2 sentences]
21
[+] score: 7
This includes miR-663 which is upregulated by shear stress [22] and miR-200c, which is upregulated by oxidative stress [23]. [score:7]
[1 to 20 of 1 sentences]
22
[+] score: 7
Kim J. S. Park M. G. Lee S. A. Park S. Y. Kim H. J. Yu S. K. Kim C. S. Kim S. G. Oh J. S. You J. S. Downregulation of adenomatous polyposis coli by microRNA-663 promotes odontogenic differentiation through activation of Wnt/β-catenin signaling Biochem. [score:4]
For example, miRNAs, such as miR-135, miR-27, mir-155, miR-129, miR-106b, let-7, miR-125, miR-663, and miR-142, target APC and activate canonical Wnt signaling [100, 138, 139, 140, 141, 142, 143, 144, 145, 146]. [score:3]
[1 to 20 of 2 sentences]
23
[+] score: 6
However, only miR-663 could be regulated by DNA methylation, and the expression levels of miR-369, miR-615, and miR-410 were not regulated by DNA methylation in K562 cells [26]. [score:5]
Previous evidence also shows that CpG islands in the upstream regions of 18 pre-miRNAs are methylated after 5-azacytidine treatment, including miR-663, miR-369, miR-615 and miR-410. [score:1]
[1 to 20 of 2 sentences]
24
[+] score: 6
Using TaqMan qPCR assays, we confirmed that four miRNAs, miR-100, miR-125b, miR-22 and miR-720, were commonly upregulated miRNAs in EMT; five miRNAs, miR-200c, miR-141, miR-205, miR-663 and miR-638, were commonly downregulated miRNAs in EMT (Figure 1B and Table S2). [score:6]
[1 to 20 of 1 sentences]
25
[+] score: 6
Recent study reported that miR-663 targets p21 (WAF1/CIP1) to promote the proliferation and development of NPC [22]. [score:4]
Yi C, Wang Q, Wang L, Huang Y, Li L, Liu L, Zhou X, Xie G, Kang T, Wang H et al. MiR-663, a microRNA targeting p21(WAF1/CIP1), promotes the proliferation and tumorigenesis of nasopharyngeal carcinoma. [score:2]
[1 to 20 of 2 sentences]
26
[+] score: 6
Primate-specific miR-663 functions as a tumor suppressor by targeting PIK3CD and predicts the prognosis of human glioblastoma. [score:5]
miRNA name Nuclear %Conservation [∗] hsa-miR-768-5pˆ 94.17 n/a hsa-miR-768-3pˆ 93.71 n/a hsa-miR-1299 93.17 No (hsa, ptr, ppy) hsa-miR-297 92.72 Yes hsa-miR-663b 92.17 No (hsa, ptr, ppy, oga, bta) hsa-miR-647 89.19 No (hsa, ppy) hsa-miR-595 88.09 No (hsa, ptr, mml, ppy) hsa-miR-921 83.82 No (hsa, ppy, efu)hsa-miR-593 [∗] 80.62 No (hsa, ptr, mml, ppy) hsa-miR-1183 78.28 No (hsa, ptr, ppy)hsa-miR-664 [∗] 75.44 Yes hsa-miR-1275 73.87 No (hsa, ptr, ppy) hsa-miR-574-5p 71.94 Yes [∗] Species identifiers: hsa, Homo sapiens; ptr, Pan troglodytes; mml, Macaca mulatta; ppy, Pongo pygmaeus; efu, Eptesicus fuscus; Bta, Bos Taurus; oga, Otolemur garnettii. [score:1]
[1 to 20 of 2 sentences]
27
[+] score: 6
Other miRNAs from this paper: hsa-mir-146a, hsa-mir-146b, hsa-mir-663a
Several genes previously recognized as tumor suppressors and oncogenes in other cancers including e. g. RASSF1, miR-663, ARID5B, FIP1L1, BCL6, TRPM2, ADORA1, ADORA2A, TFA2PA, and DIRC2 were among the “ ASXL1 methylation signature genes”. [score:3]
