sort by

39 publications mentioning bta-mir-155

Open access articles that are associated with the species Bos taurus and mention the gene name mir-155. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 265
Other miRNAs from this paper: bta-mir-137, bta-mir-223
This suggested that upregulation of AP-1/c-Jun is sufficient to induce BIC expression in these cells and that miR-155 may induce the expression of its own promoter via AP-1/Jun activation. [score:8]
We show that miR-155 expression inhibits DET1 protein translation, leading to accumulation of c-Jun protein and activation of the BIC gene containing miR-155. [score:7]
To identify putative miR-155 target genes, we performed a computational screen for genes with complementary miR-155 sites in their 3′UTR using online software (including Microcosm targets, TargetScan and PicTar). [score:7]
Our results show that miR-155 can activate c-Jun and AP-1 in our cells by targeting DET1 and inhibiting its translation. [score:7]
Consequently, we tested whether the effect of miR-155 on these potential targets could occur via inhibition of translation. [score:7]
Thus, miR-155 expression leads to DET1 down-regulation, accumulation of the c-Jun protein and activation of the BIC promoter. [score:6]
These results suggest that DET1 protein translation is directly targeted by miR-155 binding to the 3′UTR sequence. [score:6]
Transgenic mice overexpressing miR-155 in B cells developed lymphoproliferative disorders, whereas knockout mice have also demonstrated that miR-155 plays a critical role in the development of the immune system and the adaptive immune response [31], [32]. [score:5]
Additional experiments using the MG132 proteosome inhibitor, confirmed that c-Jun inhibition by the miR-155 Sponge in TBL3 cells was due to proteosome -dependent degradation (Figure 5C). [score:5]
As the expression of miR-155 led to reduced DET1 protein and elevated c-Jun levels, we hypothesized that this might increase AP-1 activity, thereby creating a positive feedback loop to drive expression of the BIC promoter. [score:5]
We also identified a new miR-155 target, transcripts encoding the DET1 protein which is involved in targeting c-Jun for degradation by ubiquitination. [score:5]
Furthermore, the effect of the miR-155 Sponge is DET1 -dependent, as it was reversed by siRNA specifically targeting DET1 expression (Figure 4D). [score:5]
Finally, the inhibitory effect of the miR-155 Sponge on the BIC promoter could be overcome by suppressing DET1 using siRNA (Figure 6B, middle). [score:5]
We focused on the miR-155 oncomiR for a number of reasons; miR-155 was lowly expressed in the parental BL3 cell line (see below) and miR-155 is overexpressed in human B cell lymphoma, leukemia, breast cancer and pancreatic cancer [27], [33]. [score:5]
We discovered that transformation by Theileria leads to upregulation of an oncogenic small RNA called miR-155 which is contained within the BIC gene. [score:4]
1003222.g002 Figure 2The oncomiR miR-155 is upregulated in cells transformed by Theileria. [score:4]
The inhibitory effect of the miR-155 Sponge could be reversed by co-transfection with siRNA inhibiting DET1, compared to a non-relevant scrambled siRNA control. [score:4]
Mutation of the miR-155 target site in the DET1 Luciferase-3′UTR reporter (mDET1) abolished the Buparvaquone -induced luciferase activity in TBL3 cells (Figure 4A). [score:4]
miR-155 is upregulated in bovine leukocytes transformed by Theileria infection. [score:4]
Here we show that miR-155 and BIC upregulation are features of cells infected by the parasite Theileria. [score:4]
Bovine DET1 is a direct target of the miR-155 oncomiR. [score:4]
The oncomiR miR-155 is upregulated in cells transformed by Theileria. [score:4]
Conversely, we performed a series of experiments involving co-transfection with a miR-155 “Sponge” construct, which functions as a miR-155 inhibitor. [score:3]
miR-155 stabilized c-Jun by inhibiting its proteasomal degradation. [score:3]
We found that the expression of either miR-155 or siDET1 or c-Jun resulted in induction of BIC promoter activity in uninfected BL3 cells (Figure 6A). [score:3]
1003222.g005 Figure 5 (A) Overexpression of miR-155 or depletion of DET1 in BL3 cells increased the half-life of endogenous c-Jun protein. [score:3]
1003222.g004 Figure 4 (A) Luciferase reporters containing the total 3′UTR of DET1 and TP53INP1 show that Buparvaquone induced Luciferase in parasitized TBL3 cells, but not in parental BL3 cells, and Luciferase induction was lost when the miR-155 target binding site was mutated (mDet1) (average ± sd, n = 3). [score:3]
We identified a new target for the miR-155; the DET1 protein which is responsible for degradation of the c-Jun factor. [score:3]
Furthermore, Buparvaquone treatment caused a dramatic decrease in miR-155 expression in both TBL3 lymphocytes and Thei macrophage cell lines (Figure 2C). [score:3]
We also tested the expression of immature transcripts pri-miR-155 and pre-miR-155 by qPCR; we observed that these forms were reduced by Buparvaquone in TBL3 cells, but not in non-infected BL3 cells (Figure 2D). [score:3]
BL3 cells transiently expressing miR-155 or siDET1 were treated with cycloheximide for the indicated times, followed by immunoblot analysis with a c-Jun antibody and semi-quantification with an αTubulin antibody as a loading control. [score:3]
Transfecting TBL3 cells with the inhibitory miR-155 Sponge caused apoptosis as monitored by Western blot detection of Caspase-3 activation. [score:3]
TBL3 cells transiently expressing miR-155 Sponge +/− siDET1 were treated with cycloheximide for the indicated times, followed by immunoblot analysis with a c-Jun antibody and semiquantification with α-Tubulin as a loading control. [score:3]
We provide evidence that miR-155 targets the DET1 protein, which leads to accumulation of the c-Jun protein and increased transcription of the miR-155-encoding BIC gene (Figure 7D). [score:3]
TBL3 cells transiently expressing the miR-155 Sponge were treated with MG132 for 3 h, followed by immunoblot analysis with the c-Jun antibody and semiquantification with α Tubulin as a loading control (average ± sd, n = 3). [score:3]
Conversely, we found that the BIC-Luciferase activity in TBL3 cells was reduced by co-transfection with the miR-155 inhibitory Sponge or a Dominant-Negative c-Jun (DN c-Jun) (Figure 6B). [score:3]
1003222.g006 Figure 6 (A) miR-155 directly regulates the BIC promoter. [score:3]
We used TP53INP1, a pro-apoptotic tumour suppressor protein reported to be repressed by miR-155 in pancreatic tumours [40], as a positive control (Figure 4A). [score:3]
Figure S2 Analysis of putative miR155 oncomiR target genes. [score:3]
The DET1 and TP53INP1 3′UTR-reporters were inhibited by co-transfection with miR-155, but not control (Figure 4B). [score:3]
We found that DET1, JARID2 and TP53INP1 genes are putative miR-155 targets; they exhibit a strong seed match and the binding site is conserved across species (Supplementary Figure S2A). [score:3]
Furthermore, we tested the effect of inhibiting the miR-155 loop on cell survival. [score:3]
In TBL3 cells, treatment with Buparvaquone or transfection with the miR-155 Sponge inhibitor both resulted in elevated DET1 protein, and decreased c-Jun levels (Figure 4C and 4D). [score:3]
The positive feedback loop is provoked by miR-155 repression of DET1 protein translation and DET1 -dependent repression of c-Jun protein stability. [score:3]
