sort by

40 publications mentioning hsa-mir-1290

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-1290. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 288
The following criteria were used to identify the possible miR-1246 or miR-1290 target genes: (1) genes downregulated >1.5-fold on miR-1246 or miR-1290 overexpression in NuLi-1 cells, and (2) genes upregulated >1.5-fold on miR-1246 or miR-1290 downregulation in A549 cells. [score:14]
HumanHT-12 v4 Expression BeadChip (Illumina) was used to identify the genes upregulated in A549 knocking down miR-1246 or miR-1290, and genes downregulated in NuLi-1 overexpressing miR-1246 or miR-1290. [score:12]
MT1G is a target of miR-1246 and miR-1290 that inhibit TICsBecause miRNAs are well-known to regulate the activities of downstream targets, which in turn, control the behaviour of a cell, we sought to identify genes that might be directly targeted by miR-1246 or miR-1290. [score:11]
While we identified the putative tumour suppressor, MT1G, as a common target for miR-1246 and miR-1290, one could not exclude the possibility that other miRNA target genes could also contribute towards the inhibition of tumorigenicity. [score:9]
To do so, we performed whole-transcriptome analyses after knocking down miR-1246 or miR-1290 in A549, a metastatic lung cancer cell line, which expressed high levels of the miRNAs, as well as after overexpressing miR-1246 or miR-1290 in NHBE, a normal lung epithelial cell line not expressing the miRNAs. [score:8]
The top downregulated lung TIC -associated miRNAs include miR-23a, miR-130a, let-7 family, miR-513a-5p, miR-125b and miR-29a, whereas the top upregulated miRNAs include miR-1290, miR-130b, miR-1246, miR-630, miR-196a/b, miR-9/9* and miR-17∼92 cluster and its miR-106b∼25 analogues. [score:7]
Since miRNAs are well-known to exert pleiotropic effects on a variety of gene targets, it is arguably more effective to inhibit miRNAs, owing to their potential for silencing other additional endogenous target mRNAs, as in the case of miR-1246 and miR-1290. [score:7]
Because miRNAs are well-known to regulate the activities of downstream targets, which in turn, control the behaviour of a cell, we sought to identify genes that might be directly targeted by miR-1246 or miR-1290. [score:7]
If MT1G was a major target of both miRNAs, we tested whether MT1G overexpression could counter the effect of miR-1246 or miR-1290 expression. [score:7]
Potential miR-1246 and miR-1290 targets were identified by using two sets of wide-transcriptome microarray profiles: NuLi-1 relative to NuLi-1 cells overexpressing miR-1246 or miR-1290 (Illumina humanHT12_V4), and A549 relative to A549 cells knocking down miR-1246 or miR-1290 (Illumina humanHT12_V4). [score:6]
LNA inhibitors against miR-1246 or miR-1290 (Exiqon) contained the following sequence: 5′- TGCTCCAAAAATCCAT -3′ or 5′- CCTGATCCAAAAATCC -3′, respectively, and the scramble LNA inhibitor control's sequence was: 5′- ACGTCTATACGCCCA -3′. [score:5]
Indeed, the concomitant administration of LNAs against miR-1246 and miR-1290 in mice bearing the pre-established tumours could result in a greater inhibition of tumour growth, and suggested the utility of targeting both miRNAs together (Fig. 5f). [score:5]
MT1G, a common target of miR-1246 and miR-1290, inhibits tumour growth and metastasis. [score:5]
Primary tumours that contain high miR-1246 or miR-1290 expression tended to correlate with the detection of metastatic tumour cells within lymph nodes, whereas those expressing low levels of the miRNAs did not (Fig. 3a,b). [score:5]
MT1G is a target of miR-1246 and miR-1290 that inhibit TICs. [score:5]
Using seed sequence base-pairing analyses, we detected the duplex formations between human miR-1246 and miR-1290 with the 3′-untranslated region (UTR) of mRNAs that include MT1G (Fig. 6c), thereby highlighting the propensity of both miRNAs to target a common gene. [score:5]
χ [2]-Analysis in NSCLC tissues showed a strong correlation between the intensity of miR-1246 expression and miR-1290 expression by ISH (P<0.001 by Student's t-test; Supplementary Fig. 2b). [score:5]
Similar to the expression patterns of miR-1246, miR-1290 and CD166, we also observed heterogeneous expression of metallothioneins within human lung tumour sections. [score:5]
A few of the top target genes, such as MT1G and GLIPR1 were, in fact, common targets of both miR-1246 and miR-1290, thus suggesting that they may play an important role in mediating the function of lung cancer cells. [score:5]
Inhibition of either miR-1246 or miR-1290 significantly reduced their respective expression (Fig. 5a). [score:5]
To confirm MT1G as a direct target of miR-1246 and miR-1290, we cloned its wild-type 3′-UTR, as well as made point mutations, and tagged them to a luciferase reporter vector. [score:5]
We next assessed whether the expression of miR-1246 and miR-1290 might be heterogeneous among the tumours of different NSCLC patients, and the implications for disease outcome. [score:5]
For lentiviral overexpression or knockdown of miR-1246 or miR-1290, cells (tumoursphere, A549, NuLi-1 and HEK293) were infected with the lentiviral supernatant for 48 h in the presence of 8 μg ml [−1] polybrene (Sigma). [score:4]
We chose to focus on miR-1246 and miR-1290 because they represent the topmost upregulated miRNAs among our TIC miRNA signature, and could be important drivers for cancer progression. [score:4]
When tumourspheres were transplanted into immune-compromised mice, those bearing knockdown of either miR-1246 or miR-1290 alone markedly inhibited tumour growth (Fig. 2c,d). [score:4]
Finally, the transplantation of these treated cells in limiting cell numbers into NSG mice clearly showed that the TS cells containing MT1G knock down remain tumorigenic even in the presence of miR-1246 or miR-1290 loss, thus confirming MT1G to be their major target (Fig. 6o). [score:4]
The pmiRZip-1246 and pmiRZip-1290 in miRZip-copGFP lentiviral vector (System Biosciences) to stably knockdown miR-1246 or miR-1290 expression was used following the manufacturer's instructions and contained the following shRNA sequence: 5′- AAUGGAUUUUUGGAGCAGG -3′ or 5′- UGGAUUUUUGGAUCAGGGA -3′, respectively. [score:4]