Several tumor suppressors and oncogenes including RASSF1, miR-663, ARID5B, FIP1L1, BCL6, TRPM2, ADORA1, ADORA2A, TFA2PA, and DIRC2 were differentially methylated in the ASXL1 mutated cases (Table  S7). [score:3]
[1 to 20 of 2 sentences]
28
[+] score: 6
Shu R APP intracellular domain acts as a transcriptional regulator of miR-663 suppressing neuronal differentiationCell. [score:4]
Another miRNA of interest, mir-663, is a known regulator of neuronal differentiation [37]. [score:2]
[1 to 20 of 2 sentences]
29
[+] score: 6
Other miRNAs from this paper: hsa-mir-663a
Although with only one exonic SNP, mir663 is not significant in our test of allele-specific expression. [score:3]
Figure 4Distinct methylation patterns between the two reconstructed parental sequences of mir663. [score:1]
mir663 (HUGO Gene Nomenclature Committee (HGNC) ID [HGNC:MIR663]) is found to have a cluster of 12 differentially methylated CG sites located within its gene body of 93 bp. [score:1]
Differentially methylated CG sites are found within mir663. [score:1]
[1 to 20 of 4 sentences]
30
[+] score: 5
The down-regulation of mir-663 in tumor cells may contribute to the hyperplasia of aberrant cells, leading to the development of GC [32]. [score:5]
[1 to 20 of 1 sentences]
31
[+] score: 5
The expression of ANKRD30BL, the putative host gene for miR-663b, was not detectable before or after 5-aza-dC experiments and therefore, not plotted in Figure 4. For miR-24-1 and miR-27b, the data is less conclusive, and we could not rule out that these two mi -RNAs can be co-synthesized with the host gene, C9orf3 [26]. [score:3]
UCSC genome browser screen captures of the promoter regions (±1000 bp from annotated transcription start site) for (A) RPS6KA4, putative host gene for miR-1237, (B) C9orf3, putative host gene for miR-24-1 and miR-27b, (C) AB058779, putative host gene for miR-602, (D) ANKRD30BL, putative host gene for miR-663b, and (E) DNAJC5, putative host gene for miR-941-1 and miR-941-3. The first track contains DNA methylation at these promoters in HCT116, and the second track contains DNA methylation in D KO cells as detected by MiGS. [score:1]
Based on qRT-PCR results, we determined that miR-1237, miR-602, miR-941-1, miR-941-3, and miR-663b are transcriptionally independent from their respective putative host genes (Figure 4). [score:1]
[1 to 20 of 3 sentences]
32
[+] score: 5
Other miRNAs from this paper: hsa-mir-663a
showed that colony number of H460 cells transfected with miR-663 mimic was significantly decreased (control 596 ± 28 vs mimic 401 ± 18, p < 0.05), while colony formation ability of H1299 transfected with miR-663a inhibitor was increased (control 171 ± 16 vs inhibitor 295 ± 18, p < 0.05) (Fig.   2b). [score:5]
[1 to 20 of 1 sentences]
33
[+] score: 5
Interestingly, 14 of these miRNAs (miR-596, miR-630, miR-422a, miR-490-5p, miR-375, miR-708, miR-345, miR-125b-2, miR-516a-3p, miR-135a, miR-1228, miR-1915, miR-134, and miR-663) have established roles in tumor suppression and drug resistance, while 5 miRNAs (miR-630, miR-375, miR-345, miR-1228, and miR-134) are known to inhibit epithelial–mesenchymal transition and invasion in cancer cells. [score:5]