We show here that activated AP-1 transcription factors in parasitized transformed cells drives the transcription of the BIC gene, leading to increased miR-155 expression in both artificially infected bovine B cells and in naturally-infected bovine Thei macrophages. [score:3]
These results suggested that miR-155 could be a common target used by viruses and parasites to manipulate host cell functions during cancer and infection. [score:3]
For example, Helicobacter pylori infection, which is associated with gastric adenocarcinoma, also induces miR-155 expression in T cells, but via Foxp3 [42]. [score:3]
Overexpression of miR-155 has been functionally linked to tumorigenesis and inflammation in animal mo dels [31], [32], [34]. [score:3]
miR-155 was significantly upregulated in TBL3 cells compared to the non-parasitized parental BL3 cells (Figure 2C). [score:3]
The effects of Buparvaquone could include changes in many miRs, so we performed experiments in BL3 cells in which we cotransfected either the DET1 or the TP53INP1 Luciferase-3′UTR reporters with a miR-155 -expressing plasmid. [score:3]
The mechanisms by which the oncomiR-155 drives and maintains tumorigenesis remain relatively unclear and few molecular targets have been identified that explain miR-155 contribution to inflammation or the cancer cell phenotypes. [score:3]
We transfected luciferase reporters fused to the miR-155 -targeted 3′UTR of these genes into Theileria-infected cells and tested the effect of Buparvaquone [30]. [score:3]
Together, these experiments show that miR-155 can target DET1 leading to c-Jun accumulation in transformed Theileria-infected leukocytes. [score:3]
DET1 is a novel miR-155 target. [score:3]
BIC and miR-155 are overexpressed in lymphomas, including Hodgkin's lymphoma, and acute myeloid leukemia patients, as well as several solid tumours [26], [27]. [score:3]
Therefore, we conclude that Theileria regulates miR-155 primarily by AP-1 driven transcription of the bovine BIC gene. [score:2]
Moreover, miR-155 appears to be commonly de-regulated by a wide range of infectious agents, including bacteria and viruses [27], [30], [36], [37]. [score:2]
These experiments suggested that the miR-155/DET1/Jun/BIC loop creates a regulatory feedback circuit. [score:2]
Thus, our results place miR-155 at an exciting crossroads between parasitology, regulatory circuits and transformation. [score:2]
miR-155 is upregulated in bovine leukocytes transformed by Theileria infectionTo investigate the molecular mechanisms underlying the phenotypes of Theileria-infected cells, we studied TBL3 cells which were derived by in vitro infection with T. annulata of BL3 cells, an immortalized, bovine B lymphocyte cell line. [score:2]
miR-155 drives a feedback regulatory loop. [score:2]
The transcriptional induction of miR-155 in Theileria infected-cells is dependent on AP-1.. [score:1]
We report here that miR-155 represses DET1 in Theileria-infected cells. [score:1]
miR-155 participates in an addictive feedback loop. [score:1]
Thus, our study has provided the molecular events in a miR-155 loop that links infection and transformation. [score:1]
The oncomir miR-155 is one of the best studied oncogenic miRNAs and it has been extensively linked to inflammation, induced by a range of bacterial pathogens and viruses [25], [26], [27]. [score:1]
1003222.g003 Figure 3The transcriptional induction of miR-155 in Theileria infected-cells is dependent on AP-1. (A) Sequence alignment of the proximal promoter sequence of the bovine, human and mouse BIC genes. [score:1]
Figure S3 miR155 does not affect c-Jun transcription. [score:1]
Homologues of BIC (B-cell integration cluster) have been identified in humans and mice and contain the precursor hairpin encoding miR-155. [score:1]
The miR-155 sequence is identical in the bovine (Bta), human (Hsa) and chicken (Gga) genomes. [score:1]
To confirm that the miR-155 levels and DET1 targeting affected c-Jun protein stability in our cells, rather than transcription, we investigated c-Jun stability by pulse-chase labeling with cycloheximide (Figure 5A and 5B). [score:1]
In contrast, c-Jun ubiquination levels were higher in TBL3 cells transfected with the miR-155 Sponge (Supplementary Figure S3C). [score:1]
miR-155 was also shown to cause cancer in genetically engineered mice and has been extensively linked to infection and inflammation [31], [34], [35]. [score:1]
The miR-155-containing BIC gene, was originally identified as a common site for insertion of proviral DNA in avian virus -induced lymphomas [28], [29] and is induced in human lymphomas transformed by Epstein-Barr Virus (EBV) [30], [36], [37]. [score:1]
Analysis of the c-Jun mRNA levels by qPCR also confirmed that the effects of miR-155, siDET1 and the miR-155 Sponge are at the protein level without changes in c-Jun transcripts (Supplementary Figure S3A and S3B). [score:1]
The transfection of TBL3 cells with the miR-155 Sponge also caused significant apoptosis, as revealed by flow cytometry or Caspase-3 activation, equivalent to that induced by killing the parasite with Buparvaquone (Figure 7B and 7C). [score:1]
miR-155 resides in a non-coding transcript, called BIC, first identified in chickens as a site of retroviral insertion in avian leukosis virus -induced lymphomas [28], [29]. [score:1]
miR-155 induction does seem to be a common feature in several inflammatory and tumorigenic scenarios. [score:1]
Unique/different short spacer regions are included between inverted miR-155 sequences to prevent the formation of exact repeats (to prevent recombination events). [score:1]
This feedback loop is essential for miR-155 oncogenic function and, thus, Theileria infection of the host leukocytes creates a transformed state involving addiction to both parasite and oncomiR. [score:1]
Finally, we looked at c-Jun ubiquitination in our cells; transfection with either miR-155 or siDET1 decreased c-Jun ubiquitination in BL3 cells, consistent elevated c-Jun stability (Figure 5D). [score:1]
Furthermore, as the miR-155 binding site is highly conserved across species, it is likely that a similar loop could function in human cancers. [score:1]
Silencing by microRNA-155. [score:1]
1003222.g007 Figure 7 (A) The colony forming potential of TBL3 cells was markedly reduced by transfection with miR-155 Sponge or Dominant Negative (DN) c-Jun. [score:1]
For mutant DET1 (previously unpublished), the miR-155 binding sites were mutated by exchanging 4 bases within the seed sequence. [score:1]
For the miR-155 Sponge plasmid, 10 inverted copies of a bulge forming anti-sense miR-155 sequences (5′- ACTAGTACCCCTATCAGTCTAGCATTAAGGGTTTACCCCTATCAATGTAGCATTAACACAGAACCCCTATCAGAGTAGCATTAAGAGCAGACCCCTATCATTGTAGCATTAAGTGGAAACCCCTATCAACTTAGCATTAACCTTGAACCCCTATCAAGGTAGCATTAAGGACCAACCCCTATCATACTAGCATTAACGAGATACCCCTATCATCTTAGCATTAACCAGGTACCCCTATCAGGATAGCATTAAGGTGCTACCCCTATCAGCCTAGCATTAATCTAGA-3′) were cloned downstream from the GFP gene in the vector, pMSCV-puro-GFP-miRcntl between the NotI and EcoRI sites, as previously described [50]. [score:1]
Indeed, previous studies of miR-155 in EBV-transformation indicated an enrichment for induced genes with AP-1 binding sites in their promoters [30]. [score:1]
Conversely, the miR-155 Sponge enhanced c-Jun degradation in infected TBL3 cells and this was rescued by siDET1 (Figure 5B). [score:1]
In unparasitized BL3 cells, transfection with miR-155, siDET1 or c-Jun led to induction of the BIC-Luciferase reporter. [score:1]