To understand whether LNA targeting miR-1246 or miR-1290 would produce adverse side-effects in mice, we profiled the dynamic changes in albumin levels, as well as alanine aminotransferase (ALT) and aspartate aminotransferase (AST) activities, in mouse serum at different time points following LNA therapy at 8 mg kg [−1]. [score:3]
Group 3 consisted of a single individual (Patient 220), who had stable disease, and no change in the serum levels of miR-1246 or miR-1290 was detected (Fig. 4d). [score:3]
In all, 66.7% (4/6) and 88.3% (5/6) of mice bearing miR-1246- and miR-1290 -overexpressing HEK293 cells, respectively, grew tumours, whereas none of the mice transplanted with control -treated cells formed tumours. [score:3]
Here, we performed a longitudinal survey of circulating miR-1246 and miR-1290 in the same individuals to assess variation in their levels in response to ongoing EGFR tyrosine kinase inhibitor (TKI) treatment, which is a standard of care for NSCLC patients with tumours harbouring mutant EGFR. [score:3]
The outgrowth of tumours in the LNA -treated mice was largely inhibited, whereas control -treated mice continued to form large tumours, thereby indicating the therapeutic utility of silencing miR-1246 and miR-1290 in established tumours (Fig. 5e,f). [score:3]
Because tumours appear to depend on miR-1246 and miR-1290 to progress, we reasoned that the inhibition of these miRNAs might impact their growth. [score:3]
Because our initial evidence suggested that miR-1246 and miR-1290 could be restricted to lung TICs, we first sought to examine their expression patterns within human lung tumours as this serves to provide a clinically relevant context for studying their function. [score:3]
More strikingly, overexpression of either miR-1246 or miR-1290 in non-tumorigenic CD166 [−] cancer cells was able to confer tumorigenic ability, as demonstrated by the formation of tumours when 100,000 cells were transplanted (Fig. 2m). [score:3]
The highly enriched expression of miR-1246 and miR-1290 in lung CD166 [+] TICs, but not in CD166 [−] cells and normal lung epithelial cells, strongly suggests these two miRNAs to be crucial for tumour initiation and establishment. [score:3]
Although miR-1246 and miR-1290 expression are restricted to TICs, it remains unclear whether they are also associated with tumour grades. [score:3]
Both miR-1246 and miR-1290 showed consistent upregulation in tumours compared with their adjacent non-neoplastic tissues (P<0.01 for miR-1246, P<0.01 for miR-1290 by unpaired t-test; Fig. 1e). [score:3]
MiR-1246 and miR-1290 targets prediction. [score:3]
The sequences of the LNA targeting miR-1246 or miR-1290 were fully complementary to the mature miRNA sequence: 5′- TGCTCCAAAAATCCAT -3′ (LNA antimiR-1246) and 5′- CCTGATCCAAAAATCC -3′ (LNA antimiR-1290); the scrambled LNA control was 5′- ACGTCTATACGCCCA -3′ (LNA antimiR-ctrl). [score:3]
Taken altogether, our results demonstrated that miR-1246 and miR-1290 contribute towards lung cancer progression through acting on TIC populations, and more importantly, we provided a proof-of-concept principle that LNA approaches can be used to impact the behaviour of TICs by targeting miRNAs crucial for their function. [score:3]
Heterogeneous expression of miR-1246 and miR-1290 in human NSCLC. [score:3]
How to cite this article: Zhang, W. C. et al. Tumour-initiating cell-specific miR-1246 and miR-1290 expression converge to promote non-small cell lung cancer progression. [score:3]
In human lung cancer patient cohorts, gene set enrichment analysis (GSEA) demonstrated a positive correlation between metastasis incidence and miR-1246 or miR-1290 expression in a variety of patient solid tumours that included lung adenocarcinoma (Supplementary Fig. 5). [score:3]
Consistently, higher miR-1246 or miR-1290 expression in tumours was associated with shorter patient survival periods (P=0.007 and P=0.024 by log-rank test, respectively; Supplementary Fig. 1f,g). [score:3]
More importantly, the comparative expression of other miRNA candidates such as miR-130b, miR-23a and miR-125b, which were initially found to be also enriched in TICs, did not provide strong evidence that they were restricted to tumours, whereas miR-1246 and miR-1290 did (Supplementary Fig. 1e). [score:3]
The pmiR-1246 and pmiR-1290 in pCDH-CMV-MCS-EF1-copGFP (CD511B-1) lentiviral vector (System Biosciences) to stably overexpress miR-1246 or miR-1290 was used following the manufacturer's instructions and contained the following sequence: 5′- AAUGGAUUUUUGGAGCAGG -3′ or 5′- UGGAUUUUUGGAUCAGGGA -3′, respectively. [score:3]
To test this, we utilized highly specific miRZip lentiviral anti-miR-1246 and anti-miR-1290 to knockdown miR-1246 and miR-1290 in lung tumourspheres and assessed their tumorigenic potential in cell cultures and in mice. [score:2]
Using another independent lung cancer patient cohort for which we generated tumourspheres, and also purified for CD166 [+] cells, we indeed confirmed miR-1246 and miR-1290 expression to be elevated more than fivefold in CD166 [+] TICs, and increased 6 and 30 times, respectively, in the corresponding patient-derived tumourspheres when compared with either normal lung epithelial cells or CD166 [−] non-TICs (Fig. 1d). [score:2]
By in situ-hybridization (ISH) assay on tissue microarrays from a cohort of 143 patients (n=197 tumour cores; Fig. 1g), miR-1246 expression negatively correlated with patient survival (P=0.016 by log-rank test), while miR-1290 had a weaker correlation (P=0.082 by log-rank test; Fig. 1h and Supplementary Tables 3 and 4). [score:2]
After 5 weeks, metastatic nodules in the lungs and liver were markedly reduced on knockdown of either miR-1246 or miR-1290 in tumoursphere cells before tail-vein injection (Fig. 3e–j and Supplementary Fig. 4c). [score:2]
Both the migration (Fig. 3c,d) and invasion capabilities (Supplementary Fig. 4a,b) were markedly impaired on knockdown of either miR-1246 (zip1246) or miR-1290 (zip1290), thus suggesting that the miRNAs were necessary for the invasion, at least in vitro. [score:2]
Knocking down either miR-1246 or miR-1290 markedly reduced the tumoursphere-forming ability of TS cells as anticipated (Fig. 6n). [score:2]
To confirm that the loss of miR-1246 or miR-1290 impacted tumour initiation, we transplanted TS cells that were knocked down for either miRNA in limiting dilution cell numbers. [score:2]