[1 to 20 of 1 sentences]
34
[+] score: 5
The sequences of targeting motifs used to build the miRNA -inhibitor vectors are listed below: (1) aaagtgccgccatcttttgagt for miR-371b-5p, (2) gcacagcccccgtccctccct for miR-149, (3) cgccgccccgcacctgct for miR-3665, (4) cagagcccgccccaacccac for miR-3940-5p, (5) cccccgcctccgccgccgcc for miR-3960, (6) gcctgccccctccaacagcca for miR-4687-3p, (7) gcggtcccgcggcgccccgcct for miR-663, and (8) gctcggccccggccccagcccc for miR-762. [score:5]
[1 to 20 of 1 sentences]
35
[+] score: 5
The top down-regulated miRNAs (miR-1, miR-30a, miR-133a, miR-133b, miR-208b and miR-378c) and up-regulated miRNAs (miR-338-5p, miR-663b, miR-645 and miR-3663-5p) are listed in Table 2 and 3. To confirm the results of miRNA microarray assay, SYBR Green qRT-PCR was performed using the RNAs from five human osteosarcoma and three normal muscle samples in miRNA microarray assay as templates. [score:5]
[1 to 20 of 1 sentences]
36
[+] score: 4
To test this hypothesis in the latter, we screened 462 human miRNA (from let-7 family to miR-663) in BMC derived from well-characterized cases of mild sporadic AD and age-matched normal elderly control subjects and, based on predicted miRNA targets, ascertained whether the accruing data may account for the patterns of mRNA downregulation in Alzheimer BMC previously reported by our laboratories (Maes et al. 2006). [score:4]
[1 to 20 of 1 sentences]
37
[+] score: 4
Other miRNAs from this paper: hsa-mir-423, hsa-mir-663a
Meanwhile, the expression of p21 in human tumors could be post-transcriptionally regulated by a lot of microRNAs including miR-663 and miR-423 [43, 44]. [score:4]
[1 to 20 of 1 sentences]
38
[+] score: 4
In addition, upregulation of miR-638 (P<0.005), miR-663 (P<0.005), and miR-1915 (P<0.005) was observed after treatment of MCF7 cells with E [2], BPA or DDT (Table 2). [score:4]
[1 to 20 of 1 sentences]
39
[+] score: 4
Eleven (miR-30d, miR-10b, miR-34a, miR-195, miR-222, miR-221, miR-31, miR-7, miR-663, miR-193b and miR-18a) out of 22 deregulated microRNAs accounted for the 283 predicted target mRNAs linked to cell death (e. g. pro- or anti-apoptotic genes) (see Additional file 8). [score:4]
[1 to 20 of 1 sentences]
40
[+] score: 4
APP intracellular domain acts as a transcriptional regulator of miR-663 suppressing neuronal differentiation. [score:4]
[1 to 20 of 1 sentences]
41
[+] score: 4
miRNA expression profiling also revealed induction of pre-miR-663 at both the time points post infection apart from the mature miR-663 form. [score:3]
We confirmed time dependent induction of specific miRNAs (miR-663, miR-638, miR-503 and miR-744) in response to CHIKV infection thus validating the microarray data. [score:1]
[1 to 20 of 2 sentences]
42
[+] score: 4
Ni C-W Qiu H Jo H MicroRNA-663 upregulated by oscillatory shear stress plays a role in inflammatory response of endothelial cellsAm. [score:3]
Several of them have been reported to be involved in EC functions (miR-139 [36] and miR-663 37, 38) or in angiogenesis (miR-483 [39], miR-708 [40], miR-205 [41] and miR-296 [42]). [score:1]