miR155 (Gene ID: 406947) sequences were cloned downstream from the GFP gene in pMSCV-puro-GFP as previously described [30]. [score:1]
The miR-155/c-Jun loop is essential for growth and survival. [score:1]
It is possible that NFκB plays a role in BIC induction upon infection and that a epigenetic switch subsequently creates a dependence on the BIC/miR-155/c-Jun loop to maintain the transformed phenotype. [score:1]
Cells were seeded in 24-well plates for 24 h, and then transfected or co -transfected with 1 µg of the indicated constructs for 36 h. The cells are transfected with luciferase constructs with or without miR-155, Sponge, c-Jun, DN c-Jun and with or without Buparvaquone treatment. [score:1]
Comparative genomic analysis revealed that the BIC gene is conserved across species and that the mature miR-155 sequence is identical between human and bovine genomes [38] (Figure 2B). [score:1]
Here, we showed that the miR-155 effects in DET1 levels led to changes in c-Jun ubiquitination and stabilization without affecting c-Jun transcriptional control. [score:1]
Conversely, transfecting miR-155 into BL3 cells reduced DET1 levels and led to elevated c-Jun protein(Figure 4E). [score:1]
Transfection of parasitized TBL3 cells with either the miR-155 Sponge or DN c-Jun caused a dramatic decrease in the number of colonies (Figure 7A). [score:1]
Thus, the miR-155 oncomiR loop is essential for parasite -induced host cell growth and survival, thereby creating a state of oncogene addiction (Figure 7D). [score:1]
Transient transfected TBL3 cells with miR-155 Sponge were treated 3 h with 20 µM MG132. [score:1]
We showed that both miR-155 and siDET1 decreased c-Jun degradation in BL3 cells (Figure 5A). [score:1]
[1 to 20 of 100 sentences]
2
[+] score: 64
Previous literature has revealed the substantial involvement of miR-155 in both innate and adaptive immunity, including the inhibition of the MyD88 -dependent toll-like receptor pathway [41], immunoglobulin class switching, Th17/IL-17 axis enhancement, and Th1 upregulation with Th2 downregulation [36]. [score:9]
Meanwhile, miR-146a-5p, miR-147b, and miR-155-5p were significantly downregulated from day 7 and were repressed along the disease course, reaching the lowest level of expression at day 15. [score:8]
Firstly, NF- κB upstream factors such as MyD88 [45], TAB2 [46], IKK ε, and RIP1 [35], which are normally inhibited by miR-155, may be overexpressed following the downregulation of miR-155. [score:8]
miR-146a-5p, miR-155-5p, miR-147b, and miR-223-3p were downregulated, while miR-182-5p, miR-183-5p, and miR-9-3p were upregulated. [score:7]
Secondly, the Th1 lineage may be abated after the downregulation of miR-155, which subsequently results in high levels of Th17 axis expression. [score:6]
In accordance with our findings, miR-155 downregulation has also been noted in human subjects with active Behçet's disease [47]. [score:6]
Among the miRNAs studied, miR-146a-5p, miR-155-5p, miR-182-5p, and miR-183-5p are four particularly crucial miRNAs for the following reasons: they all show significant differential profiles in the disease course; they all regulate NF- κB pathway, and miR-146a-5p and miR-155-5p are regarded as potent immunological drivers; they all have been reported in some uveitis mo dels. [score:4]
The downregulation of miR-155 may possibly contribute to EAAU emergence. [score:4]
The expression levels of miR-146a-5p, miR-155-5p, miR-182-5p, and miR-183-5p in iris/ciliary bodies and popliteal lymph nodes are shown in Figure 3. The levels of miR-146a-5p and miR-155-5p in the popliteal lymph nodes reached their lowest point earlier, on day 7, while those in the iris/ciliary body tissue kept decreasing until day 15 after immunization. [score:3]
These contradictory results reflect the fact that multiple targets of the intracellular pathways can be manipulated by miR-155. [score:3]
In contrast, miR-155 was regarded as a positive regulator in both cellular and humoral immune responses in some studies. [score:2]
While the positive contribution of the immune response in clinical and experimental arthritis [42] and multiple sclerosis [43] has been noted, miR-155 knockout mice suffered from an exaggerated autoimmune response in the lungs, indicating its role in the prevention of asthma [44]. [score:2]
miR-155 -deficient mice failed to secrete class-switched immunoglobulins [24] and exhibited diminished production of Th17 cells [25]. [score:1]
The earlier changes of miR-146a-5p and miR-155-5p in the popliteal lymph nodes than in the iris/ciliary bodies also demonstrate the immunoanatomical fact that antigen presentation with T cell maturation has already taken place in the closest draining lymph node. [score:1]
[1 to 20 of 14 sentences]
3
[+] score: 50
To this end, we performed cluster analysis on the predicted targets of five different dynamically expressed miRNAs using TargetScan and miRDB (miR-155: 116 targets; mir-222: 140 targets; miR-21: 108 targets; let-7d: 314 targets; and miR-190a: 59 targets). [score:17]
In the cases of miR-155 and miR-222-3p, expression was determined relative to MII oocytes since target amplification in GV oocytes was low, resulting in specious enhancement of expression changes that were misleading. [score:7]
The proteins encoded by the predicted mRNA targets of miR-155 were grouped into three functional clusters including “positive regulation of RNA metabolic process”, “negative regulation of protein metabolic process”, and “regulation of transcription from RNA polymerase II promoter” as seen in Figure 4A. [score:6]
MicroRNA-155 is a major miRNA induced at this time point and one of the major functional clusters identified in miR-155 targets is the regulation of transcription from RNA polymerase II transcription factor activity, suggesting associations between the two processes. [score:4]
O’Connell R. M. Chaudhuri A. A. Rao D. S. Baltimore D. Inositol phosphatase SHIP1 is a primary target of miR-155 Proc. [score:3]
The observed increase in pri-miRNA levels suggests that the primary mechanism for the increase in miR-155 and -222 expression observed through maturation is an increase in transcription of the primary miRNA and subsequent processing. [score:3]
Additionally, another confirmed mRNA target of miR-155 is inositol 5-phosphatase 1 (INPP5D) [38] and a decrease in INPP5D has been proven to increase AKT activity [39], a pathway involved in bovine oocyte maturation [40]. [score:3]
Huang X. Shen Y. Liu M. Bi C. Jiang C. Iqbal J. McKeithan T. W. Chan W. C. Ding S. -J. Fu K. Quantitative proteomics reveals that miR-155 regulates the PI3K-AKT pathway in diffuse large B-cell lymphoma Am. [score:2]
The results presented in Figure 3 demonstrate that pri-miR-155 and pri-miR-222-3p were both absent at the GV stage and present at the PZ stage in all pools tested (Figure 3A). [score:1]
The RT-PCR program consisted of 95 °C for 2 min, 45 cycles of 95 °C for 10 s and 60 °C for 30 s. Pri-mir-155 and pri-miR-222-3p RT-PCR products were then visualized by gel electrophoresis in a 2% agarose gel, whereas pri-let-7d were qRT-PCR results were analyzed on the Bio-Rad CFX Manager Software. [score:1]
In contrast to the increases seen with pri-miR-155 and -222-3p, pri-let-7d levels were highest in GV oocytes and decreased significantly upon maturation and fertilization (Figure 3B), in spite of the increase observed in the levels of mature let-7d miRNA. [score:1]
