sort by

32 publications mentioning hsa-mir-664a

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-664a. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 191
Gene expression studies showed that while miR-664 was upregulated during H7N9 infection, target genes LIF and NEK7 were downregulated. [score:11]
miR-664 is upregulated during the course of influenza A infection of A549 cells, which inhibits the expression of target genes of LIF and NEK7. [score:10]
0155104.g008 Fig 8 miR-664 is upregulated during the course of influenza A infection of A549 cells, which inhibits the expression of target genes of LIF and NEK7. [score:10]
Importantly, potential target genes LIF (p<0.01) and NEK7 (p<0.05) were significantly downregulated, indicating a correlation between miR-664 and the target genes predicted by IPA. [score:8]
However, whether the virus directly controls the upregulation of miR-664 in the cell, or if the virus takes advantage of the cells unbeneficial upregulation of miR-664 remains unclear. [score:8]
Thus, miR-664 may be a pro-viral miRNA, required by the virus to downregulate downstream target genes which are important for viral defense mechanisms by the host cell. [score:6]
Regulation of miR-664 expression and host gene targets during Influenza H7N9 infection. [score:6]
Follow up studies aimed to investigate whether there was a direct effect of miR-664 inhibitor, miR664i, on the gene expression levels of the target genes during infection with H7N9. [score:6]
Thus, miR-664 may have a direct impact on target genes LIF and NE7 and their expression levels during influenza A H7N9 infection. [score:6]
When an inhibitor of miR-664 is used, such as miR664i, molecules LIF and NEK7 are expressed normally, which counteracts the replication of influenza A. All in vitro experiments were performed under the guidance of the Animal Health Research Center (AHRC) in an approved biosafety level 3 laboratory with the use of a powered air-purifying respirator, according to “UGA Laboratory Safety Gui delines”. [score:5]
To determine whether miR-664 inhibitor, miR664i, targets influenza A (H7N9) or impairs virus replication by affecting the host cell machinery, a BLAST (Basic Local Alignment Search Tool) search was performed to compare miR-664 and H7N9 virus microRNA seed sites. [score:5]
There, miR-664 expression was shown to be highly upregulated compared to healthy controls. [score:5]
Effect of influenza A (H7N9) on gene expression levels of miR-664 and target genes. [score:5]
miR664i, an inhibitor of host cell miRNA miR-664, showed potent antiviral effects inhibiting H7N9 replication by two logs (TCID [50] titers) in A549 cells. [score:5]
Orange arrows show inhibitory effects of miR-664 on target genes. [score:5]
The IPA target scan produced a pathway for 8 highly predicted targets of miR-664 and their predictive interactions (Fig 3). [score:5]
When an inhibitor of miR-664 is used, such as miR664i, molecules LIF and NEK7 are expressed normally, which counteracts the replication of influenza A. In studies examining the furin -dependent proteolytic activation of highly pathogenic influenza H5 and H7 viruses, the miR-24 response was shown to strongly decrease both furin messenger RNA (mRNA) levels and intracellular furin activity in A549 cells [43]. [score:5]
Thus, the inhibitory effect of miR-664 on its target genes during influenza infection may facilitate virus replication (Fig 8). [score:5]
Furthermore, it remains unclear if virus infection and /or replication initiates the upregulation of miR-664 to avoid the antiviral effects of LIF, or if this mechanism is a non-beneficial reaction by the host cell during virus infection. [score:4]
In these studies, which examined mechanisms underlying the antiviral actions of miR664i, upregulation of miR-664 was observed during H7N9 infection of A549 cells. [score:4]
Furthermore, ongoing studies also aimed to address whether IFN regulates miR-664 expression in infected and non-infected cells. [score:4]
Inhibition of miR664 limited the replication of various influenza A strains, including H7N9 and the pandemic H1N1 and H3N2, without putting evolutionary pressure on the virus which could potentially lead to resistant mutations. [score:4]
Further, in a microarray screen of human blood serum from pandemic H1N1-infected patients and of H1N1-infected cell lines, miR-664 has been shown to be upregulated during infection [41]. [score:4]
Therefore, a direct action of miR-664 IFN gene expression is not expected. [score:4]
This suggests that miR-664 may downregulate LIF, which may be an important factor in immune defense against influenza A. Whether there are other factors involved and what happens downstream of LIF has yet to be determined. [score:4]
