sort by

23 publications mentioning gga-mir-16c

Open access articles that are associated with the species Gallus gallus and mention the gene name mir-16c. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 432
The results showed that overexpression of miR-16-5p inhibited the proliferation of myoblasts, promoted the expression of apoptosis-related genes, and downregulated myoblast differentiation marker genes. [score:10]
More importantly, after overexpression of miR-16-5p, the mRNA and protein levels of SESN1 were significantly decreased, while inhibition of miR-16-5p upregulated expression of SESN1 mRNA and protein (Fig.   4c, d). [score:10]
Here, we demonstrated a transient expression pattern of miR-16-5p during embryonic skeletal muscle development, and found that it was upregulated during chicken muscle fiber formation, indicating its potential role in muscle development. [score:8]
Because each miRNA could regulate up to hundred target genes [31], we performed an in silico analysis of miRNA-16-5p targets, and identified that the seed sequence of miR-16-5p could perfectly match the 3′ UTR of SESN1, which was also differentially expressed between WRR and XH chickens. [score:8]
In general, SESN1 has been identified as a direct target of miR-16-5p, and miR-16-5p regulates myoblast development by suppressing SESN1. [score:8]
Conversely, miR-16-5p inhibition significantly downregulated the expression of p21 and resulted in a fewer number of G0/G1 and increased S phase cells (Fig.   1d, f). [score:8]
In conclusion, our findings reveal that miR-16-5p could inhibit myoblast proliferation, promote myoblast apoptosis, and repress myoblast differentiation by directly binding and suppressing SESN1 expression. [score:8]
i, j The mRNA and protein expression levels of p53 after overexpression and inhibition of miR-16-5p in CPMs. [score:7]
NC, negative control To verify the biological effects of miR-16-5p on myoblast apoptosis, the mRNA expression levels of several apoptosis-related genes, including Cytochrome c (Cyt c), Fas, Caspase 8, Caspase 3, and Caspase 9, were examined by quantitative PCR (qPCR) after overexpression or inhibition of miR-16-5p in CPM. [score:7]
To verify the biological effects of miR-16-5p on myoblast apoptosis, the mRNA expression levels of several apoptosis-related genes, including Cytochrome c (Cyt c), Fas, Caspase 8, Caspase 3, and Caspase 9, were examined by quantitative PCR (qPCR) after overexpression or inhibition of miR-16-5p in CPM. [score:7]
e, f The mRNA and protein expression levels of myoblast differentiation marker genes with miR-16-5p overexpression and inhibition in QM-7 cells. [score:7]
Rivas MA Downregulation of the tumor-suppressor miR-16 via progestin -mediated oncogenic signaling contributes to breast cancer developmentBreast Cancer Res. [score:7]
Oligonucleotide sequences in this study are showed in Table  3. Table 3 Oligonucleotide sequences in this study Fragment name Sequences (5′ to 3′) miR-16-5p mimic UAGCAGCACGUAAAUAUUGGUG miR-16-5p inhibitor CACCAAUAUUUACGUGCUGCUAsi- SESN1 CCTTGCTTCCTTCACGTTT For SESN1 overexpression plasmid construction, the full-length sequence of SESN1 was amplified from chicken breast muscle cDNA by PCR, and cloned into the expression plasmid, pcDNA-3.1 vector (Promega, Madison, WI, USA) by using the NheI and XhoI restriction sites. [score:7]
Oligonucleotide sequences in this study are showed in Table  3. Table 3 Oligonucleotide sequences in this study Fragment name Sequences (5′ to 3′) miR-16-5p mimic UAGCAGCACGUAAAUAUUGGUG miR-16-5p inhibitor CACCAAUAUUUACGUGCUGCUAsi- SESN1 CCTTGCTTCCTTCACGTTTFor SESN1 overexpression plasmid construction, the full-length sequence of SESN1 was amplified from chicken breast muscle cDNA by PCR, and cloned into the expression plasmid, pcDNA-3.1 vector (Promega, Madison, WI, USA) by using the NheI and XhoI restriction sites. [score:7]
b, d The protein expression levels of several cleaved caspases with miR-16-5p overexpression and inhibition in CPMs. [score:7]
To study the role of miR-16-5p in chicken skeletal muscle development, we explored its molecular function and found that miR-16-5p could directly suppress SESN1 to regulate myoblast proliferation and apoptosis via the p53 signaling pathway. [score:6]
In order to further understand the molecular mechanism by which miR-16-5p regulates gene expression, we predicted its target genes on the miRDB (http://www. [score:6]
Briefly, miR-16-5p inhibits expression of both mRNA and protein of SESN1 by directly binding to the 3′ UTR of SESN1. [score:6]
Moreover, we examined the expression of p53 after overexpression or inhibition of miR-16-5p, and opposite results were observed compared to SESN1 (Fig.   5i, j). [score:6]
Fig. 8Briefly, miR-16-5p inhibits expression of both mRNA and protein of SESN1 by directly binding to the 3′ UTR of SESN1. [score:6]
In contrast, apoptosis-related genes were downregulated and inactivated after inhibition of miR-16-5p (Fig.   2c, d). [score:6]
In this study, we report that miR-16-5p could inhibit myoblast proliferation, promote myoblast apoptosis, and repress myoblast differentiation by directly binding to the 3′ UTR of SESN1, which is also differentially expressed. [score:6]
