sort by

20 publications mentioning hsa-mir-1915

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-1915. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 22
In the present study, miR-1915 was down-regulated in both its immature and mature form and miR-1915 was significantly deregulated. [score:5]
As shown in Figure 4, we identified the BCL-2 gene as being a specific target of miR-21, miR-181a, miR-181b, miR-29a, miR-29b, miR-497, miR-195, let-7a, miR-34a and miR-1915 (Figure 4 and Table 4). [score:3]
Due to the limited amount of residual available RNA, only 11 ES samples were tested in duplicate qRT-PCR reactions for the expression of miR-181b, miR-1915 and miR-1275 (Figure 3). [score:3]
In our study, the expression profiles of 3 miRNAs such as miR-181b, miR-1915 and miR-1275 were confirmed by qRT-PCR. [score:3]
Xu K. Liang X. Cui D. Wu Y. Shi W. Liu J. miR-1915 inhibits BCL-2 to modulate multidrug resistance by increasing drug-sensitivity in human colorectal carcinoma cells Mol. [score:3]
Further studies suggested a negative regulation of BCL-2 by p53 via-miR-1915 to induce apoptosis. [score:2]
MiR-1915 targets BCL-2 and modulates multidrug resistance of human colorectal carcinoma cells [44]. [score:2]
Some miRNAs such as miR-937, miR-1303, miR-1908, miR-1915, miR-762 and miR-379 had only been experimentally validated in previous studies [12] by next-generation sequencing experiments (NGS), while other miRNAs were validated by alternative methods (Table S4). [score:1]
[1 to 20 of 8 sentences]
2
[+] score: 10
Mechanistically, FOXP2 translation appears to be actively impaired by two successive waves of dysregulated micro -RNAs: initial MSCs (mesenchymal stem cells) -induced expression of a cluster of microRNAs (miR-199a-214, miR-762) led the activation of a secondary network of microRNAs (miR-1915, let-7b, and miR-34a) which subsequently repressed the expression of FOXP2 [9]. [score:8]
These miRs are encoded by loci which are either intragenic (miR-1915 within CASC10 intron) or extragenic (let7b; miR-34A; miR-762 colocalized with BCL7C intron on the reverse strand; miR-199A2 and miR-214 are both colocalized with DNM3OS and miR-199A1 on reverse strand from DNM2). [score:1]
Second, TWIST activates two waves of miRs: the 199a-214 cluster and a set of four other microRNAs (miR-762, miR-1915, let-7b, and miR-34a). [score:1]
[1 to 20 of 3 sentences]
3
[+] score: 9
When comparing the array data from PMNs and skin window PMNs, we found seven differentially regulated miRNAs (miR-297, miR-212, miR-132, miR-132*, miR-1915*, miR-760, and miR-27a*) that were all up-regulated in the extravasated neutrophils. [score:5]
Interestingly, all seven miRNAs (miR-297, miR-212, miR-1915*, miR-132, miR-27a*, miR-760 and miR-132*) were up-regulated in the skin window neutrophils (Fig. 4 and Table S2). [score:4]
[1 to 20 of 2 sentences]
4
[+] score: 8
The expression of miR-3656, miR-1915, and miR-451a was tested in 44 to 55 NSCLCs, and the results showed that these miRNAs were down-regulated in tumour samples compared to paired normal lung tissues (Fig. 1C). [score:5]
To verify the results of the miRNA microarrays, we tested the expression of miR-3195, miR-3656, miR-144, miR-1915, and miR-451a in additional NSCLCs from HPR and CR. [score:3]
[1 to 20 of 2 sentences]
5
[+] score: 8
In the work led by Tilghman et al., DTT (10 μM) or BPA (10 μM) activate ERα in MCF-7 breast cancer cells which down-regulated the expression of miR-21, let-7a-f, miR-15b, and miR-28b and increased the expression miR-638, miR-663, and miR-1915 (Tilghman et al., 2012). [score:8]