[1 to 20 of 2 sentences]
43
[+] score: 3
However, an increasing number of tumor-suppressive miRNAs have also been discovered, including miR-637 [48], miR-663 [49], miR-218 [30], miR-128 [50], and miR-34a [51]. [score:3]
[1 to 20 of 1 sentences]
44
[+] score: 3
A subset of five miRNAs was both dysregulated at 8 h and 24 h post-infection, including miR-141, miR-200c, miR-21 [*] (also known as miR-21-3p), miR-29b-1 [*] (also known as miR-29b-1-5p) and miR-663. [score:2]
Unfortunately, miR-663 was not found to show any significant changes from 8 to 24 hpi (Figure 2G). [score:1]
[1 to 20 of 2 sentences]
45
[+] score: 3
Hsa-mir-663 is involved in inflammatory conditions and suppression of cell proliferation [63], [64] which can underlie hESC response to IR exposures. [score:3]
[1 to 20 of 1 sentences]
46
[+] score: 3
miR-663 has been reported as a primate-specific miRNA largely expressed in the brain [38]. [score:3]
[1 to 20 of 1 sentences]
47
[+] score: 2
Other miRNAs from this paper: hsa-mir-663a
Another microRNA gene MIR663B is located 10,964-base upstream of 2q21.2 between 132742087-132742356 mapped by a 290-base sequence, of which a non-coding RNA gene NCRNA00164 is located in between. [score:1]
microRNA gene MIR663 are located 20,580 base upstream of 20p11.1 between 26157494-26158252 mapped by a 920-base sequence detected in seven CLL samples. [score:1]
[1 to 20 of 2 sentences]
48
[+] score: 2
Other miRNAs from this paper: hsa-mir-203a, hsa-mir-663a, hsa-mir-203b
Methylation status was assessed for 10 loci including eight cancer-related genes and two miRNAs coding loci, methylation presence was determined by methyl-specific PCR (MSP) for RIZ1, RASSF1, SOCS1, TERT, TNFRSF10C and GSTP1 genes (Additional file 1: Table S4), and using COBRA for NRG1, CLU, mir-203 and mir-663 genes (Additional file 1: Table S5). [score:1]
Clinico-biological features of the HCC patients are summarized in Table  1. In this study, we examined methylation patterns of ten tumor -associated genes (RASSF1A, GSTP1, RIZ1, SOCS1, TNFRSF10C, hTERT, NRG1, CLU, miR-203, miR-663) and of the LINE-1 repetitive element in 45 HCC and 17 matching non-tumor livers (see Figure  1 and Additional file 1: Table S1). [score:1]
[1 to 20 of 2 sentences]
49
[+] score: 2
Member(s) of the hsa-miR-181 14 and hsa-miR-29 families 15 exhibit both anticancer and pro-cancer regulation under different clinical conditions, while members of hsa-miR-126 16, hsa-miR-129 17, hsa-miR-136 18, hsa-miR-204 19, hsa-miR-663 20, hsa-miR-99 21, hsa-miR-378 22, hsa-miR-92 23, and hsa-miR-409 24 families are recognized as having anticancer properties under different clinical conditions. [score:2]
[1 to 20 of 1 sentences]
50
[+] score: 2
Furthermore, it has been reported that several circulating miRNAs, such as miR-133, miR-1291, miR-663b, miR-328, and miR-134, exhibit clinical impact on human myocardial infarction [47, 48]. [score:1]
Peng L. Chun-guang Q. Bei-fang L. Xue-zhi D. Zi-hao W. Yun-fu L. Yan-ping D. Yang-gui L. Wei-guo L. Tian-yong H. Clinical impact ofcirculating miR-133, miR-1291 and miR-663b in plasma of patients with acute myocardial infarction Diagn. [score:1]
