sort by

18 publications mentioning bta-mir-152

Open access articles that are associated with the species Bos taurus and mention the gene name mir-152. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 266
The inhibition of DNMT1 by the over -expression of miR-152 significantly enhanced demethylation, which in turn up-regulated the expression of AKT and PPARγ. [score:10]
These results showed that miR-152 down-regulated DNMT1 to inhibit GDM and the activity of DNMT, leading to a higher expression of AKT and PPARγ. [score:8]
To assess whether over-expressed miR-152 led to demethylation and induction of AKT and PPARγ in DCMECs through blocking DNMT1 expression in DCMECs, we first analyzed the expression of AKT and PPARγ. [score:7]
Expression of AKT and PPARγ during miR-152 over -expression and inhibition in DCMECs. [score:7]
Our results showed that the over -expression of miR-152 increased the viability of DCMECs, while the inhibition of miR-152 decreased the viability of DCMECs, suggesting that miR-152 may regulate cell viability. [score:6]
The activity of DNMT was significantly suppressed following over -expression of miR-152 compared to that following over -expression of miR-NC. [score:6]
It was reported that miR-152 can target DNMT1 and induce aberrant DNA methylation in HBV-related hepatocellular carcinoma [15] and that miR-152 targets DNMT1 in Nis-transformed cells via a feedback mechanism [37], [39]. [score:5]
We observed a markedly lower luciferase activity in cells expressing the reporter with miR-152 than in those expressing the reporter with miR-NC (P<0.05). [score:5]
To understand the effects of miR-152 on the expression of the lactation signal transduction genes in the present study, we used western blotting and qRT-PCR analysis to observed alterations in DCMECs transfected with miR-152 mimics or inhibitors. [score:5]
However, the expression of DNMT1 in the group with over-expressed miR-152 was not significantly different than that in the group treated with 5-Aza (P>0.05). [score:5]
The miR-152 targets predicted by computational algorithms [25] were obtained from TargetScan 4.0 and miRBase [26]. [score:5]
B: Over -expression of miR-152 increases cell viability, whereas the inhibition of miR-152 show the opposite results. [score:5]
By contrast, the inhibition of miR-152 increased the DNMT1 expression. [score:5]
The over -expression of miR-152 repressed the expression of DNMT1 at both the mRNA and protein levels in DCMECs. [score:5]
The results showed that the over -expression of miR-152 reduced DNMT1 expression at both the mRNA and protein levels in DCMECs. [score:5]
MiR-152 inhibits DNMT1 expression. [score:4]
Values are means ± SD, * P<0.05 To test the hypothesis that miR-152 down-regulates DNMT1 in DCMECs, we transfected miR-152, Anti-152, or their respective controls into DCMECs. [score:4]
In addition, the levels of β-casein, triglyceride and lactose were markedly increased by miR-152 over -expression and decreased by inhibition of miR-152 compared to those levels in control groups. [score:4]
MiR-152 targets DNMT1 and represses the expression of DNMT1 mRNA and protein. [score:4]
Through down -regulating the expression of DNMT1, miR-152 reduced GDM and the activity of DNMT to reactivate the lactation signal transduction genes Akt and Pparγ. [score:4]
The over -expression of miR-152 in DCMECs increased the mRNA and protein levels of AKT and PPARγ compared with those levels in control groups, whereas the inhibition of miR-152 showed the opposite results. [score:4]
miR-152 regulates DNMT1 expression by binding its 3′ UTR. [score:4]
In addition, miR-152 and miR-185 were shown to be involved in cisplatin-resistant ovarian cancer in vitro and in vivo through their direct targeting of DNMT1 [40]. [score:4]
DNMT1 is a direct target of miR-152. [score:4]
Under -expression of miR-152 induces aberrant DNA hypermethylation in DCMECs. [score:3]
We provided evidence using luciferase activity assays to suggest that DNMT1 is a potential target of miR-152, indicating that miR-152 is involved in the regulation of DNMT1. [score:3]
We assessed the expression of miR-152 in mammary gland tissues from cows using both small RNA sequencing and qRT-PCR techniques. [score:3]
By contrast, inhibition of miR-152 showed the opposite results (Figure 5B; P<0.05 and P<0.01, respectively). [score:3]
miR-152 is up-regulated in mammary gland tissues of cows producing high quality milk compared with those producing low quality milk. [score:3]
Therfore, it was proposed that miR-152 could regulate mammary gland development and lactation at the post-transcriptional level in Holstein dairy cows. [score:3]
Thus, we speculated that miR-152 might regulate mammary gland development through a mechanism different from those previously described. [score:3]
The DCMECs were transfected with miR-152 mimics (miR-152), miR-152 inhibitors (Anti-152) and negative controls (miR-NC, Anti-NC) (GenePharma, Shanghai, China) using siRNA-Mate (GenePharma) according to the manufacturer's instructions. [score:3]
0101358.g006 Figure 6Proliferation and viability of DCMECs were measured using CASY-TT after the transfection of miR-152, Anti-152, or their respective controls for 0 h, 24 h, 48 h, 72 h; A: Over -expression of miR-152 increases cell proliferation after 48 h and 72 h, whereas the inhibition of miR-152 show the opposite results. [score:3]
These results suggest that the gene for DNMT1 is a potential target for miR-152. [score:3]
In the present study, we showed that miR-152 exerted its effects by specifically targeting DNMT1 in cow mammary glands. [score:3]
We found that the expression of miR-152 differed in cow mammary gland tissues during the various lactation periods using small RNA sequencing and qRT-PCR. [score:3]
A: results for miR-152; B: The mRNA expression levels of miR-152 determined by qRT-PCR. [score:3]
Under -expression of miR-152 increases GDM and DNMT activity. [score:3]
By contrast, the inhibition of miR-152 resulted in a significant decrease in these levels (P<0.05). [score:3]
The expression of miR-152 in mammary glands from dairy cows producing different milk qualities. [score:3]
The inhibition of miR-152 showed the opposite result (Figure 4B, P<0.05). [score:3]
To determine whether DNMT1 is regulated by miR-152 through direct binding to its 3′ UTR, the 3′ UTR was constructed and cloned downstream of the luciferase gene in a pMIR-Report vector (Ambion) and cotransfected with miR-152 or miR-NC in HEK-293 cells and in DCMECs. [score:3]
The relative expression of miR-152 was determined in two groups (n = 3 animals per group). [score:3]
We also investigated whether the inhibition of miR-152 expression could lead to DNA hypermethylation and increase DNMT activity. [score:3]
Using small RNA sequencing, we found that the level of miR-152 was significantly up-regulated in the mammary gland tissues of cows producing high quality milk (H) compared with that in cows producing low quality milk (L) as shown in Figure 1A (P<0.01). [score:3]
The over -expression of miR-152 led to a decrease in GDM and in the activity of DNMT. [score:3]