A549 cells were infected with H7N9 at MOI 0.01 and 0.1 for 24 h. RNA was extracted for gene expression analysis of A) LIF and NEK7, and B) miR-664 using RT-qPCR. [score:3]
In validation studies, the most promising target, hsa-miR-664a-3p (miR-664), was further investigated and the effects on downstream genes, Leukemia inhibitory factor (LIF) and NIMA-related kinase 7 (NEK7), were explored (Fig 1A). [score:3]
RT-qPCR was used to investigate the gene expression levels of miR-664 and predicted host target genes, LIF and NEK7, during infection with H7N9. [score:3]
However, it is possible that miR-664 can regulate virus -induced IFN production and secretion indirectly through other molecules in the IFN induction pathway. [score:3]
0155104.g004 Fig 4 A549 cells were infected with H7N9 at MOI 0.01 and 0.1 for 24 h. RNA was extracted for gene expression analysis of A) LIF and NEK7, and B) miR-664 using RT-qPCR. [score:3]
Eight highly predicted target genes of miR-664. [score:3]
0155104.g003 Fig 3 Ingenuity pathway analysis was used to determine target genes of miR-664. [score:3]
Since there was no experimental data available for miR-664, results were filtered for targets with highly-predicted confidence for an interaction with miR-664. [score:3]
The pro-viral properties of miR-664 were confirmed as the inhibitor of miR-664, miR664i, significantly (p<0.05) reduced virus replication by nearly 2 logs. [score:3]
miR-664 was upregulated nearly 10-fold (p<0.05) in A549 cells infected (MOI = 0.1) with H7N9 at 24 h pi (hours post-infection) compared to non-infected A549 cells (Fig 4). [score:3]
Pathway analysis using Ingenuity Pathway Analysis (IPA) was used to explore downstream targets of miR-664. [score:3]
Inhibition of H7N9 replication by miRNA-664 was confirmed where infectivity of H7N9 was reduced by 27% (Fig 2B). [score:3]
Highly predicted target molecules/genes for miR-664 by IPA software. [score:3]
A mo del for miR-664 -mediated regulation of influenza A H7N9 virus infection. [score:2]
To investigate the underlying mechanisms of miR-664 during influenza replication, knock-down studies using siRNA targeting LIF and NEK7 were performed. [score:2]
Top hit has-miR-664a-3p was then investigated for pathway analysis and downstream target effects. [score:1]
Unlike miR-466, no seed sites for miR-664 can be found in any of the human IFN genes. [score:1]
Pathways of the predicted target genes for miR-664 are not well characterized; however, some are known to have ubiquitous functions in the cell (Table 2). [score:1]
Thus, LIF may be a critical factor in the antiviral defense against RSV and other respiratory diseases such as influenza A. Whether this is solely mediated by miR-664, or by other mechanisms, remains unknown and will need to be investigated. [score:1]
[1 to 20 of 44 sentences]
2
[+] score: 14
Five of the twenty snoRNA-like miRNAs, mir-664, mir-151, mir-605, mir-215 and mir-140 were selected for this analysis because they are expressed in HeLa cells. [score:3]
Indeed, to our knowledge, apart from mir-664 and ACA45 sRNA, none of the other miRNAs and smaller fragments have been detected in other mammalian species, suggesting the capability of generating smaller RNA molecules from these snoRNAs might be a recent event. [score:1]
We tested the predictions by experimentally showing that the precursors of five of the predicted snoRNA-like miRNAs, mir-664, mir-151, mir-605, mir-215 and mir-140, interact with dyskerin, a protein component of functional H/ACA snoRNPs. [score:1]
Bands of the size of the miRNA hairpins are detected in all three fractions although the putative mir-151 hairpin is mainly nucleolar whereas the putative mir-664 hairpin accumulates predominantly in the nucleoplasm and cytoplasm (bands labelled with ‘b’ in panels 6A and 6B). [score:1]
The lane numbering in panel C refers to the lanes shown in panel A. Northern blots of HeLa cell extracts fractionated into cytoplasmic, nucleoplasmic and nucleolar fractions were probed for the presence of mir-151 (A) and mir-664 (B) encoding molecules using probes against the respective mature miRNA region. [score:1]
C RT-PCR used to detect co-precipitated hsa-mir-664, hsa-mir-151, hsa-mir-605, has-mir-215 and has-mir-140 miRNA precursors, with E2 box H/ACA snoRNA as positive control and hsa-pri-let-7g miRNA, U3 box C/D snoRNA, U1 snRNA, 5S rRNA and GAPDH pre-mRNA as negative controls for dyskerin -associated RNAs. [score:1]
1000507.g006 Figure 6 Northern blots of HeLa cell extracts fractionated into cytoplasmic, nucleoplasmic and nucleolar fractions were probed for the presence of mir-151 (A) and mir-664 (B) encoding molecules using probes against the respective mature miRNA region. [score:1]