In contrast, pri-miR-155 and -222 were not detected in GV oocytes, but were consistently present in presumptive zygotes and variably at the MII stage using standard RT-PCR. [score:1]
Upon maturation and fertilization, miR-155 levels were increased. [score:1]
[1 to 20 of 13 sentences]
4
[+] score: 35
In addition to targeting this specific transcription factor, quercetin has been reported to target at miR155 for reduced expression of this particular miRNA, subsequently, reduced cognate gene (TNF) of miR155 in the gene expression. [score:9]
Boesch-Saadatmandi et al. [24] and Li et al. [21] revealed the action of quercetin in suppressing NF-κB, and miR155 whereas stimulating Nrf2 and HO-1, consequently, downregulation of TNF. [score:6]
The transcription of certain miRNAs found in immune cells, such as miR-155 and miR-146a, is upregulated in response to inflammatory stimuli, e. g., TLR ligands or proinflammatory cytokines [33, 40]. [score:4]
Among many miRNAs, the role of miR-155 is to upregulate proinflammatory cytokines, including TNF-α and IL6, in response to bacterial infection and chronic inflammation [32, 33]. [score:4]
A study by Dilda et al. challenging bovine monocytes with E. coli LPS revealed the upregulation of miR-9, miR-125b, miR-155, miR-146a, and miR-223. [score:4]
Given the proinflammatory activity of miR-155, upregulation of this miRNA may amplify the proinflammatory loop during the first phase of the innate immune reaction, consistent with the acute inflammatory reaction that follows E. coli infection. [score:4]
According to the study by Dilda et al., the stimulation of bovine monocytes with LPS upregulated both miR-155 and miR-146a [22]. [score:4]
[1 to 20 of 7 sentences]
5
[+] score: 31
In summary, by establishing the expression patterns of miRNAs and their putative targets in granulosa and theca cells of healthy and atretic follicles in cattle, we have identified a network of miRNAs including miR-199a-5p, miR-155, miR-222, miR-150, and miR-378, which we propose are involved in follicle atresia through combined targeting of genes involved in cell survival, proliferation, and differentiation; namely HIF1A and VEGFA in granulosa cells and MSH2, ETS1, JAG1, and VEGFA in theca cells. [score:7]
Our results implicate a network of miRNAs, namely, miR-199a-5p, miR-155, miR-150, and miR-378, in the downregulation of the HIF1A-VEGF effector system during atresia, with one miRNA, miR-199a-5p, simultaneously targeting both genes, as reported in other cell types [33]. [score:6]
Interestingly, a study showed that another miRNA, miR-26a, targeted the cell cycle checkpoint kinase, ATM, in porcine follicular cells during atresia, leading to increased DNA breaking and apoptosis, and raising the possibility that miR-155 could exert a similar effect through targeting MSH2 in bovine theca cells. [score:5]
Five of the 9 miRNAs confirmed to be upregulated in atretic follicles in the present study (miR-21-5p, miR-21-3p, miR-222, miR-155, and miR-199a-5p) were also found to be increased in subordinate relative to dominant follicles on day 3 of the bovine estrous cycle using deep-sequencing rather than microarray [12]. [score:4]
For example, although most of the miRNAs analyzed in this study are known not to be cell-specific, miR-150 and miR-155 are highly expressed and primarily regulate hematopoietic and vascular cells. [score:4]
MSH2, a gene involved in DNA mismatch repair, was confirmed as a target of miR-155 in theca cells. [score:3]
Of the 12 predicted high-confidence interactions analyzed, 5 were confirmed by, specifically involving miR-199a-5p and HIF1A in granulosa cells, miR-155/miR-222 and ETS1 in theca cells, miR-199a-5p and JAG1 in theca cells, and miR-199a-5p and VEGFA in both granulosa and theca cells (miRNAs indicated in bold in Fig.  3A). [score:1]
Of 8 predicted medium-confidence interactions analyzed (Table 3), 4 were confirmed involving miR-155 and HIF1A in granulosa cells, miR-150 and VEGFA in both granulosa and theca cells, miR-378 and VEGFA in granulosa cells, and miR-155 and MSH2 in theca cells (Fig.  3A). [score:1]
[1 to 20 of 8 sentences]
6
[+] score: 29
In conclusion, miR-21, miR-146a, miR-155, miR-222, and miR-383 expression levels were significantly upregulated in the CMT+ milk. [score:6]
The expression levels of five miRNA (miR-21, miR-146a, miR-155, miR-222, and miR-383) were significantly upregulated in the CMT+ group, compared with in the CMT− and normal groups. [score:5]
We identified that miR-21, miR-146a, miR-155, miR-222, and miR-383 were significantly upregulated in CMT+ milk. [score:4]
We selected the miRNA that were significantly upregulated in the CMT+ group (miR-21, miR-146a, miR-155, miR-222, and miR-383) for QuantStudio 3D Digital PCR System analysis. [score:4]
miR-146a and miR-155 expression level are induced by expose human acute monocytic leukemia cell line THP-1 to LPS [40]. [score:3]
We found a strong negative correlation between the Ct values obtained via qPCR and the values for copies/μL obtained via digital PCR (the Pearson r values for miR-21, miR-146a, miR-155, miR-222, and miR-383 were −0.8433, −0.7853, −0.8849, −0.9256, and −0.8008, respectively)(Fig 5A), and a strong positive correlation between relative expression levels obtained via qPCR and the values for copies/μL obtained via digital PCR (the Pearson r values for miR-21, miR-146a, miR-155, miR-222, and miR-383 were 0.7897, 0.9047, 0.7660, 0.9536, and 0.7676, respectively)(Fig 5B). [score:3]
Additionally, we included miR-146a and miR-155, which are known to be related to inflammation [40], as candidates in the second phase experiment. [score:1]
We found that miR-146a, miR-155 and miR-222 had high predictive values (0.9 < AUC < 1); and miR-21 and miR-383 had moderate predictive values (0.7 < AUC < 0.9). [score:1]
miR-21, miR-146a, miR-155, miR-222, and miR-383 had sensitivity of 82%, 88%, 94%, 94%, and 88%, and specificity of 89%, 100%, 90%, 93%, and 83% in differentiating CMT+ milk from normal milk, respectively. [score:1]
We included miR-146a and miR-155 in the second phase of this study. [score:1]
[1 to 20 of 10 sentences]
7
[+] score: 24
Other miRNAs from this paper: bta-mir-26a-2, bta-mir-29a, bta-let-7f-2, bta-mir-16b, bta-mir-21, bta-mir-221, bta-mir-222, bta-mir-30d, bta-mir-99a, bta-mir-145, bta-mir-181a-2, bta-mir-199a-1, bta-mir-27b, bta-mir-142, bta-mir-181b-2, bta-mir-30e, bta-mir-92a-2, bta-let-7d, bta-mir-132, bta-mir-181c, bta-mir-191, bta-mir-199b, bta-mir-214, bta-mir-29b-2, bta-mir-29c, bta-mir-455, bta-let-7g, bta-mir-10b, bta-mir-24-2, bta-let-7a-1, bta-mir-150, bta-let-7f-1, bta-mir-122, bta-let-7i, bta-mir-34c, bta-mir-363, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-195, bta-mir-34a, bta-mir-365-1, bta-mir-99b, bta-mir-100, bta-mir-129-1, bta-mir-129-2, bta-mir-130a, bta-mir-130b, bta-mir-133a-2, bta-mir-133a-1, bta-mir-143, bta-mir-146b, bta-mir-146a, bta-mir-181d, bta-mir-182, bta-mir-183, bta-mir-184, bta-mir-24-1, bta-mir-196a-2, bta-mir-196a-1, bta-mir-199a-2, bta-mir-212, bta-mir-26a-1, bta-mir-28, bta-mir-29d, bta-mir-32, bta-mir-335, bta-mir-338, bta-mir-339a, bta-mir-346, bta-mir-365-2, bta-mir-378-1, bta-mir-383, bta-mir-409a, bta-mir-449a, bta-mir-449b, bta-mir-449c, bta-mir-592, bta-mir-708, bta-mir-92a-1, bta-mir-92b, bta-mir-29e, bta-mir-29b-1, bta-mir-1271, bta-mir-1249, bta-mir-181a-1, bta-mir-181b-1, bta-mir-2285a, bta-mir-2285d, bta-mir-2285b-1, bta-mir-2332, bta-mir-199c, bta-mir-2389, bta-mir-2285c, bta-mir-2404-1