NC, negative control In order to further understand the molecular mechanism by which miR-16-5p regulates gene expression, we predicted its target genes on the miRDB (http://www. [score:6]
The results showed that overexpression of miR-16-5p could promote the upregulation and activation of apoptosis-related genes (Fig.   2a, b). [score:6]
a, c mRNA levels of several apoptosis-related genes induced by miR-16-5p overexpression and inhibition in CPMs. [score:5]
e, f Cell cycle analysis of CPMs 48 h after overexpression and inhibition of miR-16-5p, using propidium iodide staining for DNA content. [score:5]
Conversely, inhibition of miR-16-5p promoted their expression (Fig.   3d, f). [score:5]
We found that overexpression of miR-16-5p inhibited myoblasts proliferation, promoted myoblasts apoptosis, and repressed myoblast differentiation. [score:5]
m, n Cell cycle analysis of QM-7 cells 48 h after overexpression and inhibition of miR-16-5p. [score:5]
h, j Myotube area (%) of CPMs 72 h after overexpression and inhibition of miR-16-5p. [score:5]
NC, negative control Meanwhile, myoblast differentiation marker genes, including MYOG, MYOD, and MyHC, were analyzed by qPCR after overexpression or inhibition of miR-16-5p in both CPM and QM-7 cells. [score:5]
The expressions of these marker genes were all significantly downregulated in the miR-16-5p mimic transfected cells compared to control cells (Fig.   3c, e). [score:5]
NC, negative controlMeanwhile, myoblast differentiation marker genes, including MYOG, MYOD, and MyHC, were analyzed by qPCR after overexpression or inhibition of miR-16-5p in both CPM and QM-7 cells. [score:5]
e, f Annexin V-FITC and propidium iodide (PI) dual staining detection of the apoptosis of CPMs after overexpression and inhibition of miR-16-5p, as determined by flow cytometry. [score:5]
After immunofluorescence staining, we found miR-16-5p overexpression repressed myoblast differentiation and significantly reduced the total areas of myotubes (Fig.   3g, h), while inhibition of miR-16-5p promoted myoblast differentiation (Fig.   3I, j). [score:5]
h, j Proliferation rates of CPMs with miR-16-5p overexpression and inhibition. [score:5]
g, h Annexin V-FITC and PI dual staining detection of the apoptosis of QM-7 cells after overexpression and inhibition of miR-16-5p, as determined by flow cytometry. [score:5]
Fig. 2 a, c mRNA levels of several apoptosis-related genes induced by miR-16-5p overexpression and inhibition in CPMs. [score:5]
c, d The relative mRNA and protein expression of p21 after transfection with miR-16-5p mimic and inhibitor in chicken CPMs. [score:5]
c, d The mRNA and protein expression levels of myoblast differentiation marker genes from miR-16-5p mimic and inhibitor transfected CPMs. [score:5]
The contrary results were found with miR-16-5p overexpression or inhibition (Fig.   5f). [score:5]
c, d The mRNA and protein expression levels of SESN1 from miR-16-5p mimic and inhibitor transfected CPMs and QM-7 cells. [score:5]
NC, negative control To unveil the functions of miR-16-5p, we performed overexpression and inhibition experiments to assess its role in cell proliferation and viability. [score:5]
Altogether, these data demonstrated that miR-16-5p directly targets SESN1 to regulate the p53 signaling pathway, and therefore affecting myoblast proliferation and apoptosis. [score:5]
p, r Proliferation rates of QM-7 cells with miR-16-5p overexpression and inhibition. [score:5]
In chicken primary myoblast (CPM), overexpression of miR-16-5p promoted p21 mRNA and protein expression, and significantly increased the number of cells that progressed to G0/G1 and reduced the number of S phase cells (Fig.   1c, e). [score:5]
The increased expression of miR-16-5p in embryonic development suggested that miR-16-5p was probably involved in skeletal muscle development. [score:5]
NC, negative controlTo unveil the functions of miR-16-5p, we performed overexpression and inhibition experiments to assess its role in cell proliferation and viability. [score:5]
There is evidence that miR-16-5p is involved in growth and development, as well as disease occurrence 27– 30. [score:4]
Breast muscle tissues were used to detect the expression of miR-16-5p and SESN1 in the process of chicken embryonic development. [score:4]
Taken together, these results demonstrated that SESN1 was a direct target of miR-16-5p. [score:4]
e, f Western blotting analysis of γ-H2AX protein levels after SESN1 (e) and miR-16-5p (f) overexpression and knockdown in CPMs. [score:4]
SESN1 is a direct target of miR-16-5p. [score:4]
Fig. 4Identification of SESN1 as a direct target of miR-16-5p. [score:4]
NC, negative control During breast muscle development in XH chickens, miR-16-5p was expressed at embryonic days 11 (11E) and subsequently increased and peaked at 19E (Fig.   1a). [score:4]
However, these regulatory roles were negated by co-overexpression of miR-16-5p and SESN1 (Fig.   4e–h). [score:4]
Our findings are partly based on the function of miR-16-5p in suppressing SESN1 that regulates the proliferation and apoptosis of myoblast via the p53 signaling pathway, as well as p53-independent myoblast differentiation (Fig.   8). [score:4]