However, when tumourspheres bearing either miR-1246 or miR-1290 knockdown were subjected to extended periods of culture in serum-free sphere-forming condition that selects for TICs and stem cells, their numbers were markedly reduced by at least 5.4-fold (Fig. 2a). [score:2]
Conversely, knockdown of miR-1246 or miR-1290 in tumourspheres increased luciferase activity of wild-type MT1G 3′-UTR but not the mutant (Supplementary Fig. 6d). [score:2]
Taken altogether, our results indicate that miR-1246 and miR-1290, which are enriched in TICs, have critical roles in regulating tumour growth and metastasis, in part, through the repression of metallothioneins, especially MT1G. [score:2]
We further sought to examine whether miR-1246 and miR-1290 were indeed directly mediating the metastasis of lung TICs in animal mo dels. [score:2]
For co-localization of miRNA-1246/miR-1290 and CD166 protein in FFPE tissues, the sections were stained with LNA probe by ISH followed by immunohistochemistry with anti-CD166 (Novaocastra). [score:1]
During this response period, serum levels of miR-1246 and miR-1290 reduced by 69–87% and 63–90%, respectively. [score:1]
We first examined the serum levels of miR-1246 and miR-1290 from NSCLC patients and healthy individuals (n=124) by qRT–PCR. [score:1]
To ascertain the impact of anti-miR-1246 and anti-miR-1290 LNA on pre-existing tumours, we first allowed tumours to form (5 mm in length) before treating mice with 8 mg kg [−1] LNA at 3–4-day intervals. [score:1]
In all, 100 ng of wild-type or mutant 3′-UTR reporter constructs of MT1G constructs (GeneCopoeia) were cotransfected with 100 ng of pCDH-miR-1246, pCDH-miR-1290, pmiRZip-1246, pmiRZip-1290 or scrambled control vectors into HEK293 or tumoursphere cells. [score:1]
To test the oncogenic potential of miRNAs in more physiologically relevant cell systems, we introduced either miR-1246 or miR-1290 into immortalized human lung epithelial cells (NuLi-1). [score:1]
Overall, the results suggest that miR-1246 and miR-1290 could contribute towards the metastatic abilities of lung tumour cells. [score:1]
Fold change of miR-1246 and miR-1290 levels is presented as box plot. [score:1]
Using an unbiased approach to uncover TIC-specific miRNAs from patient-derived tumour cells and tumourspheres, we identified a miRNA signature containing two miRNAs, miR-1246 and miR-1290, both of which contribute towards tumour initiation and metastasis. [score:1]
In all, 50 n M of LNA anti-miR-1246, anti-miR-1290 or negative control (Exiqon) with fluorescine and PureFection (System Biosciences) were applied for transfection. [score:1]
MiR-1246- or miR-1290 -binding site 5′- AAATC -3′ was substituted with 5′- TTTAG -3′ in mutated MT1G. [score:1]
After washing, the sections were incubated with 20 n M LNA probes (5′-double-digoxigenin -labelled LNA probes specific for human miR-1246 (5′- cctgctccaaaaatccatt -3′), miR-1290 (5′- tccctgatccaaaaatcca -3′) or scrambled probe (5′- gtgtaacacgtctatacgccca -3′) (Exiqon)) in hybridization buffer (Roche) overnight at 55 °C. [score:1]
Collectively, our data indicated that miR-1246 and miR-1290 play pivotal roles in mediating the spontaneous metastasis of primary tumour cells. [score:1]
To assess their therapeutic utility in a physiologically relevant manner, LNAs against either miR-1246 or miR-1290 were introduced intraperitoneally into NSG mice bearing patient-derived lung tumour xenografts. [score:1]
miR-1246 and miR-1290 contribute towards transformation and lung tumorigenesis. [score:1]
Interestingly, this resulted only in a small decrease in colony numbers, indicating that the loss of miR-1246 and miR-1290 did not impact cell growth and proliferation under these cell culture conditions (Supplementary Fig. 3a–d). [score:1]
The LNA, however, completely abrogated tumour-initiation when 100 cells were transplanted, thereby demonstrating the in vivo impact of blocking miR-1246 and miR-1290 on tumour initiation (Fig. 5d). [score:1]
Genes repressed by miR-1246 include PRL36A, GLIPR1, HAS2, NCKAP5, MT1G and CYP4F11, whereas miR-1290 represses MT1G, MT1H, GLIPR1, CYP4F11 and NCKAP5, among others. [score:1]
Interestingly, in mice bearing xenografted tumours that were treated with anti-miR-1246 or anti-miR-1290 LNAs (Fig. 5e), these small residual tumours had increased metallothionein protein level (Supplementary Fig. 7e). [score:1]
On co-transfection of either miR-1246 or miR-1290 together with wild-type MT1G 3′-UTR reporters into HEK293 cells, the luciferase activities were reduced significantly (Fig. 6e). [score:1]
The median value of serum miR-1246 or miR-1290 levels in healthy individuals was normalized to 1. Data are represented as mean±s. [score:1]
Exogenous introduction of either miR-1246 or miR-1290 into immortalized human embryonic kidney cells (HEK293) modestly increased proliferation and colony formation in vitro (Fig. 2f–h and Supplementary Fig. 3e), but surprisingly, was able to confer on these otherwise non-tumorigenic cells and their tumorigenic potential, as gauged by the ability of the miRNA-bearing cells to form tumours efficiently (Fig. 2i). [score:1]
The metastatic ability of lung TICs is dependent on miR-1246 and miR-1290. [score:1]
Because lung TICs and cancer progression were dependent on miR-1246 or miR-1290, we assessed whether these miRNAs could confer tumorigenic potential to otherwise normal-like or non-tumorigenic cells. [score:1]
This led us to wonder whether miR-1246 and miR-1290 could confer metastatic traits to lung tumour cells. [score:1]
LNA (8 mg kg [−1]) against either miR-1246 or miR-1290 was administered at the same time as lung TIC implantation (1 × 10 [5] cells). [score:1]
Nonetheless, our observations indicate miR-1246 and miR-1290 can behave as non-invasive biomarkers that may be exploited for the early detection of a broad spectrum of cancers (Supplementary Fig. 10). [score:1]
The concomitant depletion of MT1G in miR-1246- or miR-1290 -depleted cells could, at least in part, rescue the effect of miRNA loss. [score:1]
Of note, for the vast majority of patients in all four groups, serum levels of miR-1246 and miR-1290 showed a positive correlation with tumour size as well (Fig. 4b,c,e). [score:1]
MiR-1246 and miR-1290 confer tumorigenicity. [score:1]
The median values for miR-1246 and miR-1290 levels in normal tissues were normalized as 1; n=11. [score:1]
Concomitant increases in the serum miR-1246 and miR-1290 could be detected, thus suggesting their levels to be indicative of the patients' response to therapy. [score:1]