, bta-mir-449d, bta-mir-2411, bta-mir-2446, bta-mir-339b, bta-mir-2404-2, bta-mir-2483, bta-mir-424, bta-mir-378-2, bta-mir-409b, bta-mir-2285e-1, bta-mir-2285e-2, bta-mir-2285f-1, bta-mir-2285f-2, bta-mir-2285g-1, bta-mir-2285h, bta-mir-2285i, bta-mir-2285j-1, bta-mir-2285j-2, bta-mir-2285k-1, bta-mir-2285l, bta-mir-2285o-1, bta-mir-2285o-2, bta-mir-2285n-1, bta-mir-2285n-2, bta-mir-2285p, bta-mir-2285m-1, bta-mir-2285m-2, bta-mir-378b, bta-mir-2285n-3, bta-mir-2285n-4, bta-mir-2285o-3, bta-mir-2285o-4, bta-mir-2285m-3, bta-mir-378c, bta-mir-2285m-4, bta-mir-2285o-5, bta-mir-2285m-5, bta-mir-2285n-5, bta-mir-2285n-6, bta-mir-2285n-7, bta-mir-2285k-2, bta-mir-2285k-3, bta-mir-2285k-4, bta-mir-2285k-5, bta-mir-2285q, bta-mir-2285r, bta-mir-2285s, bta-mir-2285t, bta-mir-2285b-2, bta-mir-2285v, bta-mir-2285g-2, bta-mir-2285g-3, bta-mir-2285af-1, bta-mir-2285af-2, bta-mir-2285y, bta-mir-2285w, bta-mir-2285x, bta-mir-2285z, bta-mir-2285u, bta-mir-2285aa, bta-mir-2285ab, bta-mir-2285ac, bta-mir-2285ad, bta-mir-2285ae, bta-mir-378d, bta-mir-2285ag, bta-mir-2285ah, bta-mir-2285ai, bta-mir-2285aj, bta-mir-2285ak, bta-mir-2285al, bta-mir-2285am, bta-mir-2285ar, bta-mir-2285as-1, bta-mir-2285as-2, bta-mir-2285as-3, bta-mir-2285at-1, bta-mir-2285at-2, bta-mir-2285at-3, bta-mir-2285at-4, bta-mir-2285au, bta-mir-2285av, bta-mir-2285aw, bta-mir-2285ax-1, bta-mir-2285ax-2, bta-mir-2285ax-3, bta-mir-2285ay, bta-mir-2285az, bta-mir-2285an, bta-mir-2285ao-1, bta-mir-2285ao-2, bta-mir-2285ap, bta-mir-2285ao-3, bta-mir-2285aq-1, bta-mir-2285aq-2, bta-mir-2285ba-1, bta-mir-2285ba-2, bta-mir-2285bb, bta-mir-2285bc, bta-mir-2285bd, bta-mir-2285be, bta-mir-2285bf-1, bta-mir-2285bf-2, bta-mir-2285bf-3, bta-mir-2285bg, bta-mir-2285bh, bta-mir-2285bi-1, bta-mir-2285bi-2, bta-mir-2285bj-1, bta-mir-2285bj-2, bta-mir-2285bk, bta-mir-2285bl, bta-mir-2285bm, bta-mir-2285bn, bta-mir-2285bo, bta-mir-2285bp, bta-mir-2285bq, bta-mir-2285br, bta-mir-2285bs, bta-mir-2285bt, bta-mir-2285bu-1, bta-mir-2285bu-2, bta-mir-2285bv, bta-mir-2285bw, bta-mir-2285bx, bta-mir-2285by, bta-mir-2285bz, bta-mir-2285ca, bta-mir-2285cb, bta-mir-2285cc, bta-mir-2285cd, bta-mir-2285ce, bta-mir-2285cf, bta-mir-2285cg, bta-mir-2285ch, bta-mir-2285ci, bta-mir-2285cj, bta-mir-2285ck, bta-mir-2285cl, bta-mir-2285cm, bta-mir-2285cn, bta-mir-2285co, bta-mir-2285cp, bta-mir-2285cq, bta-mir-2285cr-1, bta-mir-2285cr-2, bta-mir-2285cs, bta-mir-2285ct, bta-mir-2285cu, bta-mir-2285cv-1, bta-mir-2285cv-2, bta-mir-2285cw-1, bta-mir-2285cw-2, bta-mir-2285cx, bta-mir-2285cy, bta-mir-2285cz, bta-mir-2285da, bta-mir-2285db, bta-mir-2285dc, bta-mir-2285dd, bta-mir-2285de, bta-mir-2285df, bta-mir-2285dg, bta-mir-2285dh, bta-mir-2285di, bta-mir-2285dj, bta-mir-2285dk, bta-mir-2285dl-1, bta-mir-2285dl-2, bta-mir-2285dm
From these, the expression level of 4 miRNAs, namely bta-miR-1271, bta-miR-100, bta-miR-424-5p and bta-miR-2285k was downregulated while the expression level of only one miRNA, bta-miR-155, was significantly upregulated in granulosa cells of SF at day 7 compared to day 3. Moreover, 4 of these 5 miRNAs, namely, bta-miR-1271, bta-miR-424-5p, bta-miR-155 and bta-miR-2285k were also differentially expressed in granulosa cells of DF between day 3 and day 7 of the estrous cycle. [score:12]
For this, 8 differentially expressed miRNAs both at day 3 and day 7 of the estrous cycle, namely bta-miR-708, bta-miR-214, bta-miR-335, bta-miR-221, bta-miR-21-3p, bta-miR-21-5p, bta-miR-155 and bta-miR-34c and 3 miRNAs; bta-miR-195, bta-miR-365-5p and bta-miR-409 which were differentially expressed only at day 7 of the estrous cycle and 1 miRNA; bta-miR-34c that was differentially expressed at day 3 of the estrous cycle were analysed in theca cells. [score:7]
Among these, the expression level of 14 miRNAs including bta-miR-449a, bta-miR-449c, bta-miR-212, bta-miR-222, bta-miR-21-3p and bta-miR-155 were increased while the expression level of 2 miRNAs (bta-miR-183, bta-miR-34c) was decreased in SF groups. [score:5]
[1 to 20 of 3 sentences]
8
[+] score: 16
We identified the potential regulatory miRNAs (miR-155, miR-146a, miR-223, miR-21, miR-16 and miR-215) targeting the candidate genes in oviductal epithelial cells, using bioinformatics tools. [score:4]
Then we filtered the miRNA hits on the basis their potential relevance for physiological function and immune response of oviduct at least in four different search algorithms, and thus, miR-16, miR-21, miR-223, miR-215, miR-146a and miR-155 were identified as a potential miRNAs targeting our genes of interest. [score:3]
Interestingly, miR-16, miR-21, miR-223 and miR-215 were reported by [24], where these miRNAs are differentially expressed between healthy and sub-clinical endometritis cows, but miR-146a and miR-155 are indicated to be endotoxin-responsive genes [25, 26]. [score:3]
S2 Fig RT-PCR of miR-155 and its target genes (IL1β, CASP3 and IGF2) in BOEC after LPS challenge for 48hr. [score:3]
The overall results showed that miR-155, miR-146a, miR-223, miR-21, miR-16 and miR-215 have shown a clear inhibition in challenged group after BOEC treated with LPS for 24h (Fig. 4). [score:3]
[1 to 20 of 5 sentences]
9
[+] score: 16
Analyzing miRNA expression in oocytes and cumulus cells using a PCR array showed a negative fold change of miR-155 expression between bovine oocytes and cumulus cells, indicating higher expression in cumulus cells than in oocytes. [score:7]
miR-155 was also found to be abundantly expressed in exosomes recovered from bovine follicular fluid, and the expression level was higher in fluid from follicles that contained a growing oocyte compared to those with a fully-grown oocyte [41]. [score:4]
Based on the high expression levels of miR-155 in cumulus cells, it seems likely that this miRNA is produced by the cumulus cells themselves, although it cannot be excluded that cumulus cells take up miR-155 from the follicular fluid. [score:3]
Different members of the let-7 family, miR-155 and miR-99a-5p also gave more than 100,000 reads in each group (Table 2). [score:1]
Our sequencing results showed that miR-21-5p is the most abundant miRNA in bovine cumulus cells, followed by various members of the let-7 family and miR-155. [score:1]
[1 to 20 of 5 sentences]
10
[+] score: 13
Other miRNAs from this paper: bta-mir-16b, bta-mir-16a, bta-mir-217
Several transcriptional regulators were predicted to be significantly inhibited (e. g. IL12 and IL18) or activated (e. g. miR155-5p) in PBMC during infection. [score:4]
Three mature miRNAs were predicted to be significantly activated (miR-16-5p and miR-155-5p) or inhibited (miR-217-5p) for downstream regulation at the acute stage of infection (Table 4). [score:4]
Particularly, miR-155-5p is predicted to be significantly activated (z-score = 2.1; overlap p-value = 5.61E-08) with 55 predicted target genes in our dataset (such as IFNG, IL6, IL1A, TNF and chemokine ligands). [score:3]
Therefore this lends an impetus for exploring the role of miR-155-5p in F. hepatica infection. [score:1]
The mature miR-155 (miR-155-5p) has been demonstrated to be one of the five major miRNAs that is specific for hematopoietic cells including B cells, T cells, monocytes and granulocytes [45]. [score:1]
[1 to 20 of 5 sentences]
11
[+] score: 13
The summary of the six DE miRNA common to all species is described in Fig.   5. Briefly, all DE candidates were single copy miRNA across all libraries, and 4 DE miRNA (miR-101-3p, miR-16-5p, miR-143-3p and miR-155-5p) were up-regulated in bats while 2 (miR-125-5p and miR-221-5p) were down-regulated. [score:7]