Identification of SESN1 as a direct target of miR-16-5p. [score:4]
Furthermore, our rescue test also showed that co-overexpression of miR-16-5p and SESN1 could neutralize the regulatory roles of miR-16-5p in myoblasts. [score:4]
During breast muscle development in XH chickens, miR-16-5p was expressed at embryonic days 11 (11E) and subsequently increased and peaked at 19E (Fig.   1a). [score:4]
Conversely, miR-16-5p inhibition repressed myoblast apoptosis, suggesting that miR-16-5p has a positive regulatory effect on myoblast apoptosis (Fig  2f, h). [score:4]
b The relative expression of miR-16-5p from miR-16-5p mimic transfected CPMs and QM-7 cells. [score:3]
Fig. 1 a The relative expression of miR-16-5p in chicken embryonic breast muscle. [score:3]
In addition, the 5-ethynyl-2′-deoxyuridine (EdU) assay and cell counting kit-8 (CCK-8) assay demonstrated that miR-16-5p overexpression significantly repressed myoblast viability, while its inhibition promoted their proliferation (Fig  1g–l). [score:3]
The results showed that the seed sequence of miR-16-5p could perfectly match the 3′ UTR position 388–395 of chicken SESN1 mRNA, which suggested SESN1 was a potential target of miR-16-5p (Fig.   4a). [score:3]
To confirm whether miR-16-5p directly targets the 3′ UTR of SESN1, a dual-luciferase reporter assay was carried out in embryonic chicken fibroblast cell line DF-1 cells. [score:3]
Our findings present a novel mo del that elucidates the regulatory mechanism of how miR-16-5p controls muscle development. [score:3]
In both CPM and QM-7 cells, overexpression of miR-16-5p promoted myoblast apoptosis, as revealed by a higher apoptotic cell ratio and fewer viable cells (Fig.   2e, g). [score:3]
As differentiation progressed, the expression level of miR-16-5p significantly decreased, which suggested that miR-16-5p was involved in the process of myoblast differentiation (Fig.   3b). [score:3]
However, how Gga-miR-16-5p regulates the development of skeletal muscle in chicken is still unknown. [score:3]
Moreover, the relative luciferase activity was significantly decreased with the overexpression of miR-16-5p. [score:3]
The relative expressions of miR-16-5p were detected after 48 h of transfection with miR-16-5p mimic (Fig.   1b). [score:3]
miR-16-5p inhibits myoblast proliferation. [score:3]
Moreover, we transfected CPMs with miR-16-5p mimic or inhibitor, and then induced myoblast differentiation. [score:3]
Rinnerthaler, G. et al. miR-16-5p is a stably-expressed housekeeping microRNA in breast cancer tissues from primary tumors and from metastatic sites. [score:3]
b The relative expression of miR-16-5p during CPM differentiation. [score:3]
a The relative expression of miR-16-5p in chicken embryonic breast muscle. [score:3]
In our previous miRNA sequencing data, we found that miR-16-5p was differentially expressed between WRR and XH chickens. [score:3]
In our previous RNA-seq study (accession number GSE62971), we found that miR-16-5p was differentially expressed between fast and slow growth in chicken. [score:3]
In our previous RNA-seq study, we found that both miR-16-5p (accession number GSE62971) [16] and SENS1 (accession number GSE72424) [17] were differentially expressed between WRR and XH chickens (Supplementary File  1). [score:3]
g, i MyHC staining of myoblasts at 72 h after transfection of miR-16-5p mimic and inhibitor in CPMs. [score:3]
On the contrary, G0/G1 cells decreased while S phase cells increased significantly (Fig.   1n), and proliferation was significantly promoted after miR-16-5p inhibition (Fig. 1q, r, t). [score:3]
miR-16-5p inhibits myoblast differentiation. [score:3]
Additionally, we also confirmed that miR-16-5p was involved in myoblast differentiation by targeting SESN1. [score:3]
Mo del of miR-16-5p -mediated regulatory network for myoblast proliferation, apoptosis, and differentiation. [score:2]
MiR-16-5p overexpression significantly increased the number of cells in G0/G1, and significantly decreased the number of S phase cells (Fig.   1m). [score:2]
This was suggestive that miR-16-5p was a potential regulatory factor of SESN1. [score:2]
Recent studies have shown that miR-16-5p plays a regulatory role in the molecular machinery that enhances muscle protein synthesis in response to protein ingestion following concurrent exercise [11]. [score:2]
NC, negative control The present study reveals a role for miR-16-5p in myoblast proliferation, apoptosis, and differentiation. [score:1]
s, t Cell growth was measured following the transfection of miR-16-5p mimic and inhibitor in QM-7 cells. [score:1]
The SESN1-3′ UTR mutant plasmid was generated by changing the binding site of miR-16-5p from TGCTGCT to TATCAGT. [score:1]
The mutant sequence in miR-16-5p binding site is highlighted in red. [score:1]
The recombinant reporter vectors (pmirGLO- SESN1-WT and pmirGLO- SESN1-MT) were co -transfected with miR-16-5p mimic or mimic-normal control (NC). [score:1]
miR-16-5p facilitates myoblast apoptosis. [score:1]
Gga-miR-16-5p is the mature miRNA which results from the two precursor miRNAs (gga-miR-16-1 and gga-miR-16-2), with a mature sequence of 22 nt. [score:1]