The miRNA hairpins of miR-664 and miR-1291 have short 3′ and 5′ regions respectively that do not overlap with a snoRNA. [score:1]
Mir-664 and mir-605 have not, to our knowledge, been further functionally validated and will require additional experimental evidence to confirm they are true miRNAs. [score:1]
As shown in Figure 6, bands of the size of the predicted H/ACA snoRNA full-length molecules encoding mir-151 and mir-664 localise to the nucleolus (bands labelled with ‘a’ in panels 6A and 6B). [score:1]
And a band slightly larger than the mir-664 mature form localises mainly in the nucleoplasm. [score:1]
After chemical cross linking, the membrane was hybridized with [32]P 5′ end -labelled oligoribonucleotide probes specific for the following RNA species; (mir-664: 5′- UGUAGGCUGGGGAUAAAUGAAUA-3′, mir-151: 5′-CCUCAAGGAGCUUCAGUCUAG-3′, tRNA-Ile 5′-UGGUGGCCCGUACGGGGAUCGA-3′, U11: 5′-TCTTGATGTCGATTCCGCACGCAGAGCAATCGAGTTGCCC-3′ and U3: 5′-CACTCAGACCGCGTTCTCTCCCTCTCACTCCCCAATACGG-3′). [score:1]
[1 to 20 of 12 sentences]
3
[+] score: 14
Furthermore, hsa-miR-34a, hsa-miR-34c-5p, hsa-miR-449a, hsa-miR-607 and hsa-miR-664-3p are associated with neuropsychaitric and nuerodegenrative diseases [40], Bipolar disorder and Schizophenia [41], Molecular Targets for Neurodegenerative diseases [42], Neurodegenerative diseases [43], and Psychiatric and Neurodegenerative disease [44], respectively. [score:11]
Following that, miR-19b, miR-19a, miR-520d-5p, miR-524-5p, miR-519b-5p, miR-519a, miR-519c-3p, miR-495, miR-944 and miR-664 regulate 121, 119, 130, 130, 109, 109, 109, 102, 138, 123 genes, respectively. [score:2]
, miR-19b, miR-19a, miR-520d-5p, miR-519b-5p, miR-519a, miR-519c-3p, miR-944 and miR-664) are partially known (i. e., known to only human, but still unknown to rhesus). [score:1]
[1 to 20 of 3 sentences]
4
[+] score: 13
miR-196a, miR-486-5p, miR-664-star, and miR-378-star were upregulated, and miR-10a, miR-708, and miR-3197 were downregulated in old versus young hMSCs. [score:7]
Notably, miR-196a, miR-486-5p, miR-664-star, and miR-378-star were all significantly upregulated, and miR-10a, miR-708, and miR-3197 were downregulated in the hMSCs from old subjects compared with young subjects (Fig. 2B). [score:6]
[1 to 20 of 2 sentences]
5
[+] score: 9
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-30a, hsa-mir-32, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-196a-1, hsa-mir-30d, hsa-mir-196a-2, hsa-let-7g, hsa-let-7i, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-149, hsa-mir-200c, hsa-mir-425, hsa-mir-505, hsa-mir-548a-1, hsa-mir-548b, hsa-mir-548a-2, hsa-mir-548a-3, hsa-mir-548c, hsa-mir-625, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-548e, hsa-mir-548j, hsa-mir-548k, hsa-mir-548l, hsa-mir-548f-1, hsa-mir-548f-2, hsa-mir-548f-3, hsa-mir-548f-4, hsa-mir-548f-5, hsa-mir-548g, hsa-mir-548n, hsa-mir-548m, hsa-mir-548o, hsa-mir-548h-1, hsa-mir-548h-2, hsa-mir-548h-3, hsa-mir-548h-4, hsa-mir-548p, hsa-mir-548i-1, hsa-mir-548i-2, hsa-mir-548i-3, hsa-mir-548i-4, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-548q, hsa-mir-548s, hsa-mir-548t, hsa-mir-548u, hsa-mir-3146, hsa-mir-548v, hsa-mir-3174, hsa-mir-548w, hsa-mir-3192, hsa-mir-548x, hsa-mir-3605, hsa-mir-3662, hsa-mir-548y, hsa-mir-548z, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548o-2, hsa-mir-548h-5, hsa-mir-548ab, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548x-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-548am, hsa-mir-548an, hsa-mir-548ao, hsa-mir-548ap, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-664b, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, hsa-mir-548ay, hsa-mir-548az, hsa-mir-548ba, hsa-mir-548bb, hsa-mir-548bc
In addition, we found three miRNA*s (miR-664*, miR-505* and miR-32*) that were differentially expressed between the two cell types with at least a 5x fold change. [score:3]
One of the most highly differentially expressed was miR-664, a typical miRtron whose miRNA-664 (4 vs. [score:3]
31) and miR-664* (25 vs. [score:1]
PhastCons scores, which reflect probabilities of selective maintenance through evolution, extend to the edges of the miRNA hairpin (data not shown), suggesting that the miR-664 locus is highly conserved in the human, chimpanzee and mouse lineages. [score:1]
The host gene of the miR-664 intron has been identified as RAB3GAP1, and the sequence of miR-664 overlaps with an annotated snoRNA, ACA38B [27]. [score:1]
[1 to 20 of 5 sentences]
6
[+] score: 7