[1 to 20 of 1 sentences]
6
[+] score: 7
Among the miRNAs, the function of fifteen downregulated miRNAs (miR-1587, miR-4505, miR-1915-3p, miR-4466, miR-3162-5p, miR-4484, miR-5001-5p, miR-3940-5p, miR-4687-3p, miR-6068, miR-548ao-3p, miR-4687-5p, miR-1273g-3p, miR-877-3p, miR-4312) and the function of two miRNAs that were upregulated (miR-520f-3p, miR-4307) remain unknown. [score:7]
[1 to 20 of 1 sentences]
7
[+] score: 6
29, 30 In addition, recent studies have shown that miR-1915 also targets BCL2 and has an important role in the development of multidrug resistance in colorectal carcinoma cells [31] and that miR-146b-5p reduces migration and invasion of glioma by targeting epidermal growth factor receptor and matrix metalloproteinase 16. [score:6]
[1 to 20 of 1 sentences]
8
[+] score: 5
Interestingly, 14 of these miRNAs (miR-596, miR-630, miR-422a, miR-490-5p, miR-375, miR-708, miR-345, miR-125b-2, miR-516a-3p, miR-135a, miR-1228, miR-1915, miR-134, and miR-663) have established roles in tumor suppression and drug resistance, while 5 miRNAs (miR-630, miR-375, miR-345, miR-1228, and miR-134) are known to inhibit epithelial–mesenchymal transition and invasion in cancer cells. [score:5]
[1 to 20 of 1 sentences]
9
[+] score: 4
In addition, upregulation of miR-638 (P<0.005), miR-663 (P<0.005), and miR-1915 (P<0.005) was observed after treatment of MCF7 cells with E [2], BPA or DDT (Table 2). [score:4]
[1 to 20 of 1 sentences]
10
[+] score: 4
For example, miR-1915 has been reported to be expressed in human eNSCs where it regulates a pro-neurogenic transcript, Notch-1 [31]. [score:4]
[1 to 20 of 1 sentences]
11
[+] score: 4
Nineteen of the downregulated miRNAs in chronic patients were found to be associated with carcinogenesis in various organs and tissues, such as miR-1207 [40], miR-3162-5p [41, 42], miR-3196 [43, 44], miR-371b-5p [45], miR-574-5p [46, 47], miR-1225-5p [48], miR-4485 [49], miR-572 [50], miR-4299 [51], miR-3679-5p [52], miR-3940-5p [53], miR-638 [54, 55], miR-1202 [56], miR-5787 [57], miR-1973 [58], miR-4532 [59], miR-1275 [60], miR-4728-5p [61], and miR-1915-3p [62]. [score:4]
[1 to 20 of 1 sentences]
12
[+] score: 4
73E-02hsa-miR-9402806291.178.74E-02hsa-miR-4459264755761.088.57E-02hsa-miR-2861108122651.074.66E-02hsa-miR-45341052080.994.21E-02hsa-miR-3656261550090.948.13E-02hsa-miR-4530226542250.904.38E-02hsa-miR-44431823260.842.88E-02hsa-miR-42841592760.805.12E-02hsa-miR-4508183629910.702.36E-02hsa-miR-1915-3p180529170.692.12E-02hsa-miR-4298147823140.658.97E-02hsa-miR-4497365153920.566.18E-02Down-regulated (n = 37*)hsa-miR-451a277597−4.833.47E-02hsa-miR-29a-3p778156−2.325.04E-02hsa-miR-99a-5p645162−1.995.83E-02hsa-miR-25-3p386101−1.934. [score:4]
[1 to 20 of 1 sentences]
13
[+] score: 3
BLC2 has been examined with several targeted miRNAs, including miR-491, miR-143, miR-148a, miR-365, miR-1915, miR-204, and miR-125b [4– 6, 8, 29– 31]. [score:3]
[1 to 20 of 1 sentences]
14
[+] score: 2
Following co-culture with LGG or LGG with B. caccae grown under anaerobic conditions, miRNA profiling highlighted differential regulation of a vast number of miRNAs (mir483-3p, mir1229-3p, mir92b, mir1915, mir30b-5p, mir4521, mir193a-5p, mir125a-5p and mir141-3p) linked to colorectal cancer (Fig. 6). [score:2]
[1 to 20 of 1 sentences]
15
[+] score: 2
Our studies with BG01V line of hESC, considered being karyotypically abnormal, identified hsa-mir-1915 and hsa-mir-1274b as differentially expressed at 2 hr and 16 hr post-IR, respectively (Table S2). [score:2]