We found that the luciferase activity of the wild-type group (SESN1-3′ UTR-WT) was significantly decreased after transfection with miR-16-5p mimic, whereas no significant difference was observed in the mutant group (SESN1-3′ UTR-MT) (Fig.   4b). [score:1]
a The potential binding site of miR-16-5p in the SESN1 mRNA 3′ UTR. [score:1]
miR-16-5p represses myoblast differentiation. [score:1]
miR-16-5p represses myoblast proliferation. [score:1]
miR-16-5p promotes myoblast apoptosis. [score:1]
k, l Cell growth was measured following the transfection of miR-16-5p mimic and inhibitor in CPMs. [score:1]
[1 to 20 of 101 sentences]
2
[+] score: 124
Other miRNAs from this paper: gga-mir-16-1, gga-mir-15a, gga-mir-16-2, gga-mir-15b, gga-mir-15c
Integrating with GWAS results, only miR-16 locates nearby two of the most significantly associated loci (rs14916980 and rs13972116; Supplementary Table S1), which reached genome-wide significance on chicken growth 8. Also, miR-16, the most differentially expressed gene with 3.4-fold down-regulation, plays a critical role in organ growth and development. [score:7]
To verify this, mimic miR-16 was used to up-regulate the expression of miR-16 in DF-1 chicken embryo fibroblast cells (Fig. 4A). [score:6]
Expression analysis revealed that miR-16 expression in the muscle tissue of birds with the homozygous deletion type (low-weight line, n = 4) was much higher than that in the homozygous insertion type (high-weight line, n = 4) (Fig. 1D), while miR-15a showed no significant change (not show), which is consistent with our liver transcriptomic data. [score:5]
Elevating miR-16 expression also suppressed DF-1 chicken embryo fibroblast cell growth. [score:5]
After transfection in DF-1 chicken embryo fibroblast cells and 36 h of culture, the mature miR-16 expression in the insertion types was significantly lower than that in the deletion types (p <  0. 01), while mature miR-15a expression exhibited little changes (Fig. 3E). [score:5]
To search for potentially causal mutations affecting miR-16 expression, we focused on detecting variations in flanking regions of the miR-15a-16 cluster in F0 individuals of Xinghua & White Recessive Rock intercross lines. [score:4]
To determine the relationship between the mutation and miRNA expression level, real time PCR was performed to detect mature miR-15a and miR-16. [score:4]
Additionally, miR-16 promotes cell apoptosis via regulating the Bcl2 gene in tumors and liver disease 26 27. [score:4]
In summary, through co-localization of a QTL for body weight identified by GWAS and elements differentially expressed in liver, we have fine mapped miR-16 as the major candidate gene likely linked to a causal mutation for several growth and body composition traits. [score:4]
The result is of interest that this short insertion mutation is significantly correlated with miR-16 decreased expression in chicken liver and muscle tissues. [score:4]
Our results were consistent with previous reports, in that our study also indicated that miR-16 impacted chicken embryonic development by significantly inhibiting DF-1 chicken embryo fibroblast cell proliferation. [score:4]
We identified a 54-bp insertion close to miR-16 as a causal mutation that likely impacts body weight gain by disrupting miR-16 expression. [score:4]
Collectively, these results confirmed that the insertion mutation in the primary transcript induced a special alternative splicing pattern and decreased mature miR-16 expression. [score:4]
miR-16 inhibits DF-1 chicken embryo fibroblast cell proliferation. [score:3]
In vitro, miR-16 induced G1 arrest in A549 cells by targeting multiple cell cycle genes such as CCND1, CCND3 and CCNE1 20. [score:3]
Mimic miRNA (Qiagen) were used to overexpress miR-16, with negative random RNA mimic as a control. [score:3]
54-bp insertion induces alternative splicing resulting in decreased miR-16 expression. [score:3]
A 54-bp insertion was correlated with miR-16 expression. [score:3]
The curves show that miR-16 significantly inhibited DF-1 chicken embryo fibroblast cell proliferation. [score:3]
Our results supported miR-16 as a highly likely candidate gene, based upon location in the major QTL region by GWAS, and significantly different expression in liver and muscle tissue of fast- versus slow-growing chickens. [score:3]
The showed that miR-16 significantly inhibited DF-1 chicken embryo fibroblast cell proliferation and this effect was constant until 72 h (Fig. 4B). [score:3]
Forty-six genes and miR-15a/16 were successfully detected (Fig. 1A), of which three genes (SUCLA2, CKAP2 and miR-16) exhibited significantly decreased expression in the high weight lines. [score:3]
Through analysis of liver transcriptome differencess between high- and low-weight lines, we reduced the number of candidate genes locatedin the QTL region to three major candidates that showed differential expression, SUCLA2, CKAP2 and miR-16. [score:3]
Take together, our findings revealed a novel causal mutation in miR-16 contributing to genetic regulation of body weight. [score:3]
Another 8 birds from XH and WRR (n = 4 per population) were used to confirm miR-16 expression pattern. [score:3]