Interestingly, miR-155 also targets Bach1, a negative regulator of Nrf2, which is a core activator of the antioxidant response signaling pathway [38]. [score:4]
miR-155 is a multifunctional miRNA regulating inflammation, immunity and oncogenic pathways [37]. [score:2]
[1 to 20 of 3 sentences]
12
[+] score: 13
Other miRNAs from this paper: hsa-mir-155
The animals infected with M.  tuberculosis H37Rv showed a steady increase in expression of miR-155 after PPD-B stimulation over the course of infection, while M.  bovis infected animals showed a greater baseline expression prior to infection and hence a more modest increase over the time course. [score:5]
miR-155 has been identified as a potential biomarker of disease development and/or severity in cattle infected with M.  bovis [49]. [score:4]
miR-155 analysis. [score:1]
While a single miRNA will lack specificity as a biomarker, these results support the potential of miR-155 as a part of a biomarker panel to assess infection with tubercle bacilli. [score:1]
To explore its utility in this study, we analysed the abundance of miR-155 in PPD-B stimulated vs. [score:1]
MicroRNA miR-155 was selected for analysis based on its suggested role in immune response to M. bovis infection [49]. [score:1]
[1 to 20 of 6 sentences]
13
[+] score: 11
We selected 8 miRNAs that were reported to be upregulated (miR-145, miR-143, miR-99a-5p) or downregulated (miR-155 and miR-142-3p, miR-132, miR-378) in follicular relative to luteal tissues of ruminants [19, 21] or differentially expressed in endometrium during the human menstrual cycle (miR-31) [48– 50]. [score:9]
Out of the remaining 5 miRNAs, miR-155, miR-378 and miR-455-5p did not change (P > 0.1) during the oestrous cycle when analysed by RT-qPCR. [score:1]
We selected 8 miRNA candidates identified by sequencing (miR-125b, miR-155, miR-199a-5p, miR-381, miR-99b; Table 2) or PCR array (let-7f, miR-378, miR-455-5p; Table 3) for. [score:1]
[1 to 20 of 3 sentences]
14
[+] score: 10
Other miRNAs from this paper: hsa-mir-17, hsa-mir-19a, hsa-mir-29a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-198, hsa-mir-208a, hsa-mir-10a, hsa-mir-223, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-126, hsa-mir-146a, hsa-mir-150, hsa-mir-155, hsa-mir-29c, hsa-mir-99b, hsa-mir-296, hsa-mir-196b, hsa-mir-515-1, hsa-mir-515-2, hsa-mir-548a-1, hsa-mir-548b, hsa-mir-548a-2, hsa-mir-550a-1, hsa-mir-550a-2, hsa-mir-548a-3, hsa-mir-548c, hsa-mir-640, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-550a-3, bta-mir-29a, bta-mir-125b-1, bta-mir-126, bta-mir-10a, bta-mir-124a-1, bta-mir-17, bta-mir-29b-2, bta-mir-29c, bta-mir-150, bta-mir-122, bta-mir-125b-2, bta-mir-19a, bta-mir-99b, hsa-mir-208b, hsa-mir-548e, hsa-mir-548j, hsa-mir-548k, hsa-mir-548l, hsa-mir-548f-1, hsa-mir-548f-2, hsa-mir-548f-3, hsa-mir-548f-4, hsa-mir-548f-5, hsa-mir-548g, hsa-mir-548n, hsa-mir-548m, hsa-mir-548o, hsa-mir-548h-1, hsa-mir-548h-2, hsa-mir-548h-3, hsa-mir-548h-4, hsa-mir-548p, hsa-mir-548i-1, hsa-mir-548i-2, hsa-mir-548i-3, hsa-mir-548i-4, bta-mir-124a-2, bta-mir-124b, bta-mir-146a, bta-mir-196b, bta-mir-208a, bta-mir-208b, bta-mir-223, bta-mir-296, bta-mir-29d, bta-mir-9-1, bta-mir-9-2, bta-mir-29e, bta-mir-29b-1, hsa-mir-548q, bta-mir-2284i, bta-mir-2285a, bta-mir-2284s, bta-mir-2285d, bta-mir-2284l, bta-mir-2284j, bta-mir-2284t, bta-mir-2285b-1, bta-mir-2284d, bta-mir-2284n, bta-mir-2284g, bta-mir-2284p, bta-mir-2284u, bta-mir-2284f, bta-mir-2284a, bta-mir-2284k, bta-mir-2284c, bta-mir-2284v, bta-mir-2285c, bta-mir-2284q, bta-mir-2284m, bta-mir-2284b, bta-mir-2284r, bta-mir-2284h, bta-mir-2284o, bta-mir-2284e, hsa-mir-548s, hsa-mir-548t, hsa-mir-548u, hsa-mir-548v, hsa-mir-548w, hsa-mir-548x, bta-mir-2284w, bta-mir-2284x, hsa-mir-548y, hsa-mir-550b-1, hsa-mir-550b-2, hsa-mir-548z, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548o-2, hsa-mir-548h-5, hsa-mir-548ab, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548x-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-548am, hsa-mir-548an, hsa-mir-548ao, hsa-mir-548ap, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, bta-mir-2284y-1, bta-mir-2285e-1, bta-mir-2285e-2, bta-mir-2285f-1, bta-mir-2285f-2, bta-mir-2285g-1, bta-mir-2285h, bta-mir-2285i, bta-mir-2285j-1, bta-mir-2285j-2, bta-mir-2285k-1, bta-mir-2285l, hsa-mir-548ay, hsa-mir-548az, bta-mir-2285o-1, bta-mir-2285o-2, bta-mir-2285n-1, bta-mir-2285n-2, bta-mir-2285p, bta-mir-2285m-1, bta-mir-2285m-2, bta-mir-2284y-2, bta-mir-2285n-3, bta-mir-2285n-4, bta-mir-2284y-3, bta-mir-2285o-3, bta-mir-2285o-4, bta-mir-2285m-3, bta-mir-2284y-4, bta-mir-2284y-5, bta-mir-2284y-6, bta-mir-2285m-4, bta-mir-2285o-5, bta-mir-2285m-5, bta-mir-2285n-5, bta-mir-2285n-6, bta-mir-2284y-7, bta-mir-2285n-7, bta-mir-2284z-1, bta-mir-2284aa-1, bta-mir-2285k-2, bta-mir-2284z-3, bta-mir-2284aa-2, bta-mir-2284aa-3, bta-mir-2285k-3, bta-mir-2285k-4, bta-mir-2284z-4, bta-mir-2285k-5, bta-mir-2284z-5, bta-mir-2284z-6, bta-mir-2284z-7, bta-mir-2284aa-4, bta-mir-2285q, bta-mir-2285r, bta-mir-2285s, bta-mir-2285t, bta-mir-2285b-2, bta-mir-2285v, bta-mir-2284z-2, bta-mir-2285g-2, bta-mir-2285g-3, bta-mir-2285af-1, bta-mir-2285af-2, bta-mir-2285y, bta-mir-2285w, bta-mir-2285x, bta-mir-2285z, bta-mir-2285u, bta-mir-2285aa, bta-mir-2285ab, bta-mir-2284ab, bta-mir-2285ac, bta-mir-2285ad, bta-mir-2284ac, bta-mir-2285ae, hsa-mir-548ba, hsa-mir-548bb, hsa-mir-548bc, bta-mir-2285ag, bta-mir-2285ah, bta-mir-2285ai, bta-mir-2285aj, bta-mir-2285ak, bta-mir-2285al, bta-mir-2285am, bta-mir-2285ar, bta-mir-2285as-1, bta-mir-2285as-2, bta-mir-2285as-3, bta-mir-2285at-1, bta-mir-2285at-2, bta-mir-2285at-3, bta-mir-2285at-4, bta-mir-2285au, bta-mir-2285av, bta-mir-2285aw, bta-mir-2285ax-1, bta-mir-2285ax-2, bta-mir-2285ax-3, bta-mir-2285ay, bta-mir-2285az, bta-mir-2285an, bta-mir-2285ao-1, bta-mir-2285ao-2, bta-mir-2285ap, bta-mir-2285ao-3, bta-mir-2285aq-1, bta-mir-2285aq-2, bta-mir-2285ba-1, bta-mir-2285ba-2, bta-mir-2285bb, bta-mir-2285bc, bta-mir-2285bd, bta-mir-2285be, bta-mir-2285bf-1, bta-mir-2285bf-2, bta-mir-2285bf-3, bta-mir-2285bg, bta-mir-2285bh, bta-mir-2285bi-1, bta-mir-2285bi-2, bta-mir-2285bj-1, bta-mir-2285bj-2, bta-mir-2285bk, bta-mir-2285bl, bta-mir-2285bm, bta-mir-2285bn, bta-mir-2285bo, bta-mir-2285bp, bta-mir-2285bq, bta-mir-2285br, bta-mir-2285bs, bta-mir-2285bt, bta-mir-2285bu-1, bta-mir-2285bu-2, bta-mir-2285bv, bta-mir-2285bw, bta-mir-2285bx, bta-mir-2285by, bta-mir-2285bz, bta-mir-2285ca, bta-mir-2285cb, bta-mir-2285cc, bta-mir-2285cd, bta-mir-2285ce, bta-mir-2285cf, bta-mir-2285cg, bta-mir-2285ch, bta-mir-2285ci, bta-mir-2285cj, bta-mir-2285ck, bta-mir-2285cl, bta-mir-2285cm, bta-mir-2285cn, bta-mir-2285co, bta-mir-2285cp, bta-mir-2285cq, bta-mir-2285cr-1, bta-mir-2285cr-2, bta-mir-2285cs, bta-mir-2285ct, bta-mir-2285cu, bta-mir-2285cv-1, bta-mir-2285cv-2, bta-mir-2285cw-1, bta-mir-2285cw-2, bta-mir-2285cx, bta-mir-2285cy, bta-mir-2285cz, bta-mir-2285da, bta-mir-2285db, bta-mir-2285dc, bta-mir-2285dd, bta-mir-2285de, bta-mir-2285df, bta-mir-2285dg, bta-mir-2285dh, bta-mir-2285di, bta-mir-2285dj, bta-mir-2285dk, bta-mir-2285dl-1, bta-mir-2285dl-2, bta-mir-2285dm
Additionally, the deletion of the dicer1 gene, which is critical for proper miRNA processing, results in impaired T cell development (19), while miR-17–92, miR-150, and miR-155 have been demonstrated to be critical for B cell development. [score:3]