By contrast, inhibiting miR-152 resulted in the opposite effect (Figure 7B, P<0.05). [score:3]
The results showed that enhancing miR-152 caused an increase in total cell number as well as in cell viability in 48 h and 72 h (Figure 6A and 6B, P<0.05), whereas the inhibition of miR-152 showed the opposite results (Figure 6C, and 6D, P<0.05). [score:3]
Proliferation and viability of DCMECs were measured using CASY-TT after the transfection of miR-152, Anti-152, or their respective controls for 0 h, 24 h, 48 h, 72 h; A: Over -expression of miR-152 increases cell proliferation after 48 h and 72 h, whereas the inhibition of miR-152 show the opposite results. [score:3]
D: Dnmt1 mRNA expression after treatment with miR-152, Anti-152, 5-Aza or their respective controls in DCMECs. [score:3]
0101358.g001 Figure 1A: results for miR-152; B: The mRNA expression levels of miR-152 determined by qRT-PCR. [score:3]
According to the prediction analysis, the key enzyme in DNA methylation, DNMT1, has a putative miR-152 -binding site mapped to the 3′ UTR and was identified as one of the high-scoring candidate genes for miR-152 targeting, as shown in Figure 3A. [score:3]
E: DNMT1 protein expression of DCMECs treated with miR-152, Anti-152, 5-Aza or their respective controls. [score:3]
Therefore, in the present study, we tested whether miR-152 regulates DNMT1, which in turn influences lactation-related genes in dairy cow mammary epithelial cells (DCMECs). [score:2]
Moreover, miR-152 was involved in the regulation of cell cycle progression. [score:2]
We also observed that the expression of miR-152 was markedly higher in the mammary gland tissues of cows producing H compared with those producing L using qRT-PCR, validating the small RNA sequencing results (Figure 1B, P<0.05). [score:2]
Here we suggest that miR-152 functions as a novel regulator to promote proliferation in DCMECs proliferation. [score:2]
MiR-152 increases the expression of AKT and PPARγ. [score:2]
The expression levels of AKT and PPARγ mRNA were markedly increased (P<0.05, P<0.01, respectively) in the cells transfected with miR-152 compared with those levels in cells transfected with miR-NC (Figure 5A). [score:2]
The protein levels for AKT, phospho-AKT (p-AKT) and PPARγ were also markedly increased in the miR-152 groups compared with those levels in the miR-NC groups (Figure 5D; P<0.05, P<0.01, P<0.05 respectively); the inhibition of miR-152 showed the opposite results (Figure 5E, P<0.05 for all comparisons). [score:2]
As shown in Figure 8, over -expression of miR-152 markedly increased the levels of β-casein, triglyceride and lactose in cells compared with those levels in control groups. [score:2]
In summary, our results revealed that miR-152 was specifically involved in mammalian mammary gland development and lactation. [score:2]
The TaqMan MicroRNA Assay Kit (GenePharma) was used to detected the expression of mature miR-152 and the internal control 5S gene. [score:2]
miR-152 regulates cell cycle after transfection. [score:2]
In the present study, we used small RNA sequencing to investigate the levels of miRNA expression in mammary gland tissues from cows producing H and L and identified an miRNA, miR-152, the expression of which was increased in cows producing H compared with those producing L. This result was validated using qRT-PCR. [score:2]
These results indicated that miR-152 can enhance the PI3K/Akt signaling pathway and increase PPARγ and the secretion of β-casein, triglyceride and lactose. [score:1]
These results suggested that miR-152 promoted cell proliferation and viability. [score:1]
Subsequently, to confirm our results of an inverse correlation between miR-152 and DNMT1 levels, we found that demethylation treatment using 5-Aza blocked both de novo and maintenance DNMT pathways in DCMECs. [score:1]
Our results demonstrated that the transfection of miR-152 decreased the population of DCMECs in the G1 phase, indicating that miR-152 accelerated cell cycle progression. [score:1]
0101358.g007 Figure 7A: DCMECs were treated with miR-152 and miR-NC and stained with propidium iodide (PI) for flow cytometry. [score:1]
0101358.g008 Figure 8A: Secretion of β-casein after DCMECs were transfected with miR-152, Anti-152, or their respective controls; B: Secretion of triglyceride (TG) after DCMECs were transfected with miR-152, Anti-152, or their respective controls; C: Secretion of lactose after DCMECs were transfected with miR-152, Anti-152, or their respective controls. [score:1]
0101358.g005 Figure 5A: mRNA levels of Akt and Pparγ following transfection of DCMECs with miR-152 and miR-NC; B: mRNA levels of Akt and Pparγ following transfection of DCMECs with Anti-152 and Anti-NC; C: mRNA levels of Akt and Pparγ following treatment with 5-Aza; D: Protein levels of AKT, p-AKT and PPARγ following transfection of DCMECs with miR-152 and miR-NC; E: Protein levels of AKT, p-AKT and PPARγ following transfection of DCMECs with Anti-152 and Anti-NC; F: Protein levels of AKT, p-AKT and PPARγ following treatment with 5-Aza. [score:1]
miR-152 influences secretion of β-casein, triglyceride and lactose in mammary epithelial cells. [score:1]
The firefly luciferase reporter vector (0.4 µg) together with 100 nM miR-152 or miR-NC were cotransfected into the DCMECs and HEK-293 cells using Lipofectamine 2000 (Invitrogen) according to the manufacturer's protocol. [score:1]
miR-152 promotes cell proliferation after transfection. [score:1]
0101358.g004 Figure 4A: GMD ratios of DCMECs after the transfection of miR-152, Anti-152, or their respective controls. [score:1]
However, the involvement of miR-152 in the mammary gland at the molecular level is poorly understood. [score:1]
Furthermore, we confirmed that the levels of miR-152 are inversely correlated with those of DNMT1 in cow mammary gland tissues. [score:1]
However, the role of miR-152 in cell cycle progression warrants further study. [score:1]
A: GMD ratios of DCMECs after the transfection of miR-152, Anti-152, or their respective controls. [score:1]
0101358.g003 Figure 3A: miR-152 binds to the 3′ UTR of DNMT1 in position 48–55. [score:1]
B: DNMT activity of DCMECs after the transfection of miR-152, Anti-152, or their respective controls. [score:1]
A: mRNA levels of Akt and Pparγ following transfection of DCMECs with miR-152 and miR-NC; B: mRNA levels of Akt and Pparγ following transfection of DCMECs with Anti-152 and Anti-NC; C: mRNA levels of Akt and Pparγ following treatment with 5-Aza; D: Protein levels of AKT, p-AKT and PPARγ following transfection of DCMECs with miR-152 and miR-NC; E: Protein levels of AKT, p-AKT and PPARγ following transfection of DCMECs with Anti-152 and Anti-NC; F: Protein levels of AKT, p-AKT and PPARγ following treatment with 5-Aza. [score:1]
These results indicated that the growth-promoting effect of miR-152 was due to a reduction in G0/G1 arrest. [score:1]
The levels of global DNA methylation in individual samples after transfection with miR-152, anti-miR-152 and their respective controls were determined using a 5-mC DNA ELISA Kit (ZYMO, Irvine, CA, USA)according to the manufacturer's protocol. [score:1]