miR-16 suppressed embryonic fibroblast proliferation. [score:3]
A 54-bp insertion mutation in the upstream of precusor was identified to be a causative mutation that disrupted miR-16 genesis and contributed to weight gain during most of the growth phase. [score:3]
A 54-bp insertion mutation in 145-bp upstream of precursor miR-15a-16 was identified as the causal mutation, resulting in increased body weight, bone size and muscle mass by disrupting alternative splicing during miR-16 biogenesis. [score:3]
The miR-16 family induces cell cycle arrest in most cancer cells by regulating multiple cell cycle genes 20. [score:2]
Alternative isoform analysis demonstrated that the insertion mutation introduced three novel alternative splicing sites instead of 5′ terminal splicing site of mature miR-16. [score:2]
For miR-16-1, the two loci of rs13972116 and rs14916980, located up- and down-stream of the precursor showed a large effect on chicken growth 8. Thus, we hypothesized that miR-16 should be a causal gene regulating chicken growth. [score:2]
Fst statistical analysis also demostrated that the growth-advantagious allele of the miR-16 insertion mutation was approaching fixation in the fast-growing commercial lines (Fst >  0. 4) during recent artificial selection after long-term domestication. [score:2]
As expected, these observations were generally consistent with our previous results that the 54-bp insertion introduced two novel alternative splicing sites in the mutation region but few splicing sites were detected in the miR-16 5′ terminus. [score:2]
How to cite this article: Jia, X. et al. A short insertion mutation disrupts genesis of miR-16 and causes increased body weight in domesticated chicken. [score:2]
Five types of alternative splicing sites were detected in the insertion individuals without 5′ terminal splicing of mature miR-16, while 3 types of normal alternative splicing sites were detected in the 5′ terminal of mature miR-15 and miR-16 for the deletion individuals (Fig. 3A; Supplementary Table S4). [score:1]
In both in vivo tissue and in vitro cell experiments, the insertion type resulted in lower abundance of mature miR-16. [score:1]
20 nM mimics miR-16 and negative random RNA were transfected into cell lines, separately. [score:1]
20 nM mimic miR-16 and negative random RNA were transfected in DF-1 chicken embryo fibroblast cells, respectively (n = 6). [score:1]
However, no study has yet addressed the impacts of miR-16 on embryo growth. [score:1]
Collectively, these data suggest that miR-16 might affect body growth by repressing growth of various cell types and inducing apoptosis. [score:1]
To investigate the impacts of insertion mutation on mature miR-16, fragments of about 1300 bp in length including the miR-15a-16 precursor and mutation region were constructed into pcDNA3.1(+). [score:1]
[1 to 20 of 41 sentences]
3
[+] score: 121
bcl-2 is a target gene of miR-15a but not miR-16 in chicken lung tissues under hypoxiamiR-15a and miR-16 negatively regulate bcl-2 by directly binding to a particular sequence in the 3′-UTR of bcl-2 and inhibiting its translation [21], [31]. [score:9]
Our observation of hypoxia -induced miR-15a expression (Fig. 1B) and reduced Bcl-2 protein levels at E19 (Fig. 2C) indicated an inverse relationship between miR-15a and Bcl-2 protein expression, which suggested a causative role for miR-15a in the downregulation of bcl-2. However, as a cluster member of miR-15a, miR-16 was identified as hypoxia insensitive. [score:8]
miR-15a and miR-16, two members of the miR-15a/16 cluster, play a role in proapoptosis regulation by inhibiting the translation of the antiapoptotic protein Bcl-2 via binding to the 3′-untranslated region (3′-UTR) of bcl-2 mRNA [21]. [score:8]
To our knowledge, our work is the first to document that chicken miR-15a, but not miR-16, regulates apoptosis by directly targeting chicken bcl-2 at a specific target region during later chick lung CCGS development. [score:8]
miR-15a and miR-16 negatively regulate bcl-2 by directly binding to a particular sequence in the 3′-UTR of bcl-2 and inhibiting its translation [21], [31]. [score:7]
We also showed that only miR-15a and not miR-16 was responsive to the oxygen concentration and induced mesenchymal ablation through direct inhibition of the antiapoptotic gene chicken bcl-2 by binding to a unique target region. [score:6]
In human tumors, E2F1 is a positive regulator of miR-15a and miR-16, but only miR-15a inhibits expression of cyclin E [81]. [score:6]
To determine whether the peak value of miR-15a expression was lung specific or was a systemic reaction to hypoxia and whether expression of miR-15a was the same as that of miR-16, we performed real-time PCR for miR-15a and miR-16 using chick embryo lung, heart, brain and liver at E16 and E19. [score:5]
In co -transfected cells, the miR-15a mimic decreased the expression of hRluc and miR-15a mimic inhibitor rescued hRluc activity; no differences were seen for miR-16. [score:5]
Although miR-15a and miR-16 belong to the same cluster and miRNA family, Yin et al. also reported that miR-15a plays a causative role in the regulation of apoptosis by directly targeting bcl-2 during ischemic vascular injury [22]. [score:5]