[1 to 20 of 2 sentences]
51
[+] score: 2
Other miRNAs from this paper: hsa-mir-663a
The roles of miR-663 in regulating the differentiation, aging and other developmental processes have not been investigated and more future studies are warranted. [score:1]
For example, the ASM region tagged by the g. chr20:26137893 T- > C SNP is located upstream of miR-663 and the allelic asymmetry of DNA methylation in the miR-663 promoter region was also validated by the cloned bisulfite sequencing data (Fig. 4B). [score:1]
[1 to 20 of 2 sentences]
52
[+] score: 2
CDKN1A could be regulated by several miRNAs in many cancers, including miR-519d, miR-375, miR-31 and miR-663 [33– 35]. [score:2]
[1 to 20 of 1 sentences]
53
[+] score: 2
06 hsa-miR-595 5.29 hsa-miR-92b −9.97 hsa-miR-601 5.88 hsa-miR-765 4.47 hsa-miR-98 5.05 hsa-miR-99a 6.41 TGF-β -treated hsa-miR-20b −1.29 hsa-let-7a 1.38 hsa-miR-221 −1.25 hsa-let-7d 1.43 hsa-miR-605 −4.64 hsa-let-7e 2 hsa-miR-638 −1.40 hsa-miR-125a-5p 2.87 hsa-miR-663 −2.06 hsa-miR-146a 2.72 hsa-miR-720 −2.40 hsa-miR-21 1.14 hsa-miR-23a 1.20 hsa-miR-23b 1.14 hsa-miR-30c 1.89 hsa-miR-483-5p 1.38 hsa-miR-574-5p 2.23 hsa-miR-99b 1.63 10.1371/journal. [score:1]
06 hsa-miR-595 5.29 hsa-miR-92b −9.97 hsa-miR-601 5.88 hsa-miR-765 4.47 hsa-miR-98 5.05 hsa-miR-99a 6.41 TGF-β -treated hsa-miR-20b −1.29 hsa-let-7a 1.38 hsa-miR-221 −1.25 hsa-let-7d 1.43 hsa-miR-605 −4.64 hsa-let-7e 2 hsa-miR-638 −1.40 hsa-miR-125a-5p 2.87 hsa-miR-663 −2.06 hsa-miR-146a 2.72 hsa-miR-720 −2.40 hsa-miR-21 1.14 hsa-miR-23a 1.20 hsa-miR-23b 1.14 hsa-miR-30c 1.89 hsa-miR-483-5p 1.38 hsa-miR-574-5p 2.23 hsa-miR-99b 1.63 10.1371/journal. [score:1]
[1 to 20 of 2 sentences]
54
[+] score: 1
79 ** hsa-mir-365 7.13 *** 77.53 *** hsa-mir-429 54.63 *** 85.25 *** hsa-mir-454 33.25 *** 87.31 - hsa-mir-455-3p 42.76 *** 96.4 - hsa-mir-484 4.83 *** 78.73 - hsa-mir-485-3p 4.75 *** 71.49 *** hsa-mir-501-3p 69.25 *** 91.25 *** hsa-mir-512-5p 21.37 *** 72.89 *** hsa-mir-532-3p 9.5 *** 85.93 *** hsa-mir-541 69.87 *** 97.77 - hsa-mir-600 35.63 *** 93.48 - hsa-mir-625* 28.5 *** 72.89 *** Hits of functional screen Relative percentage of myotubes 1, % of control p value, Mann Whitney test Relative cell count 2, % of control p value, Mann Whitney test hsa-mir-636 2.37 *** 81.98 *** hsa-mir-663 21.38 *** 84.73 *** hsa-mir-664 7.13 *** 82.85 *** hsa-mir-766 45.13 *** 73. [score:1]
[1 to 20 of 1 sentences]
55
[+] score: 1
Other miRNAs from this paper: hsa-mir-663a
Previous studies have demonstrated that promoters of TFPI-2 [30] and miR-663 [31, 32] were hypermethylated in Chinese pediatric acute myeloid leukemia. [score:1]
[1 to 20 of 1 sentences]
56
[+] score: 1
Li P Zhu N Yi B Wang N Chen M You X Zhao X Solomides CC Qin Y Sun J MicroRNA-663 regulates human vascular smooth muscle cell phenotypic switch and vascular neointimal formation. [score:1]
[1 to 20 of 1 sentences]
57
[+] score: 1
As shown in Figure 2, several microRNAs were markedly more abundant in senescent cells (e. g., miR-1204, miR-663, miR-548b-3p and miR-431). [score:1]