1 phRL-TK and empty pMIR-REPORT vector cotransfection; 2 miR-152, phRL-TK, empty pMIR-REPORT vector cotransfection; 3 miR-NC, phRL-TK, DNMT1-pMIR-REPORT vector cotransfection and 4 miR-152, phRL-TK, DNMT1-pMIR-REPORT vector cotransfection. [score:1]
DCMECs were transfected with miR-152, Anti-152, or their respective controls and then were incubated in microplates at 37°C with 5% CO [2] for 0 h, 24 h, 48 h and 72 h. The cell viability at each time point was determined with a CASY-TT Analyser System (Schärfe System GmbH, Reutlingen, Germany) according to the manufacturer's instructions. [score:1]
QRT-PCR was repeated three times for miR-152 detection. [score:1]
MiR-152 is one of the three members of the miR-148/152 family, which contain miR-148a, miR-148b and miR-152. [score:1]
In addition, miR-152 significantly altered the viability of the DCMECs as well as the secretion of β-casein, triglyceride and lactose. [score:1]
A: DCMECs were treated with miR-152 and miR-NC and stained with propidium iodide (PI) for flow cytometry. [score:1]
A: Secretion of β-casein after DCMECs were transfected with miR-152, Anti-152, or their respective controls; B: Secretion of triglyceride (TG) after DCMECs were transfected with miR-152, Anti-152, or their respective controls; C: Secretion of lactose after DCMECs were transfected with miR-152, Anti-152, or their respective controls. [score:1]
To dissect the mechanism of the proliferative effect of miR-152, we determined whether growth promotion was associated with specific cell cycle control. [score:1]
We also provided insights regarding the involvement of miR-152 in the control of DNA methylation mediated through the targeting of DNMT1 in DCMECs by measuring GDM and the activity of DNMT. [score:1]
Values are means ± SD, * P<0.05 A: miR-152 binds to the 3′ UTR of DNMT1 in position 48–55. [score:1]
[1 to 20 of 95 sentences]
2
[+] score: 188
ACAA2 and HSD17B12 were down-regulated by miR-152To test whether miR-152 down-regulates the expression of ACAA2 and HSD17B12, miR-152 mimics and miR-152 inhibitor were transfected into MECs and the expressions of GFP protein can be observed in cells transfected with miR-152 mimics, miR-152 inhibitor and miRNA-ShNC (Fig.   2), suggesting that the transfection was successful. [score:15]
To test whether miR-152 down-regulates the expression of ACAA2 and HSD17B12, miR-152 mimics and miR-152 inhibitor were transfected into MECs and the expressions of GFP protein can be observed in cells transfected with miR-152 mimics, miR-152 inhibitor and miRNA-ShNC (Fig.   2), suggesting that the transfection was successful. [score:12]
MiR-152-3p might also act as a tumor suppressor in human breast cancer cells via negatively regulating PIK3CA expression to inhibit the activation of AKT and RPS6, leading to the suppression of HCC1806 cells proliferation [40]. [score:9]
Moreover, transfection of miR-152 mimics significantly decreased the expressions of ACAA2 and HSD17B12 at both mRNA and protein levels, indicating that miR-152 down-regulated the expression of both ACAA2 and HSD17B12 genes. [score:8]
Our results suggested that miR-152 could regulate fatty acid metabolism by directly targeting ACAA2, HSD17B12, which in turn inhibited cellular apoptosis, promoted cell proliferation and enhanced triglyceride production. [score:7]
The results showed that the apoptosis rates were 14.59%, 21.99% and 18.1% in MECs transfected with the mimics, inhibitor and shNC of miR-152, respectively (Fig.   4A), suggesting that overexpression of miR-152 inhibited the apoptosis of MECs. [score:7]
Triglyceride production was upregulated in MECs transfected with miR-152 mimics, and no significant differences were observed in MECs transfected with inhibitor, shNC and blank, respectively (Fig.   4C) (p < 0.05). [score:6]
Nie, L. et al. Progesterone-Induced miR-152 Inhibits the Proliferation of Endometrial Epithelial Cells by Downregulating WNT-1. Reprod Sci, 1933719116689595, 10.1177/1933719116689595 (2017). [score:6]
ACAA2 and HSD17B12 were the direct target genes of miR-152 which were verified in MECsMany target genes of miR-152 were predicted by high-throughput sequencing. [score:6]
Our results also indicated that miR-152 could suppress the expression of ACAA2 and HSD17B12 by reducing the stability of mRNA. [score:5]
It has been reported that simultaneous inhibition of miR-148a and miR-152 could significantly protect MCF-7 cells from 4-OHT induced cell viability reduction and inhibit cell apoptosis [39]. [score:5]
To validate the miR-152 effects on the target genes and triglyceride production, 150 µL Opti-MEM serum-free medium was mixed with 5 µL of lipofectamine TM 2000 and 1.25 µL 20 µmol of the miR-152 mimics, inhibitor and miR-shNC. [score:5]
The expression levels of U6 small nuclear RNA was used as housekeeping gene of miR-152, and GAPDH was used as reference genes of target genes individually. [score:5]
MiR-152 inhibits tumor cell growth by directly targeting RTKN in hepatocellular carcinoma [41]. [score:5]
To determine the effects of miR-152 and target genes on MECs proliferation, miR-152, ACAA2, HSD17B12 were overexpressed or silenced in MECs using the cell transfection methods individually. [score:5]
ACAA2 and HSD17B12 were down-regulated by miR-152. [score:4]
Our results suggested that miR-152 represses the expression of ACAA2 and HSD17B12 through a direct interaction with the 3′ UTR regions of the ACAA2 and HSD17B12. [score:4]
The results showed that the expression levels of miR-152 were remarkably increased in MECs transfected with miR-152 mimics as compared with that transfected with miR-152 inhibitor and miRNA-shNC (Fig.   3A). [score:4]
Ge, S., Wang, D., Kong, Q., Gao, W. & Sun, J. Function of MiR-152 As a Tumor Suppressor in Human Breast Cancer By Targeting PIK3CA. [score:4]
In summary, ACAA2 and HSD17B12, two important genes involved in lipid metabolism, were targeted and regulated by miR-152. [score:4]
ACAA2 and HSD17B12 were the direct target genes of miR-152 which were verified in MECs. [score:4]
MiR-152 and miR-185 could co- target DNMT1 (DNA Methyltransferase 1) in ovarian cancer cells 18, 19. [score:3]
Many target genes of miR-152 were predicted by high-throughput sequencing. [score:3]
These results further confirmed that ACAA2 and HSD17B12 were target genes of miR-152. [score:3]
Similarly, our results showed that miR-152 could inhibit apoptosis and promote cell proliferation in MECs. [score:3]
The apoptosis rate of MECs transfected with the miR-152 mimics, miR-152 inhibitor and miRNA-shNC were examined using flow cytometry. [score:3]
Vectors of miR-152 mimics, miR-152 inhibitor and miR-shNC were purchased from GenePharma Company in China. [score:3]
Bioinformatics analysis suggest that ACAA2 (acetyl-CoA acyltransferase 2) and HSD17B12 (hydroxysteroid 17-beta dehydrogenase 12) are both potential target genes of miR-152. [score:3]
Cells were subsequently analyzed by flow cytometry (BD, USA) to verify the effect of miR-152 and target genes on cell apoptosis. [score:3]