As an example, Patient 218 progressed on EGFR TKI as tumour grew by 41% on day 86; this was mirrored by increases in miR-1246 and miR-1290 levels. [score:1]
In this example, the levels of miR-1246 appeared to better mirror the response of patient to therapy than that of miR-1290. [score:1]
MiR-1246 and miR-1290 are required for lung cancer metastasis. [score:1]
Taqman miRNA probes were as follow: hsa-miR-1246 (462575_mat), hsa-miR-1290 (002863), hsa-miR-130a (000454), hsa-miR-130b (000456), hsa-miR-196a (241070_mat), hsa-miR-196b (002215), hsa-miR-630 (001563), hsa-let-7b-5p (002619), hsa-let-7c (000379), hsa-let-7d-5p (002283), hsa-let-7i (002221), hsa-miR-106b (000442), hsa-miR-125b (000449), hsa-miR-23a (000399), hsa-miR-25 (000403), hsa-miR-320c (241053_mat), hsa-miR-3667-5p (462350_mat), hsa-513-5p (002090), hsa-miR-9* (002231). [score:1]
MiR-1246, miR-1290 or metallothionein staining was independently scored by two anatomical pathologists (M. E. N and Y. H. P). [score:1]
We first evaluated the utility of LNA against miR-1246 or miR-1290 in cell cultures by transfecting them into lung TICs expressing high levels of both miRNAs. [score:1]
[1 to 20 of 96 sentences]
2
[+] score: 35
Of note, qRT-PCR illustrated that the expression of 4 miRNAs were up-regulated over 5 folds, including miR-630, miR-1246, miR-1290 and miR-3138. [score:6]
To find out whether radiation could regulate the expression of this specific miRNA signature, we first analyzed the expression of miR-630, miR-1246, miR-1290 and miR-3138 by qRT-PCR in human cervical cancer Hela cells after radiation at a dose of 6 Gy. [score:6]
The present study also demonstrated that overexpression of the specific miRNA signature (miR-630, miR-1246, miR-1290 and miR-3138) by transfection with its mimics respectively could enhance the radioresistance in cervical cancer cells, and that suppression of miR-630, delegate of the specific miRNA signature, attenuates the radioresistance in cervical cancer cells. [score:5]
Up-regulation of microRNA-1290 impairs cytokinesis and affects the reprogramming of colon cancer cells [37]. [score:4]
In the present study, 4 miRNAs (miR-630, miR-1246, miR-1290 and miR-3138) showing more than 5 folds of expression changes were selected for further analysis. [score:3]
The mimics and inhibitors specific for miR-630, miR-1246, miR-1290 and miR-3138 were obtained from Ambion (Grand Island, NY). [score:3]
The present study reveals positive roles of miR-630, miR-1246, miR-1290 and miR-3138 in radioresistance of cervical cancer cells, supporting regulatory roles of miRNAs in radioresistance. [score:2]
To investigate whether the specific miRNA signature is involved in the development of radioresistance of cervical cancer cells, we used Hela cells transfected with the mimics specific for the 4 miRNAs, which respectively express relatively higher miR-630, miR-1246, miR-1290 and miR-3138 than negative control cells (data not shown). [score:2]
The present study indicated that miRNA is involved in radioresistance of human cervical cancer cells and that a specific miRNA signature consisting of miR-630, miR-1246, miR-1290 and miR-3138 could promote radioresistance of cervical cancer cells. [score:1]
Our present data indicated that a specific miRNA signature including miR-630, miR-1246, miR-1290 and miR-3138 could promote radioresistance of human cervical cancer cells. [score:1]
The radiation -induced miRNAs (miR-630, miR-1246, miR-1290 and miR-3138) in cervical cancer cells are not included in the miRNA profiles of M059 and TK6, supporting the speculation that the modulation of miRNA is dependent on cell type, radiation dose and dose rate [30]. [score:1]
A miRNA signature consisting of 4 miRNAs (miR-630, miR-1246, miR-1290 and miR-3138) exhibited more than 5 folds of increase in radioresistant cells. [score:1]
[1 to 20 of 12 sentences]
3
[+] score: 27
Except for miR-3142 and miR-1290, whose expressions were up-regulated, all other miRNAs were down-regulated after treatment with sorafenib. [score:9]
In our study, using microarray analyses in two different cell lines, we identified and confirmed two differentially expressed human miRNAs (hsa-miR-597 and hsa-miR-720) in HRT-18 and identified nine differentially expressed human miRNAs (hsa-miR-3142, hsa-miR-20a, hsa-miR-4301, hsa-miR-1290, hsa-miR-4286, hsa-miR-3182, hsa-miR-3142, hsa-miR-1246 and hsa-miR-720) in Caco-2 cells. [score:5]
This indicates that miR-1290 is up-regulated in NSCLC and may be used as a potential prognostic biomarker [38]. [score:4]
Higher expression levels of miR-1290 were positively correlated with high tumor stage and positive lymph node metastasis in non-small cell lung cancer (NSCLC). [score:3]
With the exception of miR-767-3p, which was not detectable by RT-qPCR, we could confirm the regulation of all the other miRNAs detected by the microarray (miR-597, miR-720, miR-3182, miR-20a, miR-4301, miR-3142, miR-4286 and miR-1290). [score:2]
In the Caco-2 cell line, we identified two human miRNAs (hsa-miR-3142 and hsa-miR-20a) and eight human miRNAs (hsa-miR-4301, hsa-miR-1290, hsa-miR-4286, hsa-miR-3182, hsa-miR-3142, hsa-miR-1246 and hsa-miR-720) after 12 and 24 h, respectively (p < 0.05, Figure 4C,D). [score:1]
The nine miRNAs were miR-767-3p, miR-597, miR-720, miR-3182, miR-20a, miR-4301, miR-3142, miR-4286 and miR-1290. [score:1]
Additionally, miR-1290 is also involved in LSCC (laryngeal squamous cell carcinoma) pathogenesis and cervical cancer [39, 40]. [score:1]
Mo D. Gu B. Gong X. Wu L. Wang H. Jiang Y. Zhang B. Zhang M. Zhang Y. Xu J. miR-1290 is a potential prognostic biomarker in non-small cell lung cancer J. Thorac. [score:1]
[1 to 20 of 9 sentences]
4
[+] score: 18
We found that miR-432, miR-1286, miR-641, miR-1290, miR-1287 and miR-95 were highly upregulated just in cells with HPV infection upon 5-AZA treatment, whereas miR-625 was significantly downregulated (P<0.05) (Figure  3). [score:7]
Up-regulation of microRNA-1290 impairs cytokinesis and affects the reprogramming of colon cancer cells (Wu J, et al., [17]). [score:4]
Following in vitro photodynamic treatment, miR-1290 was overexpressed in human epidermoid carcinoma cells (A431) (Bach D, et al., [16]). [score:3]
Researches on miR-1290 have been referred on tumor therapy. [score:1]