When the same mo del was analyzed by Zhou et al. [19], peritoneal fibrotic tissues displayed upregulation in 8 miRNAs (miR-205, miR-664, miR-352, miR-146b-5p, predicted miR-160, miR-132, miR-15b, and let-7d) while 15 were downregulated (miR-335, miR-923, miR-801, miR-200a, miR-801, miR-30a, miR-193a-3p, miR-193b, miR-29b, miR-203, miR-148a, miR-709, miR-192, miR-15a, and miR-26b) [19]. [score:7]
[1 to 20 of 1 sentences]
7
[+] score: 6
The expression patterns of miRNAs that were previously reported in adipocytes or their precursors are in agreement with published data, as summarized in Additional file 3. However, the adipogenesis -dependent regulation of many of the differentially expressed miRNAs we identified has never been described before; these include miR-642a-3p, miR-345, miR-193b, miR-29c, miR-664, miR-10b, miR-136, miR-22*, miR-181a, miR-154*, let-7a, let-7b and let-7c. [score:6]
[1 to 20 of 1 sentences]
8
[+] score: 6
detected the expression profile of miRNAs from blood samples of influenza A H1N1 virus-infected patients and then exhibited that the expression levels of 193 miRNA molecules were altered in all influenza patients, of which 16 highly dysregulated miRNAs (miR-1260, miR-1285, miR-18a, miR-185*, miR-299-5p, miR-26a, miR-30a, miR-335*, miR-34b, miR-519e, miR-576-3p, miR-628-3p, miR-664, miR-665, miR-765 and miR-767-5p) were able to provide a clear distinction between infected and healthy individuals [39]. [score:6]
[1 to 20 of 1 sentences]
9
[+] score: 6
Five out of the ten most deregulated miRNAs (miRNAs hsa-miR-664, hsa-miR-422a, hsa-miR-584, hsa-miR-1275, and hsa-miR-491-5p) have not yet been associated with any specific functions or human diseases. [score:4]
The ten miRNAs that were most significantly deregulated included hsa-miR-145 (1.46·10 [−7]), hsa-miR-186 (2.89·10 [−7]), hsa-miR-664 (5.25·10 [−5]), hsa-miR-20b (1.48·10 [−4]), hsa-miR-422a (1.48·10 [−4]), hsa-miR-142-3p (1.54·10 [−4]), hsa-miR-584 (1.56·10 [−4]), hsa-miR-223 (1.63·10 [−4]), hsa-miR-1275 (1.16·10 [−4]) and hsa-miR-491-5p (2.83·10 [−4]). [score:2]
[1 to 20 of 2 sentences]
10
[+] score: 6
miR-492 and miR-548d were both up-regulated (4.9 and 3.2 times respectively) in TSI individuals compared to controls whilst 3 miR (miR-508, miR-509 and miR-664) were >3 fold down-regulated. [score:6]
[1 to 20 of 1 sentences]
11
[+] score: 5
Moreover, miR-664 could promote proliferation, migration and invasion of T-ALL cells; and negatively regulate PLP2 expression through direct binding of its 3′UTR [75]. [score:5]
[1 to 20 of 1 sentences]
12
[+] score: 5
Furthermore, a comparison was made in their negative regulatory effects on FOXO4 protein expression between miR-150 and several other potential up-stream miRNAs of FOXO4 (miR-421, miR-664a-3p, miR-499a-5p). [score:4]
miR-150, miR-421, miR-664a-3p, miR-499a-5p mimics and miRNA mimic NC were synthesized by Ribobio Technology Co. [score:1]
[1 to 20 of 2 sentences]
13
[+] score: 4
miR-664 promotes the proliferation of OS cells through the down-regulation of FOXO4 [7]. [score:4]
[1 to 20 of 1 sentences]
14
[+] score: 3
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-26a-1, hsa-mir-29a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-99a, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-197, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-10a, hsa-mir-34a, hsa-mir-182, hsa-mir-199a-2, hsa-mir-205, hsa-mir-210, hsa-mir-221, hsa-mir-223, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-23b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-140, hsa-mir-142, hsa-mir-143, hsa-mir-125b-2, hsa-mir-134, hsa-mir-146a, hsa-mir-150, hsa-mir-206, hsa-mir-155, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-101-2, hsa-mir-130b, hsa-mir-26a-2, hsa-mir-361, hsa-mir-362, hsa-mir-363, hsa-mir-376c, hsa-mir-371a, hsa-mir-375, hsa-mir-376a-1, hsa-mir-378a, hsa-mir-342, hsa-mir-151a, hsa-mir-324, hsa-mir-335, hsa-mir-345, hsa-mir-423, hsa-mir-483, hsa-mir-486-1, hsa-mir-146b, hsa-mir-202, hsa-mir-432, hsa-mir-494, hsa-mir-495, hsa-mir-193b, hsa-mir-497, hsa-mir-455, hsa-mir-545, hsa-mir-376a-2, hsa-mir-487b, hsa-mir-551a, hsa-mir-571, hsa-mir-574, hsa-mir-576, hsa-mir-606, hsa-mir-628, hsa-mir-629, hsa-mir-411, hsa-mir-671, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-889, hsa-mir-876, hsa-mir-744, hsa-mir-885, hsa-mir-920, hsa-mir-937, hsa-mir-297, hsa-mir-1233-1, hsa-mir-1260a, hsa-mir-320c-2, hsa-mir-2861, hsa-mir-378b, hsa-mir-1260b, hsa-mir-378c, hsa-mir-1233-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-664b, hsa-mir-378j, hsa-mir-486-2
Further analyses showed that six of these miRNAs (miR-1260, miR-335*, miR-664, miR-26a, miR-576-3p, and miR-628-3p) had similar expression signatures in human A549 and Madin–Darby canine kidney (MDCK) cells infected with H1N1 in vitro. [score:3]