[1 to 20 of 1 sentences]
58
[+] score: 1
Notably, miR-663 was located on chromosome 20 ph (the heterochromatic region on the p arm), in which the genes are usually transcriptionally silent [21]. [score:1]
[1 to 20 of 1 sentences]
59
[+] score: 1
Location Human Gene or comment chr1:10,291,843-10,314,721 RNU6-1,2,7,8,9 intronic of KIF1B chr1:91,344,238-91,430,371 HFM1 intronic chr2:132,234,625-132,276,521 ANKRD30BL intronic (near MIR663B) chr8:69,676,805-69,703,480 SLCO5A1 intronic chr21:8,183,959-8,252,641 NR_038958 and 28 S RNA intronic (near MIR3648 and MIR663A) chr21:8,393, 229-8,410,398 NR_038958 intronic and 28 S RNA exonic chr21:8,429,258-8,463,598 28 S RNA 45 S RNA exonic Location Plasmodium Gene or comment many nearly all rRNA genes Supercontig_1.3:841,093–845,256 T complexe protein PFC0900w Supercontig_1.4:520,965-530,102 tRNA-Glu1 Supercontig_1.7:716,587–734,017 tRNA-Asp1 Supercontig_1.11:126,943-135,040 near PF11_0040-1 (3′utr?) [score:1]
[1 to 20 of 1 sentences]
60
[+] score: 1
As an example, Lehmann et al. have shown that miR-9-1, miR-124a3, miR-148, miR-152 and miR-663 are epigenetically inactivated through hyper-methylation in breast cancer [257]. [score:1]
[1 to 20 of 1 sentences]
61
[+] score: 1
Other miRNAs from this paper: hsa-mir-532, hsa-mir-660
For autosomal chromosomes we found three microRNAs with significant differences in DNA methylation based on sex, namely hsa-miR-548H4, hsa-miR-220B and hsa-miR-663B (Additional files 2 and 3). [score:1]
[1 to 20 of 1 sentences]
62
[+] score: 1
Interestingly, miRNA content of regional BAL fluid in this study shows divergence of several microRNAs that could prove to be of importance in inflammation within the lung, namely miR-451a and miR-663. [score:1]
[1 to 20 of 1 sentences]
63
[+] score: 1
In the data presented here, many of these miRNAs (e. g. miR-10a/b, miR-24/27, miR-125a, miR-126 and miR-221/222) are abundant, while others are present in relatively low amounts (e. g. miR-18a, miR-19a, miR-34a, miR-200a/b/c, miR-210 and miR-217), or not at all (e. g. miR-133a and miR-663) (Fig.   2a). [score:1]
[1 to 20 of 1 sentences]
64
[+] score: 1
The successful bioinformatics approach to identifying miR-1236 allows us to anticipate that miR-3960, miR-3166, miR-4763, miR-665 and miR-663, are potential candidates for anti-HBV miRNA (Tables 1 and 2). [score:1]
[1 to 20 of 1 sentences]
65
[+] score: 1
While 33s were associated with only one gene, manys were associated with multiple genes: miR-7i-5p, miR-133b, miR-221-3p, miR-27a-3p, miR-29a-3p, miR-6515-5p, miR-663a, and miR-93-5p were associated with two genes; miR-145-5p, miR-17-5p, miR-193-3p, miR-19b-30, miR-203a, miR-20a-5p, miR-21-5p, miR-3651, miR-650, and miR-663b with three genes, and miR-92a-3p, miR-150-5p, and miR-20b-5p with four genes. [score:1]
[1 to 20 of 1 sentences]
66
[+] score: 1
miRNAs such as, miR-10a, miR-19a, miR-23b, miR-17-92, miR-21, miR-663, miR-92a, miR-143/145, miR-101, miR-126, miR-712, miR-205, and miR-155 are counted amongst those mechano-miRs [45]. [score:1]
[1 to 20 of 1 sentences]