MiR-432, miR-1286, miR-641, miR-1290, miR-1287 and miR-95 were found up-modulated in Caski, Hela and Siha but not in C33A induced on treatment, while miR-625 was down-modulated. [score:1]
We found hypermethylation of miR-432, miR-1286, miR-641, miR-1290, miR-1287 and miR-95 may have some relationship with HPV infection in cervical cell lines. [score:1]
In light of these reports and our results, we proposed miR-1290 -based therapeutic approaches could be developed in future. [score:1]
[1 to 20 of 7 sentences]
5
[+] score: 14
Probes-1246 and -1290 correspond to miR-1246 and miR-1290 sequences respectively, while CPHD-6235 is longer covering 10 nt upstream of miR-U2-1. Because miR-1246 and miR-1290 cross-map to miR-U2-1, the signal detected by their respective probes corresponds exclusively to hybridization with miR-U2-1. The probe CPHD-6235 also hybridizes exclusively to miR-U2-1. The analysis of the 8 matched samples reveals a very similar expression profile for the three probes, and a significant over -expression (>3 fold) of miR-U2 is observed in the primary tumors relative to the adjacent normal tissue for seven of eight patients (Fig. 4b). [score:5]
Using this method, the fold changes for the 11 primary tumors for which matched adjacent normal tissue was not available showed an over -expression (>x2) in 12 individuals out of 19 (i. e. 63%) with probes corresponding to miR-1290 and miR-1246 sequences, and 14 individuals (i. e. 74%) with the probe CPHD-6235. [score:3]
We conclude from these data that all results related to miR-1246 and miR-1290 can be assigned to miR-U2. [score:1]
Table S2 Evidence that miR-1290 is a cross-mapping error. [score:1]
Regarding miR-1290 there are two possible genomic locations that could encode it (Fig. S3), however, in our experiments it is detected at the same level as the background noise associated with sequencing errors (Table S2). [score:1]
Mapping reads from our five short libraries to the respective precursors of these two microRNAs [45] revealed unambiguously that the two putative precursors of miR-1246 and miR-1290 are the result of false-mapping. [score:1]
Similarly, two short microRNAs (19 nt), miR-1246 and miR-1290, match miR-U2-1 with 100% identity and one mismatch respectively [44]. [score:1]
Figure S3 miR-1290 is potentially encoded at two locations along the human genome. [score:1]
[1 to 20 of 8 sentences]
6
[+] score: 14
miRNA changes in response to H. pylori infection are summarized in Table 1. miR-584 and miR-1290 expression are upregulated in CagA-transformed cells. [score:6]
The miR-584 and miR-1290 target is Foxa1, and knockdown of Foxa1 promotes the epithelial-mesenchymal transition (EMT). [score:4]
Overexpression of miR-584 and miR-1290 induces intestinal metaplasia of gastric epithelial cells. [score:3]
These results indicate that miR-584 and miR-1290 interfere with cell differentiation and lead to remo deling of the gastric mucosal tissues [10]. [score:1]
[1 to 20 of 4 sentences]
7
[+] score: 13
Our results showed that levels of miRNA/mRNA pairs: miR-451/ TLR4, miR-4793-3p/ TLR4, miR-132/ HBEGF, miR-1290/ THBS1, miR-132/ CD44, miR-223/ ICAM1, miR-132/ MMP9, miR-146-3p/ GNA11 and miR-146-3p/ MYLK were significantly correlated in an inverse manner in NEC tissues, whereas miR-410/ FLT-1 was directly correlated (Fig 2). [score:2]
A proposed network of dysregulated miRNA/mRNA pairs in NEC suggested interaction at bacterial receptor TLR4 (miR-31, miR-451, miR-203, miR-4793-3p), mediated via key transcription factors NFKB2 (miR-203), AP-1 /FOSL1 (miR-194-3p), FOXA1 (miR-21-3p, miR-431 and miR-1290) and HIF1A (miR-31), and extended downstream to pathways of angiogenesis, arginine metabolism, cell adhesion and chemotaxis, extracellular matrix remo deling, hypoxia/oxidative stress, inflammation and muscle contraction. [score:2]
Our results also revealed a group of dysregulated miRNAs, including miR-1290, miR-431, and miR-200a that might interfere with cell proliferation and differentiation (S3 Table), indicating responses that could lead to tissue injury and attempted repair. [score:2]
More importantly, other dysregulated miRNAs observed in our study, such as miR-451, miR-1290, miR-4725-3p, miR-4793-3p, miR-431 and miR-203, have not been previously reported in other inflammatory intestinal conditions. [score:2]
Some dysregulated miRNAs such as miR-1290, miR-146b-3p, miR-31, miR-375 and miR-200a have established GI functions (S3 Table). [score:2]
Yet, their levels were inversely correlated within same NEC samples such as miR-451/ TLR4 (receptor), miR-4793-3p/ TLR4 (receptor), miR-132/ HBEGF (angiogenesis), miR-1290/ THBS1 (angiogenesis), miR-132/ CD44 (adhesion/chemotaxis) and miR-132/ MMP9 (ECM remo deling). [score:1]
Interestingly, we identified miRNAs that could exhibit multiple interacting points at the upstream receptor and transcription factors as well as downstream effector genes e. g., miR-31 (TLR4, HIF1A, HBEGF), miR-194-3p (AP-1 /FOSL1, MMP9, TIMP1), miR-203 (TLR4, NFKB2, HBEGF, IL8, TNF, PTGS2), miR-1290 (FOXA1, THBS1) and miR-200b-5p (SOD2, FLT1). [score:1]
Levels of 15 miRNAs: miR-223, miR-1290, miR-4725-3p, miR-4793-3p, miR-410, miR-187, miR-375, miR-203, miR-200b-5p, miR-194-3p, miR-200a, miR-215, miR-31, miR-192-3p and miR-141 were significantly different between NEC and SIP tissues (0.12–59.05 fold; Table 2). [score:1]
[1 to 20 of 8 sentences]
8
[+] score: 13
Seven over-expressed microRNAs that were altered at least four fold, including hsa-miR-671-5p, hsa-miR-542-5p, hsa-miR-542-3p, hsa-miR-1185, hsa-miR-539, hsa-miR-148a and hsa-miR-301a, (Figure 4A) and six over-expressed microRNAs that were highly expressed (normalized data ≥6), including hsa-miR-1290, hsa-miR-136, hsa-miR-424, hsa-miR-30a, hsa-miR-148a and hsa-miR-1246 (Figure 4B), were selected for further qRT-PCR analyses. [score:7]
miR-1290 and miR-1246 were enriched in L02 and HepG2 cells, and their expression in hUC-MSC was gradually increased after induction to a level that was similar to that observed in L02 cells. [score:3]
The qRT-PCR results demonstrated that the expression patterns of hsa-miR-542-5p, hsa-miR-542-3p, hsa-miR-148a, hsa-miR-1290, hsa-miR-424, hsa-miR-30a and hsa-miR-1246 were consistent with the microarray results (Figure 4C). [score:3]
[1 to 20 of 3 sentences]
9
[+] score: 12