Other roles for miRNAs in regulating adaptive immunity have also been shown, including the regulation of B and T lymphocyte functions, including antibody production, by miR-155 (20– 22). [score:3]
Tumor necrosis factor (TNF) biosynthesis, for example, is inhibited by Mycobacterium tuberculosis – an intracellular mycobacterial pathogen that infects alveolar macrophages – by altering levels of human macrophage miRNAs, including miR-125b and miR-155, for its own benefit (28). [score:3]
The human miRNA, hsa-miR-155, for example, is a perfect homolog to its bovine counterpart bta-miR-155. [score:1]
[1 to 20 of 4 sentences]
15
[+] score: 9
Similarly, miR-132, which is expressed 2.4 times greater in LPS challenged PBMCs than the control, have been initially identified and showed increased expression, along with miR-146and miR-155, in the human monocytic THP-1 cell line in response to lipo-polysaccharide (LPS) [14]. [score:5]
Moreover, the myeloid differentiation primary-response protein 88 (MYD88), TAK1 -binding protein 2 (TAB2), and TRAF6 are the direct targets of miR-155 [15]. [score:4]
[1 to 20 of 2 sentences]
16
[+] score: 7
Other miRNAs from this paper: hsa-mir-126, hsa-mir-155, bta-mir-126
Theileria-infection also induces high levels of miR-155 that regulates a feedback loop leading to sustained c-Jun protein levels [28] and infection upregulates miR-126-5p levels leading to suppression of JIP-2 liberating JNK1 to translocate to the nucleus and phosphorylate c-Jun [29]. [score:7]
[1 to 20 of 1 sentences]
17
[+] score: 6
Moreover, knockdown of SMAD5 by overexpressing the miR-155 expression enhanced the aggressiveness of diffuse large B cell lymphoma in vivo [52]. [score:6]
[1 to 20 of 1 sentences]
18
[+] score: 6
Other miRNAs from this paper: hsa-mir-155, hsa-mir-301b, bta-mir-301b
Glucocorticoids inhibit lipopolysaccharide -mediated inflammatory response by downregulating microRNA-155: a novel anti-inflammation mechanism. [score:6]
[1 to 20 of 1 sentences]
19
[+] score: 6
The expression levels of miR-25, miR-155, miR-182, miR-191, miR-221, miR-223, and/or miR-375 have been reported to change in the mammary gland tissues of cows [7], goats [8], milk from pigs [3], and rat milk whey [29] during lactation, and therefore we also analyzed these miRNAs. [score:3]
In contrast, the expressions of miR-155, miR-182, miR-200c, and miR-339a in the BMEC culture medium were lower in the DIP -treated BMECs than in the untreated BMECs (P = 0.088, = 0.061, = 0.067, and = 0.017, respectively) (Fig.   4b). [score:3]
[1 to 20 of 2 sentences]
20
[+] score: 6
Even more specifically, using a miRNA microarray, Golby et al. (2014) showed that expression of miR-155 could act as a biomarker of both tuberculosis disease development and the severity of the pathology. [score:6]
[1 to 20 of 1 sentences]
21
[+] score: 6
For example, five inflammation-related miRNAs (miR-9, miR-125b, miR-155, miR-146a and miR-223) were differentially expressed in bovine CD14+ monocytes stimulated with either LPS or Staphylococcus aureus enterotoxin B (SEB) [14]. [score:3]
Tili E. Michaille J. J. Cimino A. Costinean S. Dumitru C. D. Adair B. Croce C. M. Modulation of miR-155 and miR-125b levels following lipopolysaccharide/TNF-α stimulation and their possible roles in regulating theresponse to endotoxin shock J. Immunol. [score:2]
It was shown that miR-155 promotes the production of TNF-α in human embryonic kidney cells (HEK-293), indicating the positive role of miR-155 to modulate the release of inflammatory mediators [13]. [score:1]
[1 to 20 of 3 sentences]
22
[+] score: 5
The expression of miR-155, miR-146 and miR-21 can be induced by TLR activation and target the 3′UTR of mRNAs encoding TLR signalling pathway molecules, such as IL-1R -associated kinase 1 and TNFR -associated factor 6 [20]. [score:5]
[1 to 20 of 1 sentences]
23
[+] score: 5
A role for miR-155 in the virulence of T. annulata-infected leukocytes occurs via its suppression of De-Etiolated Homolog 1 (DET-1) expression that diminishes c-Jun ubiquitination [9]. [score:5]
[1 to 20 of 1 sentences]
24
[+] score: 5
Immune cell related miRNAs, such as miR-146a, miR-155, miR-221 or miR-15b, as well as highly expressed milk specific miRNAs like miR-148a, miR-221-5p, miR-30a-5p, miR-200a, miR-99a-5p, miR-7f demonstrated a significant correlation while approximately half of the highest expressed miRNAs (let-7a-5p, miR-26a, miR-200c, let-7f, miR-92a) were not significantly correlated between both milk fractions. [score:5]
[1 to 20 of 1 sentences]
25
[+] score: 4
Whether hsa-miR-155 also plays a role in the immune control of polyomaviruses and more specifically in polyomavirus -induced diseases that are dependent on changes in the host immune system is of particular interest but remains to be determined. [score:3]
Recent work has also identified hsa-miR-155 as an important host cell miRNA involved in a more general role in the immune response upon viral infection. [score:1]
[1 to 20 of 2 sentences]
26
[+] score: 4
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-27a, hsa-mir-31, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-16-2, hsa-mir-192, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-181a-2, hsa-mir-205, hsa-mir-181a-1, hsa-mir-214, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-146a, hsa-mir-184, hsa-mir-186, hsa-mir-193a, hsa-mir-194-1, hsa-mir-155, hsa-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-219a-2, hsa-mir-99b, hsa-mir-26a-2, hsa-mir-365a, hsa-mir-365b, hsa-mir-374a, hsa-mir-148b, hsa-mir-423, hsa-mir-486-1, hsa-mir-499a, hsa-mir-532, hsa-mir-590, bta-mir-26a-2, bta-let-7f-2, bta-mir-103-1, bta-mir-148a, bta-mir-16b, bta-mir-21, bta-mir-221, bta-mir-222, bta-mir-27a, bta-mir-499, bta-mir-125b-1, bta-mir-181a-2, bta-mir-205, bta-mir-27b, bta-mir-30b, bta-mir-31, bta-mir-193a, bta-let-7d, bta-mir-148b, bta-mir-186, bta-mir-191, bta-mir-192, bta-mir-200a, bta-mir-214, bta-mir-22, bta-mir-23a, bta-mir-29c, bta-mir-423, bta-let-7g, bta-mir-24-2, bta-let-7a-1, bta-mir-532, bta-let-7f-1, bta-mir-30c, bta-let-7i, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-125b-2, bta-mir-365-1, bta-mir-374a, bta-mir-99b, hsa-mir-374b, hsa-mir-664a, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-1915, bta-mir-146a, bta-mir-16a, bta-mir-184, bta-mir-24-1, bta-mir-194-2, bta-mir-219-1, bta-mir-223, bta-mir-26a-1, bta-mir-365-2, bta-mir-374b, bta-mir-486, bta-mir-763, bta-mir-9-1, bta-mir-9-2, bta-mir-181a-1, bta-mir-2284i, bta-mir-2284s, bta-mir-2284l, bta-mir-2284j, bta-mir-2284t, bta-mir-2284d, bta-mir-2284n, bta-mir-2284g, bta-mir-2339, bta-mir-2284p, bta-mir-2284u, bta-mir-2284f, bta-mir-2284a, bta-mir-2284k, bta-mir-2284c, bta-mir-2284v, bta-mir-2284q, bta-mir-2284m, bta-mir-2284b, bta-mir-2284r, bta-mir-2284h, bta-mir-2284o, bta-mir-664a, bta-mir-2284e, bta-mir-1388, bta-mir-194-1, bta-mir-193a-2, bta-mir-2284w, bta-mir-2284x, bta-mir-148c, hsa-mir-374c, hsa-mir-219b, hsa-mir-499b, hsa-mir-664b, bta-mir-2284y-1, bta-mir-2284y-2, bta-mir-2284y-3, bta-mir-2284y-4, bta-mir-2284y-5, bta-mir-2284y-6, bta-mir-2284y-7, bta-mir-2284z-1, bta-mir-2284aa-1, bta-mir-2284z-3, bta-mir-2284aa-2, bta-mir-2284aa-3, bta-mir-2284z-4, bta-mir-2284z-5, bta-mir-2284z-6, bta-mir-2284z-7, bta-mir-2284aa-4, bta-mir-2284z-2, hsa-mir-486-2, hsa-mir-6516, bta-mir-2284ab, bta-mir-664b, bta-mir-6516, bta-mir-219-2, bta-mir-2284ac, bta-mir-219b, bta-mir-374c, bta-mir-148d