Triglyceride was extracted from cells transfected with miR-152 mimics, miR-152 inhibitor, miRNA-ShNC, PBI-CMV3-ACAA2/HSD17B12 and sh234-ACAA2-181/sh234-HSD17B12-474 following the manufacturer’s instructions (Sigma, USA). [score:3]
Nonetheless, the effects of miR-152 expression on MECs have not been well studied. [score:3]
It has been reported that miR-152 might be involved in the carcinogenesis of ovarian cancer through deregulation of cell proliferation and might be a novel biomarker for early detection or therapeutic purpose [16]. [score:2]
Figure 1Target sites of miR-152 and luciferase assay. [score:2]
MiR-152 promoted cell proliferation and inhibited apoptosis. [score:2]
Here we identified the regulatory roles of miR-152 on ACAA2 and HSD17B12 in triglyceride production and apoptosis of MECs. [score:2]
MiR-152 affects cell cycle progression in non-small cell lung cancer and liver cancer by targeting WNT-1 protein [17]. [score:2]
The reverse transcription primers and fluorescence labeled primers for quantitative analysis of miR-152 and target genes were designed using Primer 6.0 as shown in Table  1. MECs transfected with miR-152 mimics, miR-152 inhibitor and miRNA-ShNC were harvested at 48 h post-transfection and total RNA from cultured cells was extracted by using TRIzol reagent (Ambion, Austin, TX, USA) according to the manufacturer’s instructions. [score:2]
In recent years, increased studies indicate that miR-152 is involved in lipid metabolism, for example, miR-152 regulates DNMT1, which in turn influences lactation-related genes in dairy cow mammary epithelial cells [20]. [score:2]
The cellular proliferation rate was determined by an MTT assay after the cells were transfected with miR-152 mimics, miR-152 inhibitor, miRNA-ShNC and cultured for 0, 12, 24, 36, 48 or 72 h. As shown in Fig.   4A, miR-152 mimics induced a significant decrease on the proliferation rate of MECs (p < 0.01) (Fig.   4B). [score:2]
Regulation of triglyceride production by miR-152. [score:2]
The cells were transiently co -transfected with 0.5 μg of reporter plasmids (pmiR-RB-REPORT-ACAA2-mut/WT/si or pmiR-RB-REPORT-HSD17B12-mut/WT/si) and miR-152 mimics. [score:1]
Previous studies on miR-152 are mostly focused on tumor. [score:1]
For luciferase activity detection, 150 µL Opti-Minimal Essential Medium (MEM) serum-free medium (GIBCO, Grand Island, NY, USA) was mixed with 5 µL lipofectamine TM 2000 (Invitrogen, USA) and 1.25 µL 20 µmol of the miR-152 mimics and 500 ng pmiR-RB-REPORT vectors. [score:1]
The present study aims to identify the role of miR-152 in mammary epithelial cells. [score:1]
There are also evidences suggest that miR-152 is associated with epigenetics. [score:1]
The mature sequence of miR-152, a member of the miR-148/152 family (miR-148a, miR-148b, and miR-152), is relatively conservative [15]. [score:1]
Further study of miR-152 in lipid metabolism and apoptosis in MECs might establish this microRNA as a novel biomarker for marker assisted selection of Holstein dairy cows, especially in the selection of butterfat rate. [score:1]
In addition, miR-152 could influence mammary epithelial cells apoptosis and triglyceride formation. [score:1]
In addition, miR-152 could enhance the viability and multiplication capacity of DCMECs [20]. [score:1]
Both ACAA2 and HSD17B12 genes had one miR-152 binding sites in 3′UTR region. [score:1]
[1 to 20 of 50 sentences]
3
[+] score: 34
Other miRNAs from this paper: bta-mir-148a, bta-mir-148b, bta-mir-148c, bta-mir-148d
We integrated a fragment of the bovine MHC-I heavy chain 3′-UTR containing the target sequence or a fragment in which the target sites were mutated into the luciferase reporter vector and cotransfected this vector with bta-miR-148b mimics, bta-miR-152 mimics, or scrambled oligonucleotides. [score:5]
Product size (bp) MHC class I heavy chain TATGTGGACGACACGCAGT NM_001038518.2 188 TCGCTCTGGTTGTAGTAGCC β-Actin CTCTTCCAGCCTTCCTTCCT BC102948 124 GGGCAGTGATCTCTTTCTGC The bEECs were transfected with 50 nM bta-miR-148b and bta-miR-152 mimics, inhibitors, or corresponding negative control constructs (GenePharma, China) using Lipofectamine 2000 following the producer’s directions. [score:4]
Additional assays were performed to determine whether bta-miR-148b and bta-miR-152 expression is involved in the regulation of bovine MHC-I molecules. [score:3]
org, two miRNAs were suggested to target the 3′UTR of the bovine MHC-I heavy chain: bta-miR-148b and bta-miR-152. [score:3]
Then, we analyzed the expression of bta-miR-148b and bta-miR-152 in bEECs challenged with IFN-τ using qRT-PCR analysis. [score:3]
Figure 2bta-miR-148b and bta-miR-152 target the bovine MHC class I (MHC-I) heavy chain gene. [score:3]
Using the prediction software TargetScan6.2, we found that bta-miR-148b and bta-miR-152 could potentially target the 3′UTR of the MHC-I heavy chain according to the calculation of minimum free energy (Figure 2A). [score:3]
The results showed that bta-miR-148b and bta-miR-152 expression was reduced, but the level of bovine MHC-I heavy chain mRNA was increased by IFN-τ treatment (Figure 1B). [score:3]
bta-miR-148b and bta-miR-152 Target the Bovine MHC-I Heavy Chain Gene. [score:3]
PC, positive control (bta-miR-148b sponge and bta-miR-152 sponge). [score:1]
To prepare bta-miR-148b/152-GLO vectors, PCR amplification was performed on bta-miR-148b and bta-miR-152 sponges. [score:1]
Each plate was transfected with 80 ng of pmirGLO-MHC-I heavy chain/WT vector or pmirGLO-MHC-I heavy chain/MUT vector containing firefly luciferase and the pRLTK vector (Promega, USA) containing bta-miR-148b-GLO, bta-miR-152-GLO, or control-GLO (pmirGLO, Promega). [score:1]
To confirm that bta-miR-148b and bta-miR-152 directly bind the 3′UTR of the bovine MHC-I heavy chain, a dual luciferase reporter assay was performed in HEK-293 cells. [score:1]
[1 to 20 of 13 sentences]
4
[+] score: 34
Taken together, three miRNAs were screened which may be regulators in milk fat metabolism by affecting their predicted target genes; they were bta-miR-33a, predicted target gene ELOVL5, ELOVL6 and SC4MOL; bta-miR-152, predicted target gene PTGS2, PRKAA1 and CUP3; bta-miR-224, predicted target gene LPL, GST, ALOX15 and PTGS1. [score:10]
Therefore we might conclude that the down-regulation of bta-miR-152 caused the up-regulation of PRKAA1, inhibited the Glyconeogenesis and finally decreased the milk fat biosynthesis in mammary gland. [score:9]
More importantly, three miRNAs including bta-miR-33a, bta-miR-152 and bta-miR-224 were further validated that have potential regulatory functions in milk fat metabolism together with their predicted target genes. [score:4]
By analyzing their potential target genes that annotated to four pathways related to lipid metabolism, six miRNAs were filtered including bta-miR-33a, bta-miR-21*, bta-miR-29b, bta-miR-152, bta-miR-224 and bta-miR-887. [score:3]
The bta-miR-224, bta-miR-152 and bta-miR-33a, which were differentially expressed between pMEC-HH and pMEC-LL were also identified in abundance in the human lipid fraction [29], human skim milk [30], human colostrum [30], as well as in bovine skim milk and colostrum [31], suggesting that they play important roles in the lipid metabolism and/or synthesis in the mammary gland. [score:3]