Hua and colleagues identified a group of regulatory miRNAs, including miR-16, which regulates the expression of vascular endothelial growth factor [67]. [score:5]
The RNA22/PicTar results showed that the target site sequence complemented only with chicken miR-15a, and the TargetScan result suggested that both the chicken miR-15a and miR-16 would work (data not shown). [score:5]
Together, the results suggested that chicken miR-15a decreased chicken bcl-2 translation by directly acting on a miR-15a–specific response element in the 3′-UTR of chicken bcl-2 mRNA and that this effect may be different in chicken bcl-2 as compared with that in human bcl-2. Chicken miR-16, another member of the cluster, did not affect bcl-2 regulation. [score:4]
To further verify whether miR-15a or miR-16 repressed chicken bcl-2 by binding directly to the predicted binding site in its 3′-UTR as shown in human cells [31], we analyzed the complementation of the chicken bcl-2 mRNA (NM_205339.1) and chicken miR-15a/16 using four different prediction algorithms: TargetScan [33], RNA22 [34], DIANA [35], [36], and PicTar [37]. [score:4]
bcl-2 is a target gene of miR-15a but not miR-16 in chicken lung tissues under hypoxia. [score:3]
0098868.g003 Figure 3 bcl-2 is a target gene of miR-15a, but not miR-16 in chicken lung. [score:3]
In this study, our data suggested that the expression of miR-15a, but not miR-16, is sensitive to the oxygen concentration and was significantly increased in lung mesenchymal cells in chicken. [score:3]
miR-16 shows unequal expression among tissues [68]. [score:3]
gga-miR-16 shows no response to hypoxia, and there is no target site for gga-miR-16 in the 3′-UTR region of gga- bcl-2. (B) Mesenchymal cell death/ablation indeed appeared necessary for the formation of a thinner BGB and is promoted by hypoxia (the oxygen concentration). [score:3]
miR-15a and the binding site in the gga- bcl-2 3′-UTR are shown, but miR-16 shows no target site in this part of the sequence. [score:3]
bcl-2 is a target gene of miR-15a, but not miR-16 in chicken lung. [score:3]
We also found differences in hypoxia -induced expression of miR-15a and miR-16 between high-altitude and plain chicks. [score:3]
miR-16 showed a weak response to stress in the embryonic lung (hW). [score:1]
Chicken miR-16, a cluster and family member of chicken miR-15a, does not affect the hypoxia -induced pathway. [score:1]
Thus, miR-16 also appeared to be affected by hypoxia at a time when the respiratory gas exchange was developing. [score:1]
As a cluster and family member, miR-16 was reported to have the same function as miR-15a [21]. [score:1]
However, there were no clear changes in miR-16 in the other groups. [score:1]
We performed the same experiment with chicken miR-16. [score:1]
We identified a small increase in miR-16 from E16 to E19 in embryonic lung in hW (Fig. 1C). [score:1]
In contrast, Cimmino et al. showed that miR-15a and miR-16 promote apoptosis by posttranscriptional gene silencing of bcl-2 [21]. [score:1]
miR-16 may function during BC network formation, which is perpendicular to the long axis of ACs. [score:1]
Hybridization was done using the 5′-digoxigenin–labeled miRCURY LNA microRNA Detection Probes anti-gga-miR-16 and anti-gga-miR-15a (EXIQON, Vedbaek, Denmark). [score:1]
Although miR-16 belongs to the same cluster and family as miR-15a [21], they were differentially sensitive to hypoxia. [score:1]
However, no change was observed with the chicken miR-16 mimic (Fig. 3C). [score:1]
[1 to 20 of 34 sentences]
4
[+] score: 30
Key findings of the present study were that expression of the DNMT1, DNMT3A and DNMT3B genes are abundantly expressed only in GE of cancerous ovaries as compared to normal ovaries of laying hens, and that expression of DNMT3A and DNMT3B genes are post-transcriptionally regulated by miR-1741, miR-16c, miR-222, or miR-1632, respectively. [score:7]
These results indicate that miR-1741, miR-16c, miR-222, or miR-1632 directly bind to the DNMT3A or DNMT3B transcript, respectively, and post-transcriptionally regulate expression of those genes. [score:5]
These results indicate that miR-1741, miR-16c, miR-222, or miR-1632 directly bind to DNMT3A or DNMT3B transcripts, respectively, and post-transcriptionally regulate expression of the DNMT3A and DNMT3B genes. [score:5]
Similarly, the presence of miR-16c, miR-222, or miR-1632 for DNMT3B, the percentage of GFP -expressing cells was decreased (P<0.01). [score:3]
In addition, as shown in Figure 4, in the presence of miR-16c, miR-222, or miR-1632 for DNMT3B, there was a decrease (P<0.01) in the percentage of GFP -expressing cells (100% in control vs. [score:3]
For the dual fluorescence reporter assay, the fusion contained the DsRed gene and either miR-148a or miR-1612 for DNMT1; miR-1596, miR-1687, miR-1741, or miR-1749 for DNMT3A; and miR-16c, miR-222, or miR-1632 for DNMT3B, and each was designed to be co-expressed under control of the CMV promoter (pcDNA-DsRed-miRNA). [score:2]
org/miRDB/) revealed putative binding sites for miR-148a and miR-1612 (for DNMT1) ; miR-1596, miR-1687, miR-1741, and miR-1749 (for DNMT3A) ; and miR-16c, miR-222, and miR-1632 (for DNMT3B). [score:1]