A recent study using quantitative real time PCR technique revealed differential expression of five inflammation related miRNAs (miR-9, miR-125b, miR-155, miR-146a and miR-223) after stimulation of bovine monocytes with lipopolysaccharide (LPS) and S. aureus enterotoxin B [22]. [score:3]
It was shown that miR-155 promotes the production of TNF-α in human embryonic kidney cells (HEK-293), suggesting the positive role of miR-155 to modulate the release of inflammatory mediators [15]. [score:1]
[1 to 20 of 2 sentences]
27
[+] score: 3
Other miRNAs from this paper: bta-let-7f-2, bta-mir-21, bta-mir-221, bta-mir-222, bta-mir-26b, bta-mir-125a, bta-mir-125b-1, bta-mir-128-1, bta-mir-181a-2, bta-mir-27b, bta-mir-30b, bta-mir-140, bta-mir-15b, bta-mir-92a-2, bta-let-7d, bta-let-7g, bta-mir-30a, bta-let-7a-1, bta-let-7f-1, bta-let-7i, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-125b-2, bta-mir-374a, bta-mir-128-2, bta-mir-146b, bta-mir-152, bta-mir-181d, bta-mir-24-1, bta-mir-223, bta-mir-374b, bta-mir-500, bta-mir-708, bta-mir-92a-1, bta-mir-9-1, bta-mir-9-2, bta-mir-1249, bta-mir-181a-1, bta-mir-2285a, bta-mir-2285d, bta-mir-2285b-1, bta-mir-2285c, bta-mir-2478, bta-mir-2898, bta-mir-2285e-1, bta-mir-2285e-2, bta-mir-2285f-1, bta-mir-2285f-2, bta-mir-2285g-1, bta-mir-2285h, bta-mir-2285i, bta-mir-2285j-1, bta-mir-2285j-2, bta-mir-2285k-1, bta-mir-2285l, bta-mir-2285o-1, bta-mir-2285o-2, bta-mir-2285n-1, bta-mir-2285n-2, bta-mir-2285p, bta-mir-2285m-1, bta-mir-2285m-2, bta-mir-2285n-3, bta-mir-2285n-4, bta-mir-2285o-3, bta-mir-2285o-4, bta-mir-2285m-3, bta-mir-2285m-4, bta-mir-2285o-5, bta-mir-2285m-5, bta-mir-2285n-5, bta-mir-2285n-6, bta-mir-2285n-7, bta-mir-2285k-2, bta-mir-2285k-3, bta-mir-2285k-4, bta-mir-2285k-5, bta-mir-2285q, bta-mir-2285r, bta-mir-2285s, bta-mir-2285t, bta-mir-2285b-2, bta-mir-2285v, bta-mir-2285g-2, bta-mir-2285g-3, bta-mir-2285af-1, bta-mir-2285af-2, bta-mir-2285y, bta-mir-2285w, bta-mir-2285x, bta-mir-2285z, bta-mir-2285u, bta-mir-2285aa, bta-mir-2285ab, bta-mir-2285ac, bta-mir-2285ad, bta-mir-2285ae, bta-mir-2285ag, bta-mir-2285ah, bta-mir-2285ai, bta-mir-2285aj, bta-mir-2285ak, bta-mir-2285al, bta-mir-2285am, bta-mir-2285ar, bta-mir-2285as-1, bta-mir-2285as-2, bta-mir-2285as-3, bta-mir-2285at-1, bta-mir-2285at-2, bta-mir-2285at-3, bta-mir-2285at-4, bta-mir-2285au, bta-mir-2285av, bta-mir-2285aw, bta-mir-2285ax-1, bta-mir-2285ax-2, bta-mir-2285ax-3, bta-mir-2285ay, bta-mir-2285az, bta-mir-2285an, bta-mir-2285ao-1, bta-mir-2285ao-2, bta-mir-2285ap, bta-mir-2285ao-3, bta-mir-2285aq-1, bta-mir-2285aq-2, bta-mir-2285ba-1, bta-mir-2285ba-2, bta-mir-2285bb, bta-mir-2285bc, bta-mir-2285bd, bta-mir-2285be, bta-mir-2285bf-1, bta-mir-2285bf-2, bta-mir-2285bf-3, bta-mir-2285bg, bta-mir-2285bh, bta-mir-2285bi-1, bta-mir-2285bi-2, bta-mir-2285bj-1, bta-mir-2285bj-2, bta-mir-2285bk, bta-mir-2285bl, bta-mir-2285bm, bta-mir-2285bn, bta-mir-2285bo, bta-mir-2285bp, bta-mir-2285bq, bta-mir-2285br, bta-mir-2285bs, bta-mir-2285bt, bta-mir-2285bu-1, bta-mir-2285bu-2, bta-mir-2285bv, bta-mir-2285bw, bta-mir-2285bx, bta-mir-2285by, bta-mir-2285bz, bta-mir-2285ca, bta-mir-2285cb, bta-mir-2285cc, bta-mir-2285cd, bta-mir-2285ce, bta-mir-2285cf, bta-mir-2285cg, bta-mir-2285ch, bta-mir-2285ci, bta-mir-2285cj, bta-mir-2285ck, bta-mir-2285cl, bta-mir-2285cm, bta-mir-2285cn, bta-mir-2285co, bta-mir-2285cp, bta-mir-2285cq, bta-mir-2285cr-1, bta-mir-2285cr-2, bta-mir-2285cs, bta-mir-2285ct, bta-mir-2285cu, bta-mir-2285cv-1, bta-mir-2285cv-2, bta-mir-2285cw-1, bta-mir-2285cw-2, bta-mir-2285cx, bta-mir-2285cy, bta-mir-2285cz, bta-mir-2285da, bta-mir-2285db, bta-mir-2285dc, bta-mir-2285dd, bta-mir-2285de, bta-mir-2285df, bta-mir-2285dg, bta-mir-2285dh, bta-mir-2285di, bta-mir-2285dj, bta-mir-2285dk, bta-mir-2285dl-1, bta-mir-2285dl-2, bta-mir-2285dm
It has been shown that miR-155 and miR-125b are involved in regulation of TNF production during mycobacterial infection [55, 56]. [score:2]
For three of the ST12-unique DE miRNAs (bta-miR-155, bta-miR-125b and bta-miR-223) evidence of induction by bacteria has been previously documented. [score:1]
[1 to 20 of 2 sentences]
28
[+] score: 3
Other miRNAs from this paper: bta-mir-26a-2, bta-mir-29a, bta-let-7f-2, bta-mir-151, bta-mir-21, bta-mir-27a, bta-mir-125b-1, bta-mir-205, bta-mir-27b, bta-mir-193a, bta-mir-98, bta-let-7d, bta-mir-17, bta-mir-200a, bta-mir-200c, bta-mir-210, bta-mir-29b-2, bta-mir-29c, bta-let-7g, bta-mir-200b, bta-let-7a-1, bta-mir-150, bta-let-7f-1, bta-let-7i, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-125b-2, bta-mir-15a, bta-mir-100, bta-mir-130a, bta-mir-146a, bta-mir-184, bta-mir-219-1, bta-mir-223, bta-mir-28, bta-mir-494, bta-mir-708, bta-mir-9-1, bta-mir-9-2, bta-mir-29e, bta-mir-29b-1, bta-mir-2284i, bta-mir-2285a, bta-mir-2284s, bta-mir-2285d, bta-mir-2284l, bta-mir-2284j, bta-mir-2284t, bta-mir-2285b-1, bta-mir-2284d, bta-mir-2284n, bta-mir-2284g, bta-mir-2284p, bta-mir-2284u, bta-mir-2284f, bta-mir-2284a, bta-mir-2284k, bta-mir-2284c, bta-mir-2284v, bta-mir-2285c, bta-mir-2284q, bta-mir-2284m, bta-mir-2284b, bta-mir-2284r, bta-mir-2284h, bta-mir-2284o, bta-mir-664a, bta-mir-2284e, bta-mir-2284w, bta-mir-2284x, bta-mir-3596, bta-mir-652, bta-mir-2284y-1, bta-mir-2285e-1, bta-mir-2285e-2, bta-mir-2285f-1, bta-mir-2285f-2, bta-mir-2285g-1, bta-mir-2285h, bta-mir-2285i, bta-mir-2285j-1, bta-mir-2285j-2, bta-mir-2285k-1, bta-mir-2285l, bta-mir-2285o-1, bta-mir-2285o-2, bta-mir-2285n-1, bta-mir-2285n-2, bta-mir-2285p, bta-mir-2285m-1, bta-mir-2285m-2, bta-mir-2284y-2, bta-mir-2285n-3, bta-mir-2285n-4, bta-mir-2284y-3, bta-mir-2285o-3, bta-mir-2285o-4, bta-mir-2285m-3, bta-mir-2284y-4, bta-mir-2284y-5, bta-mir-2284y-6, bta-mir-2285m-4, bta-mir-2285o-5, bta-mir-2285m-5, bta-mir-2285n-5, bta-mir-2285n-6, bta-mir-2284y-7, bta-mir-2285n-7, bta-mir-2284z-1, bta-mir-2284aa-1, bta-mir-2285k-2, bta-mir-2284z-3, bta-mir-2284aa-2, bta-mir-2284aa-3, bta-mir-2285k-3, bta-mir-2285k-4, bta-mir-2284z-4, bta-mir-2285k-5, bta-mir-2284z-5, bta-mir-2284z-6, bta-mir-2284z-7, bta-mir-2284aa-4, bta-mir-2285q, bta-mir-2285r, bta-mir-2285s, bta-mir-2285t, bta-mir-2285b-2, bta-mir-2285v, bta-mir-2284z-2, bta-mir-2285g-2, bta-mir-2285g-3, bta-mir-2285af-1, bta-mir-2285af-2, bta-mir-2285y, bta-mir-2285w, bta-mir-2285x, bta-mir-2285z, bta-mir-2285u, bta-mir-2285aa, bta-mir-2285ab, bta-mir-2284ab, bta-mir-664b, bta-mir-2285ac, bta-mir-2285ad, bta-mir-2284ac, bta-mir-2285ae, bta-mir-2285ag, bta-mir-2285ah, bta-mir-2285ai, bta-mir-2285aj, bta-mir-2285ak, bta-mir-2285al, bta-mir-2285am, bta-mir-2285ar, bta-mir-2285as-1, bta-mir-2285as-2, bta-mir-2285as-3, bta-mir-2285at-1, bta-mir-2285at-2, bta-mir-2285at-3, bta-mir-2285at-4, bta-mir-2285au, bta-mir-2285av, bta-mir-2285aw, bta-mir-2285ax-1, bta-mir-2285ax-2, bta-mir-2285ax-3, bta-mir-2285ay, bta-mir-2285az, bta-mir-2285an, bta-mir-2285ao-1, bta-mir-2285ao-2, bta-mir-2285ap, bta-mir-2285ao-3, bta-mir-2285aq-1, bta-mir-2285aq-2, bta-mir-2285ba-1, bta-mir-2285ba-2, bta-mir-2285bb, bta-mir-2285bc, bta-mir-2285bd, bta-mir-2285be, bta-mir-2285bf-1, bta-mir-2285bf-2, bta-mir-2285bf-3, bta-mir-2285bg, bta-mir-2285bh, bta-mir-2285bi-1, bta-mir-2285bi-2, bta-mir-2285bj-1, bta-mir-2285bj-2, bta-mir-2285bk, bta-mir-2285bl, bta-mir-2285bm, bta-mir-2285bn, bta-mir-2285bo, bta-mir-2285bp, bta-mir-2285bq, bta-mir-2285br, bta-mir-2285bs, bta-mir-2285bt, bta-mir-2285bu-1, bta-mir-2285bu-2, bta-mir-2285bv, bta-mir-2285bw, bta-mir-2285bx, bta-mir-2285by, bta-mir-2285bz, bta-mir-2285ca, bta-mir-2