In terms of predicted targets of bta-miR-152, we found that they were all key genes in the pathway of fatty acids metabolism. [score:3]
They are bta-miR-33a, bta-miR-152 and bta-miR-224. [score:1]
They included bta-miR-193a-3p, bta-miR-33a, bta-miR-21*, bta-miR-152, bta-miR-29, bta-miR-224, bta-miR-222 and bta-miR-877. [score:1]
[1 to 20 of 8 sentences]
5
[+] score: 26
Milk-derived DNMT -targeting exosomal miRNAs (miRNA-148a, miRNA-152, miRNA-21, miRNA-29s) may play a pivotal epigenetic role in reducing CpG methylation of critical gene regulatory sites of FTO resulting in increased FTO expression required for increased postnatal mRNA transcription (Figure 2) [135]. [score:6]
This in turn led to a decrease in global DNA methylation and increased the expression of two lactation-related genes, serine/threonine protein kinase AKT and peroxisome proliferator-activated receptor-γ (PPARG), whereas inhibition of miRNA-152 showed the opposite results. [score:5]
The expression of DNMT1 is inversely related to the expression miRNA-148a and miRNA-152 [119, 120]. [score:5]
The generation of DNMT -targeting miRNAs (miRNA-152, miRNA-148a, miRNA-29, miRNA-21) is thus a fundamental epigenetic mechanism increasing lactation-specific gene transcription thereby enhancing lactation performance as well as milk yield in domestic animals. [score:3]
The forced expression of miRNA-152 in dairy cow MECs resulted in a marked reduction of DNMT1 at both mRNA and protein levels. [score:3]
Wang et al. [116] found that the expression of miRNA-152 significantly increased during lactation in the mammary glands of dairy cows producing high quality milk compared with miRNA-152 levels in cows producing low quality milk. [score:2]
Furthermore, miRNA-152 enhanced the viability and multiplication capacity of dairy cow MECs [116]. [score:1]
miRNA-148a, miRNA-148b, and miRNA-152 are three members of the miRNA-148/152 family that share substantial homology in their seed sequence. [score:1]
[1 to 20 of 8 sentences]
6
[+] score: 22
We found the expression levels of bta-miR-184, novel-3, bta-miR-200a, bta-miR-200b, and bta-miR-200c were increased, but the expression of bta-miR-152 was significantly down-regulated in IFN-τ treatment. [score:8]
For instance, miR-148a and miR-152 down-regulate human leukocyte antigen-G (HLA-G) expression, contributing to a healthy pregnancy [21]. [score:6]
In our results, the antigen processing and presentation and allograft rejection pathways were targeted by miRNAs including bta-miR-148a, bta-miR-148b, bta-miR-152, bta-miR-375, bta-miR-3431, novel_3, bta-miR-224, bta-miR-199a-5p, bta-miR-504, bta-miR-200b, bta-miR-200c, and bta-miR-429. [score:3]
A study demonstrated that HLA-G, an immunomodulatory molecule, is mainly expressed by extravillous cytotrophoblasts and controlled by miR-148a and miR-152 in humans [21]. [score:3]
Moreover, many reports have demonstrated that miR-152 played a vital role in immune regulation [31, 32], which was also observed in our study (Supplementary Table 8). [score:2]
[1 to 20 of 5 sentences]
7
[+] score: 13
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-mir-21, hsa-mir-26a-1, hsa-mir-27a, hsa-mir-28, hsa-mir-30a, hsa-mir-96, hsa-mir-98, hsa-mir-99a, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-196a-1, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-30d, hsa-mir-34a, hsa-mir-196a-2, hsa-mir-199a-2, hsa-mir-23b, hsa-mir-27b, hsa-mir-125b-1, hsa-mir-143, hsa-mir-145, hsa-mir-152, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-194-1, hsa-mir-194-2, hsa-mir-200a, hsa-mir-99b, hsa-mir-26a-2, hsa-mir-378a, hsa-mir-342, hsa-mir-148b, hsa-mir-338, hsa-mir-335, hsa-mir-196b, hsa-mir-484, hsa-mir-486-1, hsa-mir-1271, hsa-mir-378d-2, bta-mir-26a-2, bta-mir-103-1, bta-mir-148a, bta-mir-21, bta-mir-27a, bta-mir-30d, bta-mir-484, bta-mir-99a, bta-mir-125a, bta-mir-125b-1, bta-mir-145, bta-mir-199a-1, bta-mir-27b, bta-mir-98, bta-mir-148b, bta-mir-200a, bta-mir-30a, bta-let-7a-1, bta-mir-342, bta-mir-23b, bta-let-7a-2, bta-let-7a-3, bta-mir-103-2, bta-mir-125b-2, bta-mir-34a, bta-mir-99b, hsa-mir-885, hsa-mir-103b-1, hsa-mir-103b-2, bta-mir-143, bta-mir-16a, bta-mir-194-2, bta-mir-196a-2, bta-mir-196a-1, bta-mir-196b, bta-mir-199a-2, bta-mir-26a-1, bta-mir-28, bta-mir-335, bta-mir-338, bta-mir-378-1, bta-mir-486, bta-mir-885, bta-mir-96, bta-mir-1271, bta-mir-2299, bta-mir-199c, bta-mir-1388, bta-mir-194-1, bta-mir-378-2, hsa-mir-378b, bta-mir-3431, hsa-mir-378c, hsa-mir-4286, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, bta-mir-4286-1, bta-mir-4286-2, hsa-mir-378j, bta-mir-378b, bta-mir-378c, hsa-mir-486-2, bta-mir-378d, bta-mir-194b, bta-mir-194b-2
For those miRNAs (bta-miR-199c, miR-3431, miR-2299-5p, miR-152 and miR-1388-5p) without target information in IPA database, we used the perl scripts from the TargetScan website (http://targetscan. [score:7]
When compared with the control period (day-14), we identified a total of 22 DE miRNAs at day+28 including 10 up-regulated (bta-miR-199c, miR-199a-3p, miR-98, miR-378, miR-21-5p, miR-148b, miR-34a, miR-152, miR-16a, and miR-28) and 12 down-regulated (bta-miR-200a, miR-145, miR-99a-5p, miR-125b, miR-99b, miR-125a, miR-96, miR-484, miR-1388-5p, miR-342, miR-486 and miR-1271) (Table  2). [score:6]
[1 to 20 of 2 sentences]
8
[+] score: 12
It was shown that miR-145 regulate lipogenesis via targeting the INSIG1 gene 59; miR-27a suppress triglyceride accumulation via targeting PPARɣ gene 60 while miR-152 enhance viability and multiplication capacity of cow mammary gland cells through regulation of DNMT1 gene 10. [score:9]
The expression of miR-6529a and miR-152 were the most significantly negatively (r = −0.47) and positively (r = 0.33) correlated with milk yield, respectively (Table 4). [score:3]
[1 to 20 of 2 sentences]
9
[+] score: 11
The expression of DNMT1 is thus inversely related to the expression miRNA-148a and its family homolog miRNA-152 [57, 58]. [score:5]
The forced expression of miRNA-152 in dairy cow MECs resulted in a marked reduction of DNMT1 at both the mRNA and protein levels [55]. [score:3]
Wang et al. [55] reported that the expression of miRNA-152 significantly increased during lactation in MECs of dairy cows producing high quality milk compared to lower miRNA-152 levels in cows producing low quality milk. [score:2]
miRNA-148a, miRNA-148b, and miRNA-152 are three members of the miRNA-148/152 family, which shares substantial homology in their seed sequences [54]. [score:1]
[1 to 20 of 4 sentences]
10
[+] score: 10