To further validate the miRNA microarray results, 5 out of the most obvious up-regulated miRNAs (miR-6723-5p, miR-1285-3p, miR-619-5p, miR-1290 and miR-1273a) and 5 out of the most obvious down-regulated miRNAs (miR-98, miR-7846-3p, miR-668-5p, miR-4738-3p and miR-4654) were selected to determine their relative expression levels on hypertrophic scar tissues to verify the effect of chips. [score:9]
showed that relative expression values of miR-6723-5p, miR-1285-3p, miR-619-5p, miR-1290 and miR-1273a were above 0 and that relative levels of miR-98, miR-7846-3p, miR-668-5p, miR-4738-3p and miR-4654 were below 0 (Fig.   1b). [score:3]
[1 to 20 of 2 sentences]
10
[+] score: 11
Other miRNAs from this paper: hsa-mir-602
Mir-1290 was the most downregulated miRNA and targets SLC1A2 (aging), APC and COL8A1 (skin development), NOTCH1 and BMI1 (apoptosis), and ROBO1, CDC27 (cell proliferation). [score:7]
For example, miR-602 is putatively involved in regulating MAPK and insulin signaling pathways; however, miR-1290 is involved in cancer, focal adhesion, and insulin signaling pathways. [score:2]
The most dysregulated miRNAs were miR-602 (5.74-fold increase) and miR-1290 (5.80-fold decrease). [score:2]
[1 to 20 of 3 sentences]
11
[+] score: 10
control Expression in case group 1 hsa-mir-1290 0.26 down 2 hsa-mir-342-5p 0.22 down 3 hsa-mir-1224-5p 0.23 down 4 hsa-mir-345 0.38 down 5 hsa-mir-1228 0.38 down 6 hsa-mir-1249 0.32 down 7 hsa-mir-1826 0.26 down 8 hsa-miR-1306 0.38 down 9 hsa-miR-188-5p 0.43 down 10 hsa-miR-320a 0.48 down 11 hsa-miR-320c 0.26 down 12 hsa-miR-365 0.31 down 13 hsa-miR-423-5p 0.35 down 14 hsa-miR-483-5p 0.25 down 15 hsa-miR-634 0.31 down 16 hsa-miR-671-5p 0.23 down 17 hsa-miR-939 0.24 down 18 hsa-miR-1246 2.22 up 19 hsa-miR-150 10.41 up 20 hsa-miR-574-5p 8.04 up Table 3 MiRNAs Target Gene Symbol hsa-miR-345PUM2, PPP2R3A, BCAT1, ZFHX4, CHSY3, ARNT, SHE, SLC7A5, SOS1,. [score:5]
control Expression in case group 1 hsa-mir-1290 0.26 down 2 hsa-mir-342-5p 0.22 down 3 hsa-mir-1224-5p 0.23 down 4 hsa-mir-345 0.38 down 5 hsa-mir-1228 0.38 down 6 hsa-mir-1249 0.32 down 7 hsa-mir-1826 0.26 down 8 hsa-miR-1306 0.38 down 9 hsa-miR-188-5p 0.43 down 10 hsa-miR-320a 0.48 down 11 hsa-miR-320c 0.26 down 12 hsa-miR-365 0.31 down 13 hsa-miR-423-5p 0.35 down 14 hsa-miR-483-5p 0.25 down 15 hsa-miR-634 0.31 down 16 hsa-miR-671-5p 0.23 down 17 hsa-miR-939 0.24 down 18 hsa-miR-1246 2.22 up 19 hsa-miR-150 10.41 up 20 hsa-miR-574-5p 8.04 up Table 3 MiRNAs Target Gene Symbol hsa-miR-345PUM2, PPP2R3A, BCAT1, ZFHX4, CHSY3, ARNT, SHE, SLC7A5, SOS1,. [score:5]
[1 to 20 of 2 sentences]
12
[+] score: 10
Zhu et al. demonstrated upregulation of miRNA-584 and miRNA-1290 in CagA-transformed cells and overexpression of both miRNAs induced intestinal metaplasia of gastric epithelial cells in knock-in mice (86). [score:7]
These findings support a possible role of miRNA-584 and miRNA-1290 in deregulating cell differentiation and in promoting cancer through EMT. [score:2]
Interestingly, CagA -induced miRNA-584 and miRNA-1290 promote EMT through Foxa1, a critical factor in epithelial cell differentiation. [score:1]
[1 to 20 of 3 sentences]
13
[+] score: 8
In 38 upregulated miRNAs, the fold change in miR-1290 expression in tumor tissues was the highest (17.7-fold), and the expressions of miR-362-5p, -367, -593, -545, -524-5p, -1246, -96, -224, -450a, -7, and -203 were greater than 5-fold (Table S4). [score:8]
[1 to 20 of 1 sentences]
14
[+] score: 7
The expression profile of infected and uninfected cells was evaluated using a miRNA microarray, and 16 miRNAs were reported to be up-regulated (miR-4290, miR-4279, miR-625*, miR-let-7e, miR-1290, miR-33a, miR-3686, miR-378, miR-1246, miR-767-5p, miR-320c, miR-720, miR-491-3p, miR-3647, miR-451 and miR-4286) and 4 down-regulated (miR-106b, miR-20a, miR-30b and miR-3653) during dengue infection. [score:7]
[1 to 20 of 1 sentences]
15
[+] score: 7
The top 8 downregulated (hsa-miR-200c, hsa-miR-212, hsa-miR-29a, hsa-miR-532, hsa-miR-141, hsa-miR-1, hsa-miR-363, hsa-miR-187) and 8 upregulated (hsa-miR-487, hsa-miR-452, hsa-miR-1233, hsa-miR-92a, hsa-miR-106b, hsa-miR-1290, hsa-miR-320, hsa-miR-26a) miRNAs were presented in Figure 1A. [score:7]
[1 to 20 of 1 sentences]
16
[+] score: 7
By comparing the miRNA expression profiles of cells productively or latently infected by HIV-1, Wang et al. [224] identified two cellular miRNAs- miR-196b and miR-1290, that were relatively upregulated in latently infected cells. [score:6]
Based on these results, the authors proposed that miR-196b and miR-1290 may contribute to HIV-1 latency. [score:1]
[1 to 20 of 2 sentences]
17
[+] score: 7
While miR-1290 and miR-572 were found to be upregulated, miR-125a-3p, miR-134, miR-584-5p, miR-663a, and miR-513a-5p were determined to be downregulated in various types of cancer [48– 64]. [score:7]
[1 to 20 of 1 sentences]
18
[+] score: 6
Thirteen miRNAs were overexpressed in exosomes from bulk cells: hsa-miR-218-5p, hsa-miR-7-5p, hsa-miR-1290, hsa-miR-17-5p, hsa-miR-20a-5p, hsa-miR-503-5p, hsa-miR-30c-5p, hsa-miR-125b-1, hsa-miR-21-5p, hsa-miR-93-5p, hsa-miR-378c, hsa-miR-378d and hsa-miR-25-3p (Table 2). [score:3]
Previous studies that have analyzed circulating miRNAs as potential candidates for PCa biomarkers identified miRNAs differentially expressed in bulk cell exosomes in our study, in particular mir-21-5p [52- 54], miR-378c [55], miR-1290 [56], miR-20a [54, 57], miR-125b [58], miR-93-5p [59]. [score:3]
[1 to 20 of 2 sentences]
19
[+] score: 6
In contrast, hsa-miR-221-3p, hsa-miR-409-5p, hsa-miR-1290, hsa-miR-155-5p, hsa-miR-31-3p, hsa-miR-7-5p, hsa-miR-362-5p, hsa-miR-493-5p, hsa-miR-296-5p, and hsa-miR-199b-5p were statistically downregulated in human Sertoli cells of SCOS patients compared to OA patients (Figure 3B). [score:3]
B. Real-time PCR further revealed that human miR-221-3p, miR-409-5p, miR-1290, miR-155-5p, miR-31-3p, miR-7-5p, miR-362-5p, miR-493-5p, miR-296-5p, and miR-199b-5p were statistically expressed at lower levels in Sertoli cells of SCOS patients than Sertoli cells of OA patients. [score:3]
[1 to 20 of 2 sentences]
20
[+] score: 5
In our profiling data we found important miRs, already reported to be of relevance in disease biology, [17, 18, 35] to be equally abundant in cells and exosomes while other miRs such as miR-202-3p, miR-628-3p, and miR-1290 were specifically enriched in exosomes. [score:3]