[1 to 20 of 1 sentences]
16
[+] score: 1
In a recent work Kazuya Nakazawa and colleagues provide evidences regarding the role of an activated p53 on pri-miR-1915 processing in response to DNA damage (Adriamicine) [53]. [score:1]
[1 to 20 of 1 sentences]
17
[+] score: 1
For hsa-miR-1915 and hsa-miR-4275, the same trends were observed, however, missing the alpha level of 0.05. [score:1]
[1 to 20 of 1 sentences]
18
[+] score: 1
Five miRNAs (miR-92a-3p, miR-1915-3p, miR-17-5p, miR-29b-1-5p & miR-15b-5p) from our list of 11 were identical to what this group observed for microarray. [score:1]
[1 to 20 of 1 sentences]
19
[+] score: 1
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-27a, hsa-mir-31, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-16-2, hsa-mir-192, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-181a-2, hsa-mir-205, hsa-mir-181a-1, hsa-mir-214, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-146a, hsa-mir-184, hsa-mir-186, hsa-mir-193a, hsa-mir-194-1, hsa-mir-155, hsa-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-219a-2, hsa-mir-99b, hsa-mir-26a-2, hsa-mir-365a, hsa-mir-365b, hsa-mir-374a, hsa-mir-148b, hsa-mir-423, hsa-mir-486-1, hsa-mir-499a, hsa-mir-532, hsa-mir-590, bta-mir-26a-2, bta-let-7f-2, bta-mir-103-1, bta-mir-148a, bta-mir-16b, bta-mir-21, bta-mir-221, bta-mir-222, bta-mir-27a, bta-mir-499, bta-mir-125b-1, bta-mir-181a-2, bta-mir-205, bta-mir-27b, bta-mir-30b, bta-mir-31, bta-mir-193a, bta-let-7d, bta-mir-148b, bta-mir-186, bta-mir-191, bta-mir-192, bta-mir-200a, bta-mir-214, bta-mir-22, bta-mir-23a, bta-mir-29c, bta-mir-423, bta-let-7g, bta-mir-24-2, bta-let-7a-1, bta-mir-532, bta-let-7f-1, bta-mir-30c, bta-let-7i, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-125b-2, bta-mir-365-1, bta-mir-374a, bta-mir-99b, hsa-mir-374b, hsa-mir-664a, hsa-mir-103b-1, hsa-mir-103b-2, bta-mir-146a, bta-mir-155, bta-mir-16a, bta-mir-184, bta-mir-24-1, bta-mir-194-2, bta-mir-219-1, bta-mir-223, bta-mir-26a-1, bta-mir-365-2, bta-mir-374b, bta-mir-486, bta-mir-763, bta-mir-9-1, bta-mir-9-2, bta-mir-181a-1, bta-mir-2284i, bta-mir-2284s, bta-mir-2284l, bta-mir-2284j, bta-mir-2284t, bta-mir-2284d, bta-mir-2284n, bta-mir-2284g, bta-mir-2339, bta-mir-2284p, bta-mir-2284u, bta-mir-2284f, bta-mir-2284a, bta-mir-2284k, bta-mir-2284c, bta-mir-2284v, bta-mir-2284q, bta-mir-2284m, bta-mir-2284b, bta-mir-2284r, bta-mir-2284h, bta-mir-2284o, bta-mir-664a, bta-mir-2284e, bta-mir-1388, bta-mir-194-1, bta-mir-193a-2, bta-mir-2284w, bta-mir-2284x, bta-mir-148c, hsa-mir-374c, hsa-mir-219b, hsa-mir-499b, hsa-mir-664b, bta-mir-2284y-1, bta-mir-2284y-2, bta-mir-2284y-3, bta-mir-2284y-4, bta-mir-2284y-5, bta-mir-2284y-6, bta-mir-2284y-7, bta-mir-2284z-1, bta-mir-2284aa-1, bta-mir-2284z-3, bta-mir-2284aa-2, bta-mir-2284aa-3, bta-mir-2284z-4, bta-mir-2284z-5, bta-mir-2284z-6, bta-mir-2284z-7, bta-mir-2284aa-4, bta-mir-2284z-2, hsa-mir-486-2, hsa-mir-6516, bta-mir-2284ab, bta-mir-664b, bta-mir-6516, bta-mir-219-2, bta-mir-2284ac, bta-mir-219b, bta-mir-374c, bta-mir-148d
48164101:+ bta-miR-191′-5pbta-mir-191′bta-miR-1915.540gaacgaaauccaagcgcagcug220gcugcuuuugggauuccguugcc2322:51543481.. [score:1]
[1 to 20 of 1 sentences]
20
[+] score: 1
Wan Y. Cui R. Gu J. Zhang X. Xiang X. Liu C. Qu K. Lin T. Identification of four oxidative stress-responsive microRNAs, miR-34a-5p, miR-1915-3p, miR-638, and miR-150-3p, in hepatocellular carcinomaOxid. [score:1]
[1 to 20 of 1 sentences]