[1 to 20 of 1 sentences]
15
[+] score: 3
Next, to further explore the functions of these miRNAs in HCC, we selected miRNAs with a fold change >5, namely hsa-miR-636, hsa-miR-671, hsa-miR-489, hsa-miR-26a, hsa-miR-320, hsa-miR-628, hsa-miR-505, hsa-miR-100, hsa-miR-664, hsa-miR-942, hsa-miR-192, hsa-miR-99b, hsa-miR-125b, hsa-miR-10b, hsa-miR-30b, and hsa-miR-145, for GO (Gene Ontology) enrichment analysis [21] of their target genes using the web -based software WebGestalt 2.0 [22]. [score:3]
[1 to 20 of 1 sentences]
16
[+] score: 3
It was observed that in whole blood of H1N1 patients, miR-1260, miR-26a, miR-335, miR-576-3p, miR-628-3p and miR-664 are differentially expressed [57]. [score:3]
[1 to 20 of 1 sentences]
17
[+] score: 3
miRNAs selected for validation studies spanned a range of expression from high to single alignments, and included miR-21, miR-30, miR-98/Let7 family members, miR-221, miR-222, miR-622, miR-664, miR-1248 and miR-1291. [score:3]
[1 to 20 of 1 sentences]
18
[+] score: 3
miR-335* and miR-664 also showed consistently increased expression. [score:3]
[1 to 20 of 1 sentences]
19
[+] score: 2
The best classification accuracy has been obtained by using a subset that consists of 16 miRNAs including hsa-miR-186, hsa-let-7d*, hsa-miR-18a*, hsa-miR-145, hsa-miR-99a, hsa-miR-664, hsa-miR-501-5p, hsa-miR-378*, hsa-miR-29c*, hsa-miR-1280, hsa-miR-365, hsa-miR-1249, hsa-miR-328, hsa-miR-422a, hsa-miR-30 d, and hsa-miR-17*. [score:1]
We analyzed 13 miRNAs that showed significant deregulation in the microarray experiments, including hsa-miR-106b, hsa-miR-107, hsa-miR-1280, hsa-miR-151-3p, hsa-miR-17*, hsa-miR-18a, hsa-miR-199a-5p, hsa-miR-20a, hsa-miR-20b, hsa-miR-30a, hsa-miR-362-3p, hsa-miR-550*, and hsa-miR-664, using TaqMan [® ]MicroRNA Assays (Applied Biosystems). [score:1]
[1 to 20 of 2 sentences]
20
[+] score: 1
79 ** hsa-mir-365 7.13 *** 77.53 *** hsa-mir-429 54.63 *** 85.25 *** hsa-mir-454 33.25 *** 87.31 - hsa-mir-455-3p 42.76 *** 96.4 - hsa-mir-484 4.83 *** 78.73 - hsa-mir-485-3p 4.75 *** 71.49 *** hsa-mir-501-3p 69.25 *** 91.25 *** hsa-mir-512-5p 21.37 *** 72.89 *** hsa-mir-532-3p 9.5 *** 85.93 *** hsa-mir-541 69.87 *** 97.77 - hsa-mir-600 35.63 *** 93.48 - hsa-mir-625* 28.5 *** 72.89 *** Hits of functional screen Relative percentage of myotubes 1, % of control p value, Mann Whitney test Relative cell count 2, % of control p value, Mann Whitney test hsa-mir-636 2.37 *** 81.98 *** hsa-mir-663 21.38 *** 84.73 *** hsa-mir-664 7.13 *** 82.85 *** hsa-mir-766 45.13 *** 73. [score:1]
[1 to 20 of 1 sentences]
21
[+] score: 1
For the pre-miRNAs originally annotated to encode miRNAs at both arms, the major arms of hsa-mir-374a, hsa-mir-500a, hsa-mir-625 and hsa-mir-136 are their 5p arms; while, the major arms of hsa-mir-664, hsa-mir-144, hsa-mir-493 and hsa-mir-376a-1 are their 3p arms. [score:1]
[1 to 20 of 1 sentences]
22
[+] score: 1
In the upper lobe, miR-664a-3p (P = 0.005) was the lone microRNA identified as significantly changed upon 24 h exposure to 5% O [2]. [score:1]
[1 to 20 of 1 sentences]
23
[+] score: 1
Our previous study found that miR-196a, miR-486-5p, miR-664-star, and miR-378-star were significantly increased whereas miR-10a, miR-708, and miR-3197 were decreased in old hBM-MSCs. [score:1]
[1 to 20 of 1 sentences]
24
[+] score: 1
Other miRNAs from this paper: hsa-let-7a-2, hsa-let-7c, hsa-let-7e, hsa-mir-15a, hsa-mir-16-1, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-2, hsa-mir-100, hsa-mir-29b-2, mmu-let-7i, mmu-mir-99b, mmu-mir-125a, mmu-mir-130a, mmu-mir-142a, mmu-mir-144, mmu-mir-155, mmu-mir-183, hsa-mir-196a-1, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, hsa-mir-148a, mmu-mir-143, hsa-mir-181c, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-181a-1, hsa-mir-200b, mmu-mir-298, mmu-mir-34b, hsa-let-7i, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-130a, hsa-mir-142, hsa-mir-143, hsa-mir-144, hsa-mir-125a, mmu-mir-148a, mmu-mir-196a-1, mmu-let-7a-2, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-mir-15a, mmu-mir-16-1, mmu-mir-21a, mmu-mir-22, mmu-mir-23a, mmu-mir-24-2, rno-mir-148b, mmu-mir-148b, hsa-mir-200c, hsa-mir-155, mmu-mir-100, mmu-mir-200c, mmu-mir-181a-1, mmu-mir-29b-2, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-181c, hsa-mir-34b, hsa-mir-99b, hsa-mir-374a, hsa-mir-148b, rno-let-7a-2, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7i, rno-mir-21, rno-mir-22, rno-mir-23a, rno-mir-24-2, rno-mir-29b-2, rno-mir-34b, rno-mir-99b, rno-mir-100, rno-mir-124-1, rno-mir-124-2, rno-mir-125a, rno-mir-130a, rno-mir-142, rno-mir-143, rno-mir-144, rno-mir-181c, rno-mir-183, rno-mir-199a, rno-mir-200c, rno-mir-200b, rno-mir-181a-1, rno-mir-298, hsa-mir-193b, hsa-mir-497, hsa-mir-568, hsa-mir-572, hsa-mir-596, hsa-mir-612, rno-mir-664-1, rno-mir-664-2, rno-mir-497, mmu-mir-374b, mmu-mir-497a, mmu-mir-193b, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-568, hsa-mir-298, hsa-mir-374b, rno-mir-466b-1, rno-mir-466b-2, mmu-mir-664, rno-mir-568, hsa-mir-664b, mmu-mir-21b, mmu-mir-21c, rno-mir-155, mmu-mir-142b, mmu-mir-497b, rno-mir-148a, rno-mir-15a, rno-mir-193b