0061658.g004 Figure 4[A] Diagram of miR-16c, miR-222, and miR-1632 binding sites in the DNMT3B 3′-UTR. [score:1]
[C and D] After co-transfection of pcDNA-eGFP-3′-UTR for the DNMT3B transcript and pcDNA-DsRed-miRNA for the miR-16c, miR-222, and miR-1632, the fluorescence signals of GFP and DsRed were detected using FACS [C] and fluorescent microscopy [D]. [score:1]
85.3% in miR-16c, 40.3% in miR-222, and 25.9% in miR-1632). [score:1]
[A] Diagram of miR-16c, miR-222, and miR-1632 binding sites in the DNMT3B 3′-UTR. [score:1]
[1 to 20 of 11 sentences]
5
[+] score: 30
In 7-week-old chickens, as compared with 14-day-old embryos, the expression of let-7b, miR-30a-5p, miR-30b, miR-99a and miR-133b was significantly up-regulated, but miR-16c, miR-92, miR-106, miR-203, miR-451 and miR-454 were significantly down-regulated in both dwarf and normal chickens. [score:8]
The expression of miR-16c, miR-92, miR-106, miR-203, miR-451, and miR-454 was commonly down-regulated (Table  2). [score:6]
Let-7b -mediated regulation of GHR expressionThe miRNAs involved in the regulation of GHR were let-7b, miR-15c (miR-16, miR-16c), and miR-181b (Additional file 3: Table S3). [score:5]
However, the target sites of miR-15c, miR-16, miR-16c and miR-181b were far apart from the GHR region. [score:3]
But the target locations of miR-16, miR-16c and miR-181b were distant from the deleted region. [score:3]
The miRNAs involved in the regulation of GHR were let-7b, miR-15c (miR-16, miR-16c), and miR-181b (Additional file 3: Table S3). [score:2]
Four miRNAs, let-7b, miR-16, miR-16c, and miR-181b, are involved in the regulation of GHR. [score:2]
GHR was affected by let-7b, miR-15c, miR-16, and miR-16c. [score:1]
[1 to 20 of 8 sentences]
6
[+] score: 15
Therefore, although little is known about the specific functions of several of these miRNAs (e. g. miR-31, miR-101, miR-200b, miR-10b, miR-460, miR-15b, miR-16 and miR203) during muscle development, the close relationship between their targets and myogenesis regulation demonstrates a potential role during muscle development. [score:6]
Seven (miR-101, miR-10a, miR-10b, miR-1677, let-7f, miR-31, and miR-205b) were expressed at higher levels in layers, and ten (miR-203, miR-200b, miR-16c, miR-15b, miR-15c, miR-460, miR-429, let-7c, miR-2188, and gga-miR-N2) were expressed at higher levels in broilers. [score:5]
Six of these miRNAs (miR-31, miR-10a, miR-10b, miR-16C and two let-7 members) have been implicated in skeletal muscle regeneration or development [39- 42]. [score:2]
Little is known about the functional roles of the remaining eight (miR-31, miR-101, miR-200b, miR-10b, miR-460, miR-15b, miR-16 and miR-203) during muscle development. [score:2]
[1 to 20 of 4 sentences]
7
[+] score: 14
A number of miRNAs down-regulated in DT40, including gga-miR-16, -30e, -30d, -30b, -30c, -26a, -147, -15b, and -29a, were also downregulated in CD40L-stimulated cells, suggesting conserved functions of cell division and proliferation. [score:7]
A number of miRNAs, including gga-miR-16, -30e, -30d, -30b, -30c, -26a, -147, -15b, and -29a, down-regulated in DT40 cells were also downregulated in CD40L -treated cells (Figure 3B). [score:7]
[1 to 20 of 2 sentences]
8
[+] score: 13
In addition, miR-15 and miR-16 are negatively correlated with expression of the anti-apoptotic gene BCL-2 [25], which inhibits apoptosis at the level of the mitochondria and is critical for cancer cells [26]. [score:5]
Calin G. A. Dumitru C. D. Shimizu M. Bichi R. Zupo S. Noch E. Aldler H. Rattan S. Keating M. Rai K. Frequent deletions and down-regulation of micro -RNA genes miR15 and miR16 at 13Q14 in chronic lymphocytic leukemia Proc. [score:4]
Cimmino A. Calin G. A. Fabbri M. Iorio M. V. Ferracin M. Shimizu M. Wojcik S. E. Aqeilan R. I. Zupo S. Dono M. MiR-15 and miR-16 induce apoptosis by targeting BCL2 Proc. [score:3]
MiR-15 and miR-16 are located in the 13q14 chromosome region, the partial absence of which was strongly influential in an outbreak of chronic lymphocytic leukemia (CLL). [score:1]
[1 to 20 of 4 sentences]
9
[+] score: 13
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-21, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-9-2, mmu-mir-151, mmu-mir-10b, hsa-mir-192, mmu-mir-194-1, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-122, hsa-mir-10a, hsa-mir-10b, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-210, hsa-mir-214, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-122, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-194-1, mmu-mir-192, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-21a, mmu-mir-10a, mmu-mir-210, mmu-mir-214, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-9-1, mmu-mir-9-3, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-365a, mmu-mir-365-1, hsa-mir-365b, hsa-mir-151a, gga-let-7i, gga-let-7a-3, gga-let-7b, gga-let-7c, gga-mir-16-1, gga-mir-194, gga-mir-10b, gga-mir-199-2, gga-mir-16-2, gga-let-7g, gga-let-7d, gga-let-7f, gga-let-7a-1, gga-mir-199-1, gga-let-7a-2, gga-let-7j, gga-let-7k, gga-mir-122-1, gga-mir-122-2, gga-mir-9-2, mmu-mir-365-2, gga-mir-9-1, gga-mir-365-1, gga-mir-365-2, hsa-mir-151b, mmu-mir-744, gga-mir-21, hsa-mir-744, gga-mir-199b, gga-mir-122b, gga-mir-10a, gga-mir-214, sma-let-7, sma-mir-71a, sma-bantam, sma-mir-10, sma-mir-2a, sma-mir-3479, sma-mir-71b, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-let-7k, gga-mir-365b, sma-mir-8437, sma-mir-2162, gga-mir-9-3, gga-mir-210a, gga-mir-9-4, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3, gga-mir-9b-1, gga-mir-10c, gga-mir-210b, gga-let-7l-1, gga-let-7l-2, gga-mir-122b-1, gga-mir-9b-2, gga-mir-122b-2