Importantly, miR-1290, miR-628-3p, and miR-202-3p were enriched within the exosomal RNA (Fig 4A). [score:1]
However, we found that certain candidate miRs are specifically enriched or counter-selected in exosomes including miR-202-3p, miR-1290, and miR-628-3p but are less abundant in the parental cells (Fig 4A). [score:1]
[1 to 20 of 3 sentences]
21
[+] score: 5
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-23a, hsa-mir-25, hsa-mir-26a-1, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-96, hsa-mir-99a, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-16-2, hsa-mir-198, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-204, hsa-mir-210, hsa-mir-212, hsa-mir-181a-1, hsa-mir-214, hsa-mir-215, hsa-mir-216a, hsa-mir-217, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-27b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-132, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-142, hsa-mir-145, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-134, hsa-mir-146a, hsa-mir-150, hsa-mir-186, hsa-mir-188, hsa-mir-193a, hsa-mir-194-1, hsa-mir-320a, hsa-mir-155, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-194-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-99b, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-362, hsa-mir-369, hsa-mir-375, hsa-mir-378a, hsa-mir-382, hsa-mir-340, hsa-mir-328, hsa-mir-342, hsa-mir-151a, hsa-mir-148b, hsa-mir-331, hsa-mir-339, hsa-mir-335, hsa-mir-345, hsa-mir-196b, hsa-mir-424, hsa-mir-425, hsa-mir-20b, hsa-mir-451a, hsa-mir-409, hsa-mir-484, hsa-mir-486-1, hsa-mir-487a, hsa-mir-511, hsa-mir-146b, hsa-mir-496, hsa-mir-181d, hsa-mir-523, hsa-mir-518d, hsa-mir-499a, hsa-mir-501, hsa-mir-532, hsa-mir-487b, hsa-mir-551a, hsa-mir-92b, hsa-mir-572, hsa-mir-580, hsa-mir-550a-1, hsa-mir-550a-2, hsa-mir-590, hsa-mir-599, hsa-mir-612, hsa-mir-624, hsa-mir-625, hsa-mir-627, hsa-mir-629, hsa-mir-33b, hsa-mir-633, hsa-mir-638, hsa-mir-644a, hsa-mir-650, hsa-mir-548d-1, hsa-mir-449b, hsa-mir-550a-3, hsa-mir-151b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-454, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-708, hsa-mir-216b, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-378b, hsa-mir-3151, hsa-mir-320e, hsa-mir-378c, hsa-mir-550b-1, hsa-mir-550b-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-219b, hsa-mir-203b, hsa-mir-451b, hsa-mir-499b, hsa-mir-378j, hsa-mir-486-2
Low expression of miR-151-5p and miR-451, and high expression of miR-1290 or a combination of all three, predicted inferior relapse-free survival (RFS) in pediatric B-ALL [74]. [score:5]
[1 to 20 of 1 sentences]
22
[+] score: 5
After a long follow-up, mice over expressing hsa-miR-584 and hsa-miR-1290 showed changes associated with gastric intestinal metaplasia including the appearance of colonic epithelium and colonic markers (Muc-2; Zhu et al., 2012), suggesting a role of these two miRNA in the development of more advanced gastric lesions. [score:4]
Interestingly, using an in vitro system, it was shown that CagA induces hsa-miR-584 and hsa-miR-1290 in a NFκβ and Erk 1/2 dependent manner, respectively (Zhu et al., 2012). [score:1]
[1 to 20 of 2 sentences]
23
[+] score: 4
Table 7 showed serum PICP at total time points were significantly associated with miR-363 (r = −0.3347 p < 0.05), miR-1290 (r = −0.2908, p < 0.05), miR-103 (r = −0.2739, p < 0.05), miR-451a (r = −0.3204, p < 0.05), miR-130a (r = −0.3402, p < 0.05), miR-1234 (r = −0.2396, p < 0.05), and miR-20a (r = −0.3148, p < 0.05), respectively. [score:1]
miR-451a, miR-363, miR-1290, miR-363, miR-151-5p, and miR-151-3p had an optimal area value under the curve >0.85, indicating that these circulating miRNAs levels might be useful biological markers for assessing the risk of bed rest or simulated microgravity. [score:1]
In addition, significant correlations were found for miR-1290 (r = −0.2706, p < 0.05), miR-130a (r = −0.2984, p < 0.05), and miR-1234 (r = −0.3545, p < 0.05) with total serum BALP of individuals at total time points respectively. [score:1]
The AUC of remaining eight miRNAs was 0.8929 for miR-1290 (95% CI 0.7736–1.012, p = 0.00069), 0.8896 for miR-363 (95% CI 0.7514–1.028, p = 0.0010), 0.8799 for miR-20a (95% CI 0.7171–1.043, p = 0.0014), 0.8701 for miR-151-5p (95% CI 0.7223–1.018, p = 0.0018), 0.8571 for miR-151-3p (95% CI 0.6948–1.019, p = 0.0026), 0.8036 for miR-103 (95% CI 0.6089–0.9983, p = 0.0087), 0.7532 for miR-199a-3p (95% CI 0.5381–0.9684, p = 0.033), and 0.6788 for miR-148a (95% CI 0.4504–0.9067, p = 0. 12). [score:1]
[1 to 20 of 4 sentences]
24
[+] score: 4
Twelve miRNAs (hsa-miR-130b, hsa-miR-203, hsa-miR-1974, hsa-miR-592, hsa-miR-200a, hsa-miR-429, hsa-miR-183, hsa-miR-182, hsa-miR-1290, hsa-miR-141, hsa-miR-135b, and hsa-miR-96) were overexpressed, whereas 84 miRNAs (hsa-miR-1, hsa-miR-145, hsa-miR-145*, and so on) were downexpressed in tumor tissues compared with those in normal tissues. [score:4]
[1 to 20 of 1 sentences]
25
[+] score: 4
Other miRNAs from this paper: hsa-mir-29a, hsa-mir-101-1, hsa-mir-139, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-142, hsa-mir-144, hsa-mir-127, hsa-mir-154, hsa-mir-185, hsa-mir-195, hsa-mir-29c, hsa-mir-101-2, hsa-mir-380, hsa-mir-381, hsa-mir-323a, hsa-mir-520e, hsa-mir-520a, hsa-mir-518c, hsa-mir-520d, hsa-mir-518a-1, hsa-mir-518d, hsa-mir-518a-2, hsa-mir-519a-1, hsa-mir-519a-2, hsa-mir-513a-1, hsa-mir-513a-2, hsa-mir-509-1, hsa-mir-576, hsa-mir-548a-1, hsa-mir-586, hsa-mir-548b, hsa-mir-548a-2, hsa-mir-599, hsa-mir-548a-3, hsa-mir-607, hsa-mir-613, hsa-mir-548c, hsa-mir-625, hsa-mir-634, hsa-mir-642a, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-656, hsa-mir-509-2, hsa-mir-509-3, hsa-mir-1208, hsa-mir-548e, hsa-mir-548j, hsa-mir-548k, hsa-mir-548l, hsa-mir-548f-1, hsa-mir-548f-2, hsa-mir-548f-3, hsa-mir-548f-4, hsa-mir-548f-5, hsa-mir-1247, hsa-mir-548g, hsa-mir-548n, hsa-mir-548m, hsa-mir-548o, hsa-mir-548h-1, hsa-mir-548h-2, hsa-mir-548h-3, hsa-mir-548h-4, hsa-mir-548p, hsa-mir-548i-1, hsa-mir-548i-2, hsa-mir-548i-3, hsa-mir-548i-4, hsa-mir-1324, hsa-mir-1825, hsa-mir-548q, hsa-mir-548s, hsa-mir-548t, hsa-mir-548u, hsa-mir-548v, hsa-mir-323b, hsa-mir-548w, hsa-mir-548x, hsa-mir-548y, hsa-mir-642b, hsa-mir-548z, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548o-2, hsa-mir-548h-5, hsa-mir-548ab, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548x-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-548am, hsa-mir-548an, hsa-mir-548ao, hsa-mir-548ap, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, hsa-mir-548ay, hsa-mir-548az, hsa-mir-548ba, hsa-mir-548bb, hsa-mir-548bc