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-21, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-99a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-16-2, hsa-mir-192, hsa-mir-148a, hsa-mir-10b, hsa-mir-181a-2, hsa-mir-181a-1, hsa-mir-215, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-mir-15b, hsa-mir-27b, hsa-mir-125b-1, hsa-mir-141, hsa-mir-143, hsa-mir-152, hsa-mir-125b-2, hsa-mir-126, hsa-mir-146a, hsa-mir-184, hsa-mir-200c, hsa-mir-155, hsa-mir-29c, hsa-mir-200a, hsa-mir-99b, hsa-mir-296, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-378a, hsa-mir-342, hsa-mir-148b, hsa-mir-451a, ssc-mir-125b-2, ssc-mir-148a, ssc-mir-15b, ssc-mir-184, ssc-mir-224, ssc-mir-23a, ssc-mir-24-1, ssc-mir-26a, ssc-mir-29b-1, ssc-let-7f-1, ssc-mir-103-1, ssc-mir-21, ssc-mir-29c, hsa-mir-486-1, hsa-mir-499a, hsa-mir-671, hsa-mir-378d-2, bta-mir-26a-2, bta-mir-29a, bta-let-7f-2, bta-mir-103-1, bta-mir-148a, bta-mir-16b, bta-mir-21, bta-mir-499, bta-mir-99a, bta-mir-125b-1, bta-mir-126, bta-mir-181a-2, bta-mir-27b, bta-mir-31, bta-mir-15b, bta-mir-215, bta-mir-30e, bta-mir-148b, bta-mir-192, bta-mir-200a, bta-mir-200c, bta-mir-23a, bta-mir-29b-2, bta-mir-29c, bta-mir-10b, bta-mir-24-2, bta-mir-30a, bta-mir-200b, bta-let-7a-1, bta-mir-342, bta-let-7f-1, bta-let-7a-2, bta-let-7a-3, bta-mir-103-2, bta-mir-125b-2, bta-mir-15a, bta-mir-99b, hsa-mir-664a, ssc-mir-99b, hsa-mir-103b-1, hsa-mir-103b-2, ssc-mir-15a, ssc-mir-16-2, ssc-mir-16-1, bta-mir-141, bta-mir-143, bta-mir-146a, bta-mir-155, bta-mir-16a, bta-mir-184, bta-mir-24-1, bta-mir-223, bta-mir-224, bta-mir-26a-1, bta-mir-296, bta-mir-29d, bta-mir-378-1, bta-mir-451, bta-mir-486, bta-mir-671, bta-mir-29e, bta-mir-29b-1, bta-mir-181a-1, ssc-mir-181a-1, ssc-mir-215, ssc-mir-30a, bta-mir-2318, bta-mir-2339, bta-mir-2430, bta-mir-664a, bta-mir-378-2, ssc-let-7a-1, ssc-mir-378-1, ssc-mir-29a, ssc-mir-30e, ssc-mir-499, ssc-mir-143, ssc-mir-10b, ssc-mir-486-1, ssc-mir-152, ssc-mir-103-2, ssc-mir-181a-2, ssc-mir-27b, ssc-mir-24-2, ssc-mir-99a, ssc-mir-148b, ssc-mir-664, ssc-mir-192, ssc-mir-342, ssc-mir-125b-1, oar-mir-21, oar-mir-29a, oar-mir-125b, oar-mir-181a-1, hsa-mir-378b, hsa-mir-378c, ssc-mir-296, ssc-mir-155, ssc-mir-146a, bta-mir-148c, ssc-mir-126, ssc-mir-378-2, ssc-mir-451, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-451b, hsa-mir-499b, ssc-let-7a-2, ssc-mir-486-2, hsa-mir-664b, hsa-mir-378j, ssc-let-7f-2, ssc-mir-29b-2, ssc-mir-31, ssc-mir-671, bta-mir-378b, bta-mir-378c, hsa-mir-486-2, oar-let-7a, oar-let-7f, oar-mir-103, oar-mir-10b, oar-mir-143, oar-mir-148a, oar-mir-152, oar-mir-16b, oar-mir-181a-2, oar-mir-200a, oar-mir-200b, oar-mir-200c, oar-mir-23a, oar-mir-26a, oar-mir-29b-1, oar-mir-30a, oar-mir-99a, bta-mir-664b, chi-let-7a, chi-let-7f, chi-mir-103, chi-mir-10b, chi-mir-125b, chi-mir-126, chi-mir-141, chi-mir-143, chi-mir-146a, chi-mir-148a, chi-mir-148b, chi-mir-155, chi-mir-15a, chi-mir-15b, chi-mir-16a, chi-mir-16b, chi-mir-184, chi-mir-192, chi-mir-200a, chi-mir-200b, chi-mir-200c, chi-mir-215, chi-mir-21, chi-mir-223, chi-mir-224, chi-mir-2318, chi-mir-23a, chi-mir-24, chi-mir-26a, chi-mir-27b, chi-mir-296, chi-mir-29a, chi-mir-29b, chi-mir-29c, chi-mir-30a, chi-mir-30e, chi-mir-342, chi-mir-378, chi-mir-451, chi-mir-499, chi-mir-671, chi-mir-99a, chi-mir-99b, bta-mir-378d, ssc-mir-378b, oar-mir-29b-2, ssc-mir-141, ssc-mir-200b, ssc-mir-223, bta-mir-148d
Ye et al. (2012) examined miRNA expression in the duodenum of E. coli F18-sensitive and -resistant weaned piglets and identified 12 candidate miRNA (ssc-miR-143, ssc-let-7f, ssc-miR-30e, ssc-miR-148a, ssc-miR-148b, ssc-miR-181a, ssc-miR-192, ssc-miR-27b, ssc-miR-15b, ssc-miR-21, ssc-miR-215, and ssc-miR-152) disease markers. [score:5]
In cattle, Wang et al. (2014) showed evidence that miRNA-152 regulates DNA methyltransferase 1 and is involved in the development and lactation processes in mammary glands. [score:3]
MicroRNA-152 regulates DNA methyltransferase 1 and is involved in the development and lactation of mammary glands in dairy cows. [score:2]
[1 to 20 of 3 sentences]
11
[+] score: 5
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26b, hsa-mir-27a, hsa-mir-31, hsa-mir-33a, hsa-mir-99a, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-147a, hsa-mir-34a, hsa-mir-182, hsa-mir-199a-2, hsa-mir-212, hsa-mir-221, hsa-mir-224, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-132, hsa-mir-142, hsa-mir-145, hsa-mir-152, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-127, hsa-mir-134, hsa-mir-200c, hsa-mir-106b, hsa-mir-361, hsa-mir-148b, hsa-mir-20b, hsa-mir-410, hsa-mir-202, hsa-mir-503, hsa-mir-33b, hsa-mir-643, hsa-mir-659, bta-let-7f-2, bta-mir-103-1, bta-mir-148a, bta-mir-21, bta-mir-221, bta-mir-26b, bta-mir-27a, bta-mir-99a, bta-mir-125a, bta-mir-125b-1, bta-mir-145, bta-mir-199a-1, bta-mir-27b, bta-mir-30b, bta-mir-31, bta-mir-127, bta-mir-142, bta-mir-20b, bta-let-7d, bta-mir-132, bta-mir-148b, bta-mir-200c, bta-mir-22, bta-mir-23a, bta-mir-29b-2, bta-mir-361, bta-let-7g, bta-mir-24-2, bta-let-7a-1, bta-let-7f-1, bta-let-7i, bta-mir-25, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-125b-2, bta-mir-34a, hsa-mir-708, hsa-mir-147b, hsa-mir-877, hsa-mir-940, hsa-mir-548j, hsa-mir-302e, hsa-mir-103b-1, hsa-mir-103b-2, bta-mir-100, bta-mir-106b, bta-mir-130a, bta-mir-134, bta-mir-147, bta-mir-153-1, bta-mir-153-2, bta-mir-182, bta-mir-24-1, bta-mir-199a-2, bta-mir-202, bta-mir-212, bta-mir-224, bta-mir-33a, bta-mir-33b, bta-mir-410, bta-mir-708, bta-mir-877, bta-mir-940, bta-mir-29b-1, bta-mir-148c, bta-mir-503, bta-mir-148d
This study demonstrated that eight miRNAs (miR-503, miR-21, miR-29b, miR-142-3p, miR-34a, miR-152, miR-25 and miR-130a) were highly expressed, while nine miRNAs (miR-125a, miR-199a-3p, miR-125b, miR-99a, let-7c, miR-145, miR-31, miR-202 and miR-27b) were expressed at lower level between the follicular and luteal stages in ovine ovarian tissues. [score:5]
[1 to 20 of 1 sentences]
12
[+] score: 5
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-98, hsa-mir-99a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-10a, hsa-mir-10b, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-181a-1, hsa-mir-221, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-27b, hsa-mir-30b, hsa-mir-130a, hsa-mir-152, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-185, hsa-mir-193a, hsa-mir-320a, hsa-mir-200c, hsa-mir-1-1, hsa-mir-181b-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-99b, hsa-mir-130b, hsa-mir-30e, hsa-mir-363, hsa-mir-374a, hsa-mir-375, hsa-mir-378a, hsa-mir-148b, hsa-mir-331, hsa-mir-339, hsa-mir-423, hsa-mir-20b, hsa-mir-491, hsa-mir-193b, hsa-mir-181d, hsa-mir-92b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, bta-mir-29a, bta-let-7f-2, bta-mir-148a, bta-mir-18a, bta-mir-20a, bta-mir-221, bta-mir-27a, bta-mir-30d, bta-mir-320a-2, bta-mir-99a, bta-mir-181a-2, bta-mir-27b, bta-mir-30b, bta-mir-106a, bta-mir-10a, bta-mir-15b, bta-mir-181b-2, bta-mir-193a, bta-mir-20b, bta-mir-30e, bta-mir-92a-2, bta-mir-98, bta-let-7d, bta-mir-148b, bta-mir-17, bta-mir-181c, bta-mir-191, bta-mir-200c, bta-mir-22, bta-mir-29b-2, bta-mir-29c, bta-mir-423, bta-let-7g, bta-mir-10b, bta-mir-24-2, bta-mir-30a, bta-let-7a-1, bta-let-7f-1, bta-mir-30c, bta-let-7i, bta-mir-25, bta-mir-363, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-15a, bta-mir-19a, bta-mir-19b, bta-mir-331, bta-mir-374a, bta-mir-99b, hsa-mir-374b, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, bta-mir-1-2, bta-mir-1-1, bta-mir-130a, bta-mir-130b, bta-mir-181d, bta-mir-182, bta-mir-185, bta-mir-24-1, bta-mir-193b, bta-mir-29d, bta-mir-30f, bta-mir-339a, bta-mir-374b, bta-mir-375, bta-mir-378-1, bta-mir-491, bta-mir-92a-1, bta-mir-92b, bta-mir-9-1, bta-mir-9-2, bta-mir-29e, bta-mir-29b-1, bta-mir-181a-1, bta-mir-181b-1, bta-mir-320b, bta-mir-339b, bta-mir-19b-2, bta-mir-320a-1, bta-mir-193a-2, bta-mir-378-2, hsa-mir-378b, hsa-mir-320e, hsa-mir-378c, bta-mir-148c, hsa-mir-374c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-378j, bta-mir-378b, bta-mir-378c, bta-mir-378d, bta-mir-374c, bta-mir-148d