For validation of the microarray results, the miRNAs that displayed the largest fold change were quantified by qRT-PCR and normalized to miR-16 (a total of 6 up-regulated miRNAs and 6 down-regulated miRNAs were examined). [score:7]
Figure S2Expression of miR-16 in liver and serum over the time course of S. mansoni infection. [score:3]
To account for differences in RNA extraction or qRT-PCR efficiency, the data were normalised to miR-16, which displayed stable expression in the liver during infection (Fig. S2). [score:3]
[1 to 20 of 3 sentences]
10
[+] score: 7
Other miRNAs from this paper: gga-mir-16-1, gga-mir-16-2
Duplicate RNA samples were prepared and probed separately for Probes were hybridised in-solution to duplicate RNA samples for detection of shEGFP and mir-16 expression. [score:3]
Expression of the miR-16 effector sequence was detected using the mir-16 RNA probe provided with the mirVana Probe & Marker Kit, (Ambion). [score:3]
Detection of miR-16 as a loading control in all transfected and control RNA samples, confirmed the presence of total small RNAs (Fig. 2). [score:1]
[1 to 20 of 3 sentences]
11
[+] score: 6
miR-16 is considered a tumor suppressor [31], which acts by targeting BCL-2, and repressed expression is consistent with tumorigenesis. [score:6]
[1 to 20 of 1 sentences]
12
[+] score: 5
MiR-101-3p (−2.1-fold) and miR-15c-5p (−1.4-fold) had the most target genes followed by miR-15a, miR-16-5p, miR-214, miR-16c-5p, and miR-181b-5p (Supplementary Table S4), and these miRNAs were all down-regulated in L30 compared with L20. [score:5]
[1 to 20 of 1 sentences]
13
[+] score: 4
During HIV infection, the down-regulation of miR-16 results in the activation of the NF-κB signaling pathway, thus enhancing immune responses (Li et al., 2010). [score:4]
[1 to 20 of 1 sentences]
14
[+] score: 3
Typically, tyrosine-protein kinase receptor (CTK-1) can be targeted by three miRNAs, including gga-miR-15c-5p, gga-miR-15a and gga-miR-16-5p. [score:3]
[1 to 20 of 1 sentences]
15
[+] score: 3
Expression patterns of 15 miRNAs identified using RT-PCR agreed with those identified using deep sequencing, miR-101, miR-10a, miR-10b, miR-1677, let-7f, and miR-31 were higher in layers, while miR-200b, let-7c, miR-16c, miR15b, miR-15c, miR460, miR-429, miR-2188, and the novel miR-N2 were higher in broilers. [score:3]
[1 to 20 of 1 sentences]
16
[+] score: 3
Some host miRNAs, including gga-miR-let-7, gga-miR-199a-1, gga-miR-26a, gga-miR-181a, and gga-miR-16, were expressed at lower levels in MDV -induced tumors than non-infected spleens, indicating their potential importance in tumorigenesis. [score:3]
[1 to 20 of 1 sentences]
17
[+] score: 3
Other miRNAs from this paper: gga-mir-16-1, gga-mir-15a, gga-mir-16-2
Several genes also harbored or were near the 11 suggestively significant SNPs, including gga-miR-16a-1 (MIR16–1), deleted in lymphocytic leukemia 2 (DELU2), SPRY domain containing 7 (SPRYD7), potassium channel regulator (KCNRG) and tripartite motif containing (TRIM13). [score:2]
According to the genome of vertebrates, MIR15A, accompanied by MIR16–1 and DELU2 nearby, forms a DLEU2/miR-15a/16–1 cluster to affect chronic lymphocytic leukemia in cancer research [17, 18]. [score:1]
[1 to 20 of 2 sentences]
18
[+] score: 3
To verify the RNA-Seq data, the differential expression of four miRNAs including miR-223, miR-16, miR-205a and miR-222b-5p were validated by qRT-PCR among all four comparisons (Figure 4). [score:3]
[1 to 20 of 1 sentences]
19
[+] score: 2
Further, miR-16 and miR-223 are involved in muscle cell development in chicken [64]. [score:2]
[1 to 20 of 1 sentences]
20
[+] score: 2
Other miRNAs from this paper: gga-mir-16-1, gga-mir-15a, gga-mir-16-2, gga-mir-15b, gga-mir-15c
Insulin-like growth factor 1 (IGF1) gene, which involved in mediating growth and development, had a conserved binding site with miR-15 and miR-16 family in human [32], [33]. [score:2]
[1 to 20 of 1 sentences]
21
[+] score: 1
Another miRNA, miR-16, is in clinical trials since early 2015 for mesothelioma and lung cancer [43]. [score:1]
[1 to 20 of 1 sentences]
22
[+] score: 1
In addition, the lncRNA DLEU2 is well conserved across the vertebrates, it is a host gene for two miRNA genes, miR-15 and miR-16, both of which are also well conserved across the vertebrates (see Fig. B in S1). [score:1]
[1 to 20 of 1 sentences]
23
[+] score: 1
Other miRNAs from this paper: gga-mir-16-1, gga-mir-15a, gga-mir-16-2
MicroRNA-15a and microRNA-16 impair human circulating proangiogenic cell functions and are increased in the proangiogenic cells and serum of patients with critical limb ischemia. [score:1]
[1 to 20 of 1 sentences]