Family Members 1 mir-466b-1 mir-466b-2 2 mir-664-1 mir-664-2There are 154 singleton human miRNAs with no defined homologs. [score:1]
[1 to 20 of 1 sentences]
25
[+] score: 1
miRNA name Nuclear %Conservation [∗] hsa-miR-768-5pˆ 94.17 n/a hsa-miR-768-3pˆ 93.71 n/a hsa-miR-1299 93.17 No (hsa, ptr, ppy) hsa-miR-297 92.72 Yes hsa-miR-663b 92.17 No (hsa, ptr, ppy, oga, bta) hsa-miR-647 89.19 No (hsa, ppy) hsa-miR-595 88.09 No (hsa, ptr, mml, ppy) hsa-miR-921 83.82 No (hsa, ppy, efu)hsa-miR-593 [∗] 80.62 No (hsa, ptr, mml, ppy) hsa-miR-1183 78.28 No (hsa, ptr, ppy)hsa-miR-664 [∗] 75.44 Yes hsa-miR-1275 73.87 No (hsa, ptr, ppy) hsa-miR-574-5p 71.94 Yes [∗] Species identifiers: hsa, Homo sapiens; ptr, Pan troglodytes; mml, Macaca mulatta; ppy, Pongo pygmaeus; efu, Eptesicus fuscus; Bta, Bos Taurus; oga, Otolemur garnettii. [score:1]
[1 to 20 of 1 sentences]
26
[+] score: 1
Other miRNAs from this paper: hsa-mir-214, hsa-mir-155, hsa-mir-494, hsa-mir-92b, hsa-mir-664b
It found that 1 week after the exposure only 23 miRNAs were affected (like rno-miR-92b, and rno-miR-664), while 2 months after, the total number rose to 45 types (like rno-miR-214, rno-miR-327, rno-miR-466b, and rno-miR-494) [94]. [score:1]
[1 to 20 of 1 sentences]
27
[+] score: 1
Other miRNAs from this paper: hsa-mir-143, hsa-mir-145
Of the suitable reference miRNAs, miR-664a-3p was detected in all samples and was used for normalization. [score:1]
[1 to 20 of 1 sentences]
28
[+] score: 1
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-mir-15a, hsa-mir-18a, hsa-mir-33a, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, mmu-mir-27b, mmu-mir-126a, mmu-mir-128-1, mmu-mir-140, mmu-mir-146a, mmu-mir-152, mmu-mir-155, mmu-mir-191, hsa-mir-10a, hsa-mir-211, hsa-mir-218-1, hsa-mir-218-2, mmu-mir-297a-1, mmu-mir-297a-2, hsa-mir-27b, hsa-mir-128-1, hsa-mir-140, hsa-mir-152, hsa-mir-191, hsa-mir-126, hsa-mir-146a, mmu-let-7a-1, mmu-let-7a-2, mmu-mir-15a, mmu-mir-18a, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-342, hsa-mir-155, mmu-mir-107, mmu-mir-10a, mmu-mir-218-1, mmu-mir-218-2, mmu-mir-33, mmu-mir-211, hsa-mir-374a, hsa-mir-342, gga-mir-33-1, gga-let-7a-3, gga-mir-155, gga-mir-18a, gga-mir-15a, gga-mir-218-1, gga-mir-103-2, gga-mir-107, gga-mir-128-1, gga-mir-140, gga-let-7a-1, gga-mir-146a, gga-mir-103-1, gga-mir-218-2, gga-mir-126, gga-let-7a-2, gga-mir-27b, mmu-mir-466a, mmu-mir-467a-1, hsa-mir-499a, hsa-mir-545, hsa-mir-593, hsa-mir-600, hsa-mir-33b, gga-mir-499, gga-mir-211, gga-mir-466, mmu-mir-675, mmu-mir-677, mmu-mir-467b, mmu-mir-297b, mmu-mir-499, mmu-mir-717, hsa-mir-675, mmu-mir-297a-3, mmu-mir-297a-4, mmu-mir-297c, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-467c, mmu-mir-467d, mmu-mir-466d, hsa-mir-297, mmu-mir-467e, mmu-mir-466l, mmu-mir-466i, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-467f, mmu-mir-466j, mmu-mir-467g, mmu-mir-467h, hsa-mir-1306, hsa-mir-1307, gga-mir-1306, hsa-mir-103b-1, hsa-mir-103b-2, gga-mir-10a, mmu-mir-1306, mmu-mir-3064, mmu-mir-466m, mmu-mir-466o, mmu-mir-467a-2, mmu-mir-467a-3, mmu-mir-466c-2, mmu-mir-467a-4, mmu-mir-466b-4, mmu-mir-467a-5, mmu-mir-466b-5, mmu-mir-467a-6, mmu-mir-466b-6, mmu-mir-467a-7, mmu-mir-466b-7, mmu-mir-467a-8, mmu-mir-467a-9, mmu-mir-467a-10, mmu-mir-466p, mmu-mir-466n, mmu-mir-466b-8, hsa-mir-466, hsa-mir-3173, hsa-mir-3618, hsa-mir-3064, hsa-mir-499b, mmu-mir-466q, hsa-mir-664b, gga-mir-3064, mmu-mir-126b, gga-mir-33-2, mmu-mir-3618, mmu-mir-466c-3, gga-mir-191
Namely, it was observed that in cases where two ncRNA genes (miRNA and snoRNA) overlapped in the same region, the automatic annotation pipeline favored the longer RNA; for example, the record of snoRNA gene SNORA36B overwrote the record of the overlapping miRNA gene hsa-mir-664a. [score:1]
[1 to 20 of 1 sentences]
29
[+] score: 1