In this study, three members of this family (miR-148a, miR-148b and miR-152, Figure 12H) showed modest expression levels, suggesting that miR-148 may be a stably expressed miRNA in exosomes of most mammals including pigs. [score:5]
[1 to 20 of 1 sentences]
13
[+] score: 3
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-27a, hsa-mir-31, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-101-1, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-16-2, hsa-mir-192, hsa-mir-199a-1, hsa-mir-30c-2, hsa-mir-199a-2, hsa-mir-223, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-125b-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-140, hsa-mir-141, hsa-mir-152, hsa-mir-191, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-149, hsa-mir-150, hsa-mir-320a, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-101-2, hsa-mir-99b, hsa-mir-26a-2, hsa-mir-379, hsa-mir-423, hsa-mir-451a, hsa-mir-486-1, hsa-mir-496, hsa-mir-520a, hsa-mir-525, hsa-mir-518b, hsa-mir-516b-2, hsa-mir-516b-1, hsa-mir-516a-1, hsa-mir-516a-2, hsa-mir-92b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, bta-mir-26a-2, bta-let-7f-2, bta-mir-101-2, bta-mir-103-1, bta-mir-16b, bta-mir-20a, bta-mir-21, bta-mir-27a, bta-mir-320a-2, bta-mir-125a, bta-mir-125b-1, bta-mir-199a-1, bta-mir-31, bta-mir-140, bta-mir-92a-2, bta-let-7d, bta-mir-132, bta-mir-191, bta-mir-192, bta-mir-22, bta-mir-23a, bta-mir-29c, bta-mir-423, bta-let-7g, bta-mir-24-2, bta-let-7a-1, bta-mir-150, bta-let-7f-1, bta-mir-30c, bta-let-7i, bta-mir-23b, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-125b-2, bta-mir-99b, hsa-mir-1249, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, bta-mir-101-1, bta-mir-133a-2, bta-mir-133a-1, bta-mir-141, bta-mir-16a, bta-mir-24-1, bta-mir-199a-2, bta-mir-223, bta-mir-26a-1, bta-mir-379, bta-mir-451, bta-mir-486, bta-mir-496, bta-mir-92a-1, bta-mir-92b, bta-mir-1249, bta-mir-320b, bta-mir-320a-1, hsa-mir-320e, hsa-mir-23c, hsa-mir-451b, bta-mir-149, hsa-mir-486-2
Thus, only four of all miRNAs differentially expressed (P < 0.05) between pregnant (Day 24) and non-pregnant animals in the PCR array, i. e. miR-99b, miR-152, miR-101, miR-103, were also different (P < 0.05) between pregnant and non-pregnant groups (all comparisons) in the sequencing dataset. [score:3]
[1 to 20 of 1 sentences]
14
[+] score: 2
Wang J MicroRNA-152 regulates DNA methyltransferase 1 and is involved in the development and lactation of mammary glands in dairy cowsPLoS One. [score:2]
[1 to 20 of 1 sentences]
15
[+] score: 1
bomir-143-3p 22 ggo-miR-143 11 +/-UGAGAUGAAGCACUGUAGCUCG7:60268857:60268878:1 [f] Intergenic bomir-152-5p 21 hsa-miR-152 1 -CCAAGUUCUGUCAUGCACUGA19:39650399:39650419:-1 [f] Intragenicbomir-193a-2-3p [c] 19 bta-miR193a 1 -GGGACUUUGUAGGCCAGUU14:889828:889846:-1 [f] Intronic bomir-378-1-3p 21 hsa-miR-378 1 +CUGGACUUGGAGUCAGAAGGC7:60536513:60536533:1 [f] Intronic bomir-378-2-5p 21 hsa-miR-378 - - +CUGGACUUGGAGUCAGAAGGC4:11116898:11116918:1 [h] Intronic bomir-382-3p 22 hsa-miR-382 1 -GAAUCCACCACGAACAACUUC21:66031757:66031777:-1 [f] Intronic bomir-409-5p 22 hsa-miR-409 2 -GGGGUUCACCGAGCAACAUUC21:66042162:66042182:-1 [f] Intronic bomir-424-3p 22 hsa-miR-424* 1 -CAAAACGUGAGGCGCUGCUAUUn. [score:1]
[1 to 20 of 1 sentences]
16
[+] score: 1
Other miRNAs from this paper: bta-let-7f-2, bta-mir-101-2, bta-mir-103-1, bta-mir-21, bta-mir-27a, bta-mir-30d, bta-mir-320a-2, bta-mir-199a-1, bta-mir-27b, bta-mir-30b, bta-mir-107, bta-mir-140, bta-mir-30e, bta-let-7d, bta-mir-124a-1, bta-mir-199b, bta-mir-200a, bta-mir-200c, bta-let-7g, bta-mir-30a, bta-mir-200b, bta-let-7a-1, bta-let-7f-1, bta-mir-122, bta-mir-30c, bta-let-7i, bta-mir-25, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-1-2, bta-mir-1-1, bta-mir-101-1, bta-mir-124a-2, bta-mir-124b, bta-mir-133a-2, bta-mir-133a-1, bta-mir-143, bta-mir-154a, bta-mir-185, bta-mir-199a-2, bta-mir-206, bta-mir-30f, bta-mir-335, bta-mir-33a, bta-mir-33b, bta-mir-370, bta-mir-378-1, bta-mir-432, bta-mir-9-1, bta-mir-9-2, bta-mir-1224, bta-mir-376b, bta-mir-376d, bta-mir-376c, bta-mir-376a, bta-mir-1839, bta-mir-1185, bta-mir-2284i, bta-mir-2285a, bta-mir-2284s, bta-mir-2285d, bta-mir-2284l, bta-mir-2284j, bta-mir-2284t, bta-mir-2285b-1, bta-mir-2284d, bta-mir-2284n, bta-mir-2284g, bta-mir-199c, bta-mir-2284p, bta-mir-2284u, bta-mir-2363-1, bta-mir-2363-2, bta-mir-2284f, bta-mir-2284a, bta-mir-2284k, bta-mir-2284c, bta-mir-2284v, bta-mir-2285c, bta-mir-2284q, bta-mir-2284m, bta-mir-2284b, bta-mir-320b, bta-mir-2284r, bta-mir-2284h, bta-mir-2284o, bta-mir-2284e, bta-mir-320a-1, bta-mir-378-2, bta-mir-2284w, bta-mir-2284x, bta-mir-3432a-1, bta-mir-3432a-2, bta-mir-3604-1, bta-mir-3604-2, bta-mir-2284y-1, bta-mir-2285e-1, bta-mir-2285e-2, bta-mir-2285f-1, bta-mir-2285f-2, bta-mir-2285g-1, bta-mir-2285h, bta-mir-2285i, bta-mir-2285j-1, bta-mir-2285j-2, bta-mir-2285k-1, bta-mir-2285l, bta-mir-2285o-1, bta-mir-2285o-2, bta-mir-2285n-1, bta-mir-2285n-2, bta-mir-2285p, bta-mir-2285m-1, bta-mir-2285m-2, bta-mir-2284y-2, bta-mir-378b, bta-mir-2285n-3, bta-mir-2285n-4, bta-mir-2284y-3, bta-mir-154c, bta-mir-376e, bta-mir-154b, bta-mir-2285o-3, bta-mir-2285o-4, bta-mir-2285m-3, bta-mir-378c, bta-mir-2284y-4, bta-mir-2284y-5, bta-mir-2284y-6, bta-mir-2285m-4, bta-mir-2285o-5, bta-mir-2285m-5, bta-mir-2285n-5, bta-mir-2285n-6, bta-mir-6526-1, bta-mir-6526-2, bta-mir-503, bta-mir-2284y-7, bta-mir-6526-3, bta-mir-2285n-7, bta-mir-2284z-1, bta-mir-2284aa-1, bta-mir-2285k-2, bta-mir-2284z-3, bta-mir-2284aa-2, bta-mir-2284aa-3, bta-mir-2285k-3, bta-mir-2285k-4, bta-mir-2284z-4, bta-mir-2285k-5, bta-mir-2284z-5, bta-mir-2284z-6, bta-mir-2284z-7, bta-mir-6536-1, bta-mir-2284aa-4, bta-mir-6536-2, bta-mir-2285q, bta-mir-2285r, bta-mir-2285s, bta-mir-2285t, bta-mir-2285b-2, bta-mir-2285v, bta-mir-2284z-2, bta-mir-2285g-2, bta-mir-2285g-3, bta-mir-2285af-1, bta-mir-2285af-2, bta-mir-2285y, bta-mir-2285w, bta-mir-2285x, bta-mir-2285z, bta-mir-2285u, bta-mir-2285aa, bta-mir-2285ab, bta-mir-2284ab, bta-mir-2285ac, bta-mir-2285ad, bta-mir-2284ac, bta-mir-2285ae, bta-mir-378d, bta-mir-3432b, bta-mir-2285ag, bta-mir-2285ah, bta-mir-2285ai, bta-mir-2285aj, bta-mir-2285ak, bta-mir-2285al, bta-mir-2285am, bta-mir-2285ar, bta-mir-2285as-1, bta-mir-2285as-2, bta-mir-2285as-3, bta-mir-2285at-1, bta-mir-2285at-2, bta-mir-2285at-3, bta-mir-2285at-4, bta-mir-2285au, bta-mir-2285av, bta-mir-2285aw, bta-mir-2285ax-1, bta-mir-2285ax-2, bta-mir-2285ax-3, bta-mir-2285ay, bta-mir-2285az, bta-mir-2285an, bta-mir-2285ao-1, bta-mir-2285ao-2, bta-mir-2285ap, bta-mir