Indeed, although CTNNA2 can be regulated by primate-specific miRNAs common to both monkeys and humans (miR-513a-3p, miR-518a-5p, miR-548a-5p, miR-576-5p, miR-586, miR-607, miR-625, miR-642), a number of miRNAs present in Homo sapiens but not in Macaca mulatta (miR-1208, miR-1247, miR-1290, miR-1324, miR-1825, miR-613 and miR-634) also target CTNNA2 [19], [29]. [score:4]
[1 to 20 of 1 sentences]
26
[+] score: 4
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7e, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-27a, hsa-mir-30a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-99a, hsa-mir-100, hsa-mir-101-1, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-106a, hsa-mir-16-2, hsa-mir-192, hsa-mir-196a-1, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-10a, hsa-mir-196a-2, hsa-mir-199a-2, hsa-mir-203a, hsa-mir-215, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-200b, hsa-mir-1-2, hsa-mir-15b, hsa-mir-27b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-141, hsa-mir-143, hsa-mir-145, hsa-mir-152, hsa-mir-191, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-146a, hsa-mir-150, hsa-mir-185, hsa-mir-194-1, hsa-mir-195, hsa-mir-320a, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-128-2, hsa-mir-194-2, hsa-mir-200a, hsa-mir-101-2, hsa-mir-130b, hsa-mir-302c, hsa-mir-375, hsa-mir-378a, hsa-mir-148b, hsa-mir-324, hsa-mir-451a, hsa-mir-483, hsa-mir-484, hsa-mir-486-1, hsa-mir-500a, hsa-mir-92b, hsa-mir-595, hsa-mir-596, hsa-mir-421, hsa-mir-378d-2, hsa-mir-744, hsa-mir-885, hsa-mir-939, hsa-mir-940, hsa-mir-1229, hsa-mir-1233-1, hsa-mir-1246, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-718, hsa-mir-378b, hsa-mir-378c, hsa-mir-4306, hsa-mir-4286, hsa-mir-500b, hsa-mir-1233-2, hsa-mir-3935, hsa-mir-642b, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-3976, hsa-mir-4644, hsa-mir-203b, hsa-mir-451b, hsa-mir-378j, hsa-mir-486-2
Li A. Yu J. Kim H. Wolfgang C. L. Canto M. I. Hruban R. H. Goggins M. MicroRNA array analysis finds elevated serum miR-1290 accurately distinguishes patients with low-stage pancreatic cancer from healthy and disease controls Clin. [score:3]
Li et al. demonstrated that serum miR-1290 levels distinguished patients with low-stage PCa from controls better than CA19-9 levels; higher miR-1290 levels predicted poorer outcomes among patients undergoing pancreaticoduodenectomy, and the detection of elevated circulating miR-1290 has the potential to improve the early detection of PCa [68]. [score:1]
[1 to 20 of 2 sentences]
27
[+] score: 4
Remarkably, we also observed that the target genes (IGF1R, FZD4, USP9X, SLC2A10, TK2, STARD13, F8A1 and IL17RD) and has-miR-1290 sets of this module were implicated in the reproductive process and regulated the signal transduction pathways and molecular functions that reflected the defects in spermatogenesis. [score:4]
[1 to 20 of 1 sentences]
28
[+] score: 3
Zhang WC Tumour-initiating cell-specific miR-1246 and miR-1290 expression converge to promote non-small cell lung cancer progressionNat. [score:3]
[1 to 20 of 1 sentences]
29
[+] score: 3
Zhang WC Tumour-initiating cell-specific miR-1246 and miR-1290 expression converge to promote non-small cell lung cancer progressionNat. [score:3]
[1 to 20 of 1 sentences]
30
[+] score: 3
Li et al. reported that miR-1290 promoted cell proliferation and metastasis through inhibiting SCAI in esophageal squamous cell carcinoma [35]. [score:3]
[1 to 20 of 1 sentences]
31
[+] score: 3
Zhang W. C. Chin T. M. Yang H. Nga M. E. Lunny D. P. Lim E. K. Sun L. L. Pang Y. H. Leow Y. N. Malusay S. R. Tumour-initiating cell-specific mir-1246 and mir-1290 expression converge to promote non-small cell lung cancer progressionNat. [score:3]
[1 to 20 of 1 sentences]
32
[+] score: 3
13 (1552.97) 2878.75 (896.93) 1.40 miRPlus-C1110 312.42 (62.17) 224.99 (50.54) 1.39 miRPlus-E1258 86.75 (20.49) 64.07 (11.77) 1.35 miR-720 340.15 (119.55) 252.95 (74.57) 1.34 miR-1290 171.55 (50.99) 128.19 (32.76) 1.34 SNORD13 513.58 (204.28) 384.05 (88.93) 1.34 Underexpressed RNAs miR-144 143.57 (72.96) 267. [score:3]
[1 to 20 of 1 sentences]
33
[+] score: 2
Other miRNAs from this paper: hsa-mir-15a, hsa-mir-148a
Wu L. Liu T. Xiao Y. Li X. Zhu Y. Zhao Y. Bao J. Wu C. Polygonatum odoratum lectin induces apoptosis and autophagy by regulation of microRNA-1290 and microRNA-15a-3p in human lung adenocarcinoma a549 cellsInt. [score:2]
[1 to 20 of 1 sentences]
34
[+] score: 1
Other miRNAs from this paper: hsa-mir-375
Also, Huang et al. demonstrated that higher levels of exosomal miR-1290 and miR-375 were significantly associated with poor overall survival in patients with castration-resistant prostate cancer 18. [score:1]
[1 to 20 of 1 sentences]
35
[+] score: 1
Computation of all six miRNAs (miR-181a, miR-92a, miR-424, miR-1290, miR-29b, and miR-331) together with the baseline LIPS mo del further increased AUC to 0.728 (95% CI 0.674–0.783; p = 0.001) (Table  4). [score:1]
[1 to 20 of 1 sentences]
36
[+] score: 1
Among these miRNAs, miR-146a-5p and miR-29a-3p are the most abundant, while miR-1246 and miR-1290 are most enriched (>10-fold) in EVs. [score:1]
[1 to 20 of 1 sentences]
37
[+] score: 1
miRNA △△Ct2 [−] [△△Ct] hsa-miR-1290 −10.05 1063.66 hsa-miR-1275 −9.36 655.36 hsa-miR-1260 −9.25 609.09 hsa-miR-574-3p −4.49 22.48 hsa-miR-454 −4.45 21.93 hsa-miR-148a −4.38 20.85 hsa-miR-539 −4.36 20.57 hsa-miR-223 −4.27 19.29 hsa-miR-142-5p −4.27 19.26 hsa-miR-485-3p −4.21 18.56 hsa-miR-548c-5p −4.13 17.56 hsa-miR-17 −4.12 17.41 hsa-miR-484 −4.10 17.17 hsa-miR-652 −4.09 17.01 hsa-miR-660 −4.07 16.78 hsa-miR-20b −4.06 16. [score:1]
[1 to 20 of 1 sentences]
38
[+] score: 1
4. Imaoka, H. et al. Circulating microRNA-1290 as a novel diagnostic and prognostic biomarker in human colorectal cancer. [score:1]
[1 to 20 of 1 sentences]
39
[+] score: 1
From this list, miR-1246 and miR-1290 were positively correlated with spontaneous apoptosis, further suggesting that they are candidates to play pro-apoptotic roles in CLL. [score:1]
[1 to 20 of 1 sentences]
40
[+] score: 1
And after correction for multiple testing, level of miR-1290 was confirmed significantly different between the two groups (adj. [score:1]
[1 to 20 of 1 sentences]