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-17, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-23a, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-16-2, mmu-mir-23b, mmu-mir-27b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-127, mmu-mir-128-1, mmu-mir-132, mmu-mir-133a-1, mmu-mir-188, mmu-mir-194-1, mmu-mir-195a, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, mmu-mir-205, mmu-mir-206, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-122, mmu-mir-30e, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-205, hsa-mir-211, hsa-mir-212, hsa-mir-214, hsa-mir-217, hsa-mir-200b, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-128-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-127, hsa-mir-138-1, hsa-mir-188, hsa-mir-194-1, hsa-mir-195, hsa-mir-206, mmu-mir-19b-2, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-23a, mmu-mir-26a-1, mmu-mir-26b, mmu-mir-29a, mmu-mir-29c, mmu-mir-27a, mmu-mir-31, mmu-mir-351, hsa-mir-200c, mmu-mir-17, mmu-mir-19a, mmu-mir-100, mmu-mir-200c, mmu-mir-212, mmu-mir-214, mmu-mir-26a-2, mmu-mir-211, mmu-mir-29b-2, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-19b-1, mmu-mir-138-1, mmu-mir-128-2, hsa-mir-128-2, mmu-mir-217, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-379, mmu-mir-379, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-412, mmu-mir-431, hsa-mir-431, hsa-mir-451a, mmu-mir-451a, mmu-mir-467a-1, hsa-mir-412, hsa-mir-485, hsa-mir-487a, hsa-mir-491, hsa-mir-503, hsa-mir-504, mmu-mir-485, hsa-mir-487b, mmu-mir-487b, mmu-mir-503, hsa-mir-556, hsa-mir-584, mmu-mir-665, mmu-mir-669a-1, mmu-mir-674, mmu-mir-690, mmu-mir-669a-2, mmu-mir-669a-3, mmu-mir-669c, mmu-mir-696, mmu-mir-491, mmu-mir-504, hsa-mir-665, mmu-mir-467e, mmu-mir-669k, mmu-mir-669f, mmu-mir-1896, mmu-mir-1894, mmu-mir-1943, mmu-mir-1983, mmu-mir-1839, mmu-mir-3064, mmu-mir-3072, mmu-mir-467a-2, mmu-mir-669a-4, mmu-mir-669a-5, mmu-mir-467a-3, mmu-mir-669a-6, mmu-mir-467a-4, mmu-mir-669a-7, mmu-mir-467a-5, mmu-mir-467a-6, mmu-mir-669a-8, mmu-mir-669a-9, mmu-mir-467a-7, mmu-mir-467a-8, mmu-mir-669a-10, mmu-mir-467a-9, mmu-mir-669a-11, mmu-mir-467a-10, mmu-mir-669a-12, mmu-mir-3473a, hsa-mir-23c, hsa-mir-4436a, hsa-mir-4454, mmu-mir-3473b, hsa-mir-4681, hsa-mir-3064, hsa-mir-4436b-1, hsa-mir-4790, hsa-mir-4804, hsa-mir-548ap, mmu-mir-3473c, mmu-mir-5110, mmu-mir-3473d, mmu-mir-5128, hsa-mir-4436b-2, mmu-mir-195b, mmu-mir-133c, mmu-mir-30f, mmu-mir-3473e, hsa-mir-6825, hsa-mir-6888, mmu-mir-6967-1, mmu-mir-3473f, mmu-mir-3473g, mmu-mir-6967-2, mmu-mir-3473h
ARPE_cont) Homo sapiens hsa-miR-4454 0.00806874 –2.15149 Homo sapiens hsa-miR-664a-5p 0.00933842 –1.71214 Homo sapiens HBII-316 0.0371439 –1.6763 Homo sapiens hsa-miR-188-3p 0.0050997 –1.67318 Homo sapiens hsa-mir-548al 0.0409855 –1.66795 Homo sapiens hsa-miR-548ap-3p 0.00270826 –1.62928 Homo sapiens hsa-miR-6888-5p 0.0244117 –1.55839 Homo sapiens hsa-miR-584-5p 0.00101538 –1.54123 Homo sapiens hsa-miR-4681 0.0273394 –1.53062 Homo sapiens hsa-miR-451a 0.0147813 –1.52959 Homo sapiens HBI-36 0.0477323 –1.51987 Homo sapiens hsa-miR-6825-5p 0.0137077 –1.51982 Homo sapiens hsa-miR-4790-5p 0.0229827 –1.51921 Homo sapiens hsa-mir-556 0.00579586 –1.5192 Homo sapiens hsa-mir-4804 0.018718 –1.4998 Homo sapiens U73a 0.0395006 –1. [score:1]
[1 to 20 of 1 sentences]
30
[+] score: 1
This work reports on the detection of more miRNAs, e. g., miR-351, miR-1 and miR-664 in rat nucleoli. [score:1]
[1 to 20 of 1 sentences]
31
[+] score: 1
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-27a, hsa-mir-31, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-16-2, hsa-mir-192, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-181a-2, hsa-mir-205, hsa-mir-181a-1, hsa-mir-214, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-146a, hsa-mir-184, hsa-mir-186, hsa-mir-193a, hsa-mir-194-1, hsa-mir-155, hsa-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-219a-2, hsa-mir-99b, hsa-mir-26a-2, hsa-mir-365a, hsa-mir-365b, hsa-mir-374a, hsa-mir-148b, hsa-mir-423, hsa-mir-486-1, hsa-mir-499a, hsa-mir-532, hsa-mir-590, bta-mir-26a-2, bta-let-7f-2, bta-mir-103-1, bta-mir-148a, bta-mir-16b, bta-mir-21, bta-mir-221, bta-mir-222, bta-mir-27a, bta-mir-499, bta-mir-125b-1, bta-mir-181a-2, bta-mir-205, bta-mir-27b, bta-mir-30b, bta-mir-31, bta-mir-193a, bta-let-7d, bta-mir-148b, bta-mir-186, bta-mir-191, bta-mir-192, bta-mir-200a, bta-mir-214, bta-mir-22, bta-mir-23a, bta-mir-29c, bta-mir-423, bta-let-7g, bta-mir-24-2, bta-let-7a-1, bta-mir-532, bta-let-7f-1, bta-mir-30c, bta-let-7i, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-125b-2, bta-mir-365-1, bta-mir-374a, bta-mir-99b, hsa-mir-374b, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-1915, bta-mir-146a, bta-mir-155, bta-mir-16a, bta-mir-184, bta-mir-24-1, bta-mir-194-2, bta-mir-219-1, bta-mir-223, bta-mir-26a-1, bta-mir-365-2, bta-mir-374b, bta-mir-486, bta-mir-763, bta-mir-9-1, bta-mir-9-2, bta-mir-181a-1, bta-mir-2284i, bta-mir-2284s, bta-mir-2284l, bta-mir-2284j, bta-mir-2284t, bta-mir-2284d, bta-mir-2284