-2285ao-3, bta-mir-2285aq-1, bta-mir-2285aq-2, bta-mir-2285ba-1, bta-mir-2285ba-2, bta-mir-2285bb, bta-mir-2285bc, bta-mir-2285bd, bta-mir-2285be, bta-mir-2285bf-1, bta-mir-2285bf-2, bta-mir-2285bf-3, bta-mir-2285bg, bta-mir-2285bh, bta-mir-2285bi-1, bta-mir-2285bi-2, bta-mir-2285bj-1, bta-mir-2285bj-2, bta-mir-2285bk, bta-mir-2285bl, bta-mir-2285bm, bta-mir-2285bn, bta-mir-2285bo, bta-mir-2285bp, bta-mir-2285bq, bta-mir-2285br, bta-mir-2285bs, bta-mir-2285bt, bta-mir-2285bu-1, bta-mir-2285bu-2, bta-mir-2285bv, bta-mir-2285bw, bta-mir-2285bx, bta-mir-2285by, bta-mir-2285bz, bta-mir-2285ca, bta-mir-2285cb, bta-mir-2285cc, bta-mir-2285cd, bta-mir-2285ce, bta-mir-2285cf, bta-mir-2285cg, bta-mir-2285ch, bta-mir-2285ci, bta-mir-2285cj, bta-mir-2285ck, bta-mir-2285cl, bta-mir-2285cm, bta-mir-2285cn, bta-mir-2285co, bta-mir-2285cp, bta-mir-2285cq, bta-mir-2285cr-1, bta-mir-2285cr-2, bta-mir-2285cs, bta-mir-2285ct, bta-mir-2285cu, bta-mir-2285cv-1, bta-mir-2285cv-2, bta-mir-2285cw-1, bta-mir-2285cw-2, bta-mir-2285cx, bta-mir-2285cy, bta-mir-2285cz, bta-mir-2285da, bta-mir-2285db, bta-mir-2285dc, bta-mir-2285dd, bta-mir-2285de, bta-mir-2285df, bta-mir-2285dg, bta-mir-2285dh, bta-mir-2285di, bta-mir-2285dj, bta-mir-2285dk, bta-mir-2285dl-1, bta-mir-2285dl-2, bta-mir-2285dm
Similarly, miR-21, miR-103, miR-107, miR140, miR-143, miR-152, miR-199, miR-432, miR-839, and miR-2284x were predominantly found at lengths of 22, 21, 21, 23, 21, 21, 21, 21, 22, and 22 nt, respectively. [score:1]
[1 to 20 of 1 sentences]
17
[+] score: 1
Other miRNAs from this paper: bta-let-7f-2, bta-mir-21, bta-mir-221, bta-mir-222, bta-mir-26b, bta-mir-125a, bta-mir-125b-1, bta-mir-128-1, bta-mir-181a-2, bta-mir-27b, bta-mir-30b, bta-mir-140, bta-mir-15b, bta-mir-92a-2, bta-let-7d, bta-let-7g, bta-mir-30a, bta-let-7a-1, bta-let-7f-1, bta-let-7i, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-125b-2, bta-mir-374a, bta-mir-128-2, bta-mir-146b, bta-mir-155, bta-mir-181d, bta-mir-24-1, bta-mir-223, bta-mir-374b, bta-mir-500, bta-mir-708, bta-mir-92a-1, bta-mir-9-1, bta-mir-9-2, bta-mir-1249, bta-mir-181a-1, bta-mir-2285a, bta-mir-2285d, bta-mir-2285b-1, bta-mir-2285c, bta-mir-2478, bta-mir-2898, bta-mir-2285e-1, bta-mir-2285e-2, bta-mir-2285f-1, bta-mir-2285f-2, bta-mir-2285g-1, bta-mir-2285h, bta-mir-2285i, bta-mir-2285j-1, bta-mir-2285j-2, bta-mir-2285k-1, bta-mir-2285l, bta-mir-2285o-1, bta-mir-2285o-2, bta-mir-2285n-1, bta-mir-2285n-2, bta-mir-2285p, bta-mir-2285m-1, bta-mir-2285m-2, bta-mir-2285n-3, bta-mir-2285n-4, bta-mir-2285o-3, bta-mir-2285o-4, bta-mir-2285m-3, bta-mir-2285m-4, bta-mir-2285o-5, bta-mir-2285m-5, bta-mir-2285n-5, bta-mir-2285n-6, bta-mir-2285n-7, bta-mir-2285k-2, bta-mir-2285k-3, bta-mir-2285k-4, bta-mir-2285k-5, bta-mir-2285q, bta-mir-2285r, bta-mir-2285s, bta-mir-2285t, bta-mir-2285b-2, bta-mir-2285v, bta-mir-2285g-2, bta-mir-2285g-3, bta-mir-2285af-1, bta-mir-2285af-2, bta-mir-2285y, bta-mir-2285w, bta-mir-2285x, bta-mir-2285z, bta-mir-2285u, bta-mir-2285aa, bta-mir-2285ab, bta-mir-2285ac, bta-mir-2285ad, bta-mir-2285ae, bta-mir-2285ag, bta-mir-2285ah, bta-mir-2285ai, bta-mir-2285aj, bta-mir-2285ak, bta-mir-2285al, bta-mir-2285am, bta-mir-2285ar, bta-mir-2285as-1, bta-mir-2285as-2, bta-mir-2285as-3, bta-mir-2285at-1, bta-mir-2285at-2, bta-mir-2285at-3, bta-mir-2285at-4, bta-mir-2285au, bta-mir-2285av, bta-mir-2285aw, bta-mir-2285ax-1, bta-mir-2285ax-2, bta-mir-2285ax-3, bta-mir-2285ay, bta-mir-2285az, bta-mir-2285an, bta-mir-2285ao-1, bta-mir-2285ao-2, bta-mir-2285ap, bta-mir-2285ao-3, bta-mir-2285aq-1, bta-mir-2285aq-2, bta-mir-2285ba-1, bta-mir-2285ba-2, bta-mir-2285bb, bta-mir-2285bc, bta-mir-2285bd, bta-mir-2285be, bta-mir-2285bf-1, bta-mir-2285bf-2, bta-mir-2285bf-3, bta-mir-2285bg, bta-mir-2285bh, bta-mir-2285bi-1, bta-mir-2285bi-2, bta-mir-2285bj-1, bta-mir-2285bj-2, bta-mir-2285bk, bta-mir-2285bl, bta-mir-2285bm, bta-mir-2285bn, bta-mir-2285bo, bta-mir-2285bp, bta-mir-2285bq, bta-mir-2285br, bta-mir-2285bs, bta-mir-2285bt, bta-mir-2285bu-1, bta-mir-2285bu-2, bta-mir-2285bv, bta-mir-2285bw, bta-mir-2285bx, bta-mir-2285by, bta-mir-2285bz, bta-mir-2285ca, bta-mir-2285cb, bta-mir-2285cc, bta-mir-2285cd, bta-mir-2285ce, bta-mir-2285cf, bta-mir-2285cg, bta-mir-2285ch, bta-mir-2285ci, bta-mir-2285cj, bta-mir-2285ck, bta-mir-2285cl, bta-mir-2285cm, bta-mir-2285cn, bta-mir-2285co, bta-mir-2285cp, bta-mir-2285cq, bta-mir-2285cr-1, bta-mir-2285cr-2, bta-mir-2285cs, bta-mir-2285ct, bta-mir-2285cu, bta-mir-2285cv-1, bta-mir-2285cv-2, bta-mir-2285cw-1, bta-mir-2285cw-2, bta-mir-2285cx, bta-mir-2285cy, bta-mir-2285cz, bta-mir-2285da, bta-mir-2285db, bta-mir-2285dc, bta-mir-2285dd, bta-mir-2285de, bta-mir-2285df, bta-mir-2285dg, bta-mir-2285dh, bta-mir-2285di, bta-mir-2285dj, bta-mir-2285dk, bta-mir-2285dl-1, bta-mir-2285dl-2, bta-mir-2285dm
112083922:+ chr19_1281 70,00 5,00 43,00 hsa-miR-152-5p agguucugugauacacuccgacu chr19:39081179.. [score:1]
[1 to 20 of 1 sentences]
18
[+] score: 1
Other miRNAs from this paper: bta-mir-29a, bta-let-7f-2, bta-mir-103-1, bta-mir-151, bta-mir-30d, bta-mir-320a-2, bta-mir-126, bta-mir-181a-2, bta-mir-27b, bta-mir-30b, bta-mir-31, bta-mir-34b, bta-mir-107, bta-mir-15b, bta-mir-181b-2, bta-mir-30e, bta-let-7d, bta-mir-124a-1, bta-mir-138-2, bta-mir-181c, bta-mir-214, bta-mir-455, bta-mir-93, bta-let-7g, bta-mir-10b, bta-mir-30a, bta-let-7a-1, bta-mir-487b, bta-let-7f-1, bta-mir-122, bta-mir-30c, bta-let-7i, bta-mir-25, bta-mir-34c, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-15a, bta-mir-34a, bta-mir-1-2, bta-mir-1-1, bta-mir-105b, bta-mir-124a-2, bta-mir-124b, bta-mir-133a-2, bta-mir-133a-1, bta-mir-133b, bta-mir-138-1, bta-mir-181d, bta-mir-196a-2, bta-mir-196a-1, bta-mir-206, bta-mir-30f, bta-mir-409a, bta-mir-432, bta-mir-486, bta-mir-495, bta-mir-543, bta-mir-9-1, bta-mir-9-2, bta-mir-1185, bta-mir-1271, bta-mir-181a-1, bta-mir-181b-1, bta-mir-2284i, bta-mir-2284s, bta-mir-2284l, bta-mir-2284j, bta-mir-2284t, bta-mir-2284d, bta-mir-2284n, bta-mir-2284g, bta-mir-2284p, bta-mir-2284u, bta-mir-2363-1, bta-mir-2363-2, bta-mir-2284f, bta-mir-2284a, bta-mir-2284k, bta-mir-2284c, bta-mir-2384, bta-mir-2284v, bta-mir-2284q, bta-mir-2404-1, bta-mir-2284m, bta-mir-2284b, bta-mir-320b, bta-mir-2424, bta-mir-2284r, bta-mir-2284h, bta-mir-2404-2, bta-mir-2284o, bta-mir-2284e, bta-mir-320a-1, bta-mir-424, bta-mir-2284w, bta-mir-2284x, bta-mir-409b, bta-mir-2284y-1, bta-mir-2284y-2, bta-mir-2284y-3, bta-mir-2284y-4, bta-mir-2284y-5, bta-mir-2284y-6, bta-mir-2284y-7, bta-mir-2284z-1, bta-mir-2284aa-1, bta-mir-2284z-3, bta-mir-2284aa-2, bta-mir-2284aa-3, bta-mir-2284z-4, bta-mir-2284z-5, bta-mir-2284z-6, bta-mir-2284z-7, bta-mir-2284aa-4, bta-mir-2284z-2, bta-mir-133c, bta-mir-2284ab, bta-mir-2284ac
In contrast, five conserved miRNAs (bta-miRNA-543, miRNA-432, let-7i, miRNA-320, and miRNA-152) and seven novel miRNAs (bta-miRn16, miRn18, miRn33, miRn65, miRn70, miRn73, and miRn73) could be quantified from all tissues and several of them (e. g., bta-miRNA-320, miRn33 and miRn65) were relatively consistent across all nine tissue types. [score:1]
[1 to 20 of 1 sentences]