n, bta-mir-2284g, bta-mir-2339, bta-mir-2284p, bta-mir-2284u, bta-mir-2284f, bta-mir-2284a, bta-mir-2284k, bta-mir-2284c, bta-mir-2284v, bta-mir-2284q, bta-mir-2284m, bta-mir-2284b, bta-mir-2284r, bta-mir-2284h, bta-mir-2284o, bta-mir-664a, bta-mir-2284e, bta-mir-1388, bta-mir-194-1, bta-mir-193a-2, bta-mir-2284w, bta-mir-2284x, bta-mir-148c, hsa-mir-374c, hsa-mir-219b, hsa-mir-499b, hsa-mir-664b, bta-mir-2284y-1, bta-mir-2284y-2, bta-mir-2284y-3, bta-mir-2284y-4, bta-mir-2284y-5, bta-mir-2284y-6, bta-mir-2284y-7, bta-mir-2284z-1, bta-mir-2284aa-1, bta-mir-2284z-3, bta-mir-2284aa-2, bta-mir-2284aa-3, bta-mir-2284z-4, bta-mir-2284z-5, bta-mir-2284z-6, bta-mir-2284z-7, bta-mir-2284aa-4, bta-mir-2284z-2, hsa-mir-486-2, hsa-mir-6516, bta-mir-2284ab, bta-mir-664b, bta-mir-6516, bta-mir-219-2, bta-mir-2284ac, bta-mir-219b, bta-mir-374c, bta-mir-148d
7335412:- bta-miR-664-3pssc-mir-664ssc-miR-664-3p68.570uauucauuuaucucccagccuaca2459caggcuaggagaaaugauuggau2316:24379875.. [score:1]
[1 to 20 of 1 sentences]
32
[+] score: 1
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-21, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-99a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-16-2, hsa-mir-192, hsa-mir-148a, hsa-mir-10b, hsa-mir-181a-2, hsa-mir-181a-1, hsa-mir-215, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-mir-15b, hsa-mir-27b, hsa-mir-125b-1, hsa-mir-141, hsa-mir-143, hsa-mir-152, hsa-mir-125b-2, hsa-mir-126, hsa-mir-146a, hsa-mir-184, hsa-mir-200c, hsa-mir-155, hsa-mir-29c, hsa-mir-200a, hsa-mir-99b, hsa-mir-296, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-378a, hsa-mir-342, hsa-mir-148b, hsa-mir-451a, ssc-mir-125b-2, ssc-mir-148a, ssc-mir-15b, ssc-mir-184, ssc-mir-224, ssc-mir-23a, ssc-mir-24-1, ssc-mir-26a, ssc-mir-29b-1, ssc-let-7f-1, ssc-mir-103-1, ssc-mir-21, ssc-mir-29c, hsa-mir-486-1, hsa-mir-499a, hsa-mir-671, hsa-mir-378d-2, bta-mir-26a-2, bta-mir-29a, bta-let-7f-2, bta-mir-103-1, bta-mir-148a, bta-mir-16b, bta-mir-21, bta-mir-499, bta-mir-99a, bta-mir-125b-1, bta-mir-126, bta-mir-181a-2, bta-mir-27b, bta-mir-31, bta-mir-15b, bta-mir-215, bta-mir-30e, bta-mir-148b, bta-mir-192, bta-mir-200a, bta-mir-200c, bta-mir-23a, bta-mir-29b-2, bta-mir-29c, bta-mir-10b, bta-mir-24-2, bta-mir-30a, bta-mir-200b, bta-let-7a-1, bta-mir-342, bta-let-7f-1, bta-let-7a-2, bta-let-7a-3, bta-mir-103-2, bta-mir-125b-2, bta-mir-15a, bta-mir-99b, ssc-mir-99b, hsa-mir-103b-1, hsa-mir-103b-2, ssc-mir-15a, ssc-mir-16-2, ssc-mir-16-1, bta-mir-141, bta-mir-143, bta-mir-146a, bta-mir-152, bta-mir-155, bta-mir-16a, bta-mir-184, bta-mir-24-1, bta-mir-223, bta-mir-224, bta-mir-26a-1, bta-mir-296, bta-mir-29d, bta-mir-378-1, bta-mir-451, bta-mir-486, bta-mir-671, bta-mir-29e, bta-mir-29b-1, bta-mir-181a-1, ssc-mir-181a-1, ssc-mir-215, ssc-mir-30a, bta-mir-2318, bta-mir-2339, bta-mir-2430, bta-mir-664a, bta-mir-378-2, ssc-let-7a-1, ssc-mir-378-1, ssc-mir-29a, ssc-mir-30e, ssc-mir-499, ssc-mir-143, ssc-mir-10b, ssc-mir-486-1, ssc-mir-152, ssc-mir-103-2, ssc-mir-181a-2, ssc-mir-27b, ssc-mir-24-2, ssc-mir-99a, ssc-mir-148b, ssc-mir-664, ssc-mir-192, ssc-mir-342, ssc-mir-125b-1, oar-mir-21, oar-mir-29a, oar-mir-125b, oar-mir-181a-1, hsa-mir-378b, hsa-mir-378c, ssc-mir-296, ssc-mir-155, ssc-mir-146a, bta-mir-148c, ssc-mir-126, ssc-mir-378-2, ssc-mir-451, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-451b, hsa-mir-499b, ssc-let-7a-2, ssc-mir-486-2, hsa-mir-664b, hsa-mir-378j, ssc-let-7f-2, ssc-mir-29b-2, ssc-mir-31, ssc-mir-671, bta-mir-378b, bta-mir-378c, hsa-mir-486-2, oar-let-7a, oar-let-7f, oar-mir-103, oar-mir-10b, oar-mir-143, oar-mir-148a, oar-mir-152, oar-mir-16b, oar-mir-181a-2, oar-mir-200a, oar-mir-200b, oar-mir-200c, oar-mir-23a, oar-mir-26a, oar-mir-29b-1, oar-mir-30a, oar-mir-99a, bta-mir-664b, chi-let-7a, chi-let-7f, chi-mir-103, chi-mir-10b, chi-mir-125b, chi-mir-126, chi-mir-141, chi-mir-143, chi-mir-146a, chi-mir-148a, chi-mir-148b, chi-mir-155, chi-mir-15a, chi-mir-15b, chi-mir-16a, chi-mir-16b, chi-mir-184, chi-mir-192, chi-mir-200a, chi-mir-200b, chi-mir-200c, chi-mir-215, chi-mir-21, chi-mir-223, chi-mir-224, chi-mir-2318, chi-mir-23a, chi-mir-24, chi-mir-26a, chi-mir-27b, chi-mir-296, chi-mir-29a, chi-mir-29b, chi-mir-29c, chi-mir-30a, chi-mir-30e, chi-mir-342, chi-mir-378, chi-mir-451, chi-mir-499, chi-mir-671, chi-mir-99a, chi-mir-99b, bta-mir-378d, ssc-mir-378b, oar-mir-29b-2, ssc-mir-141, ssc-mir-200b, ssc-mir-223, bta-mir-148d
From lung tissue of pigs infected with Actinobacillus pleuropneumoniae, Podolska et al. (2012) identified miR-664-5p, miR-451, and miR-15a as promising miRNA candidates involved in response to bacterial infection. [score:1]
[1 to 20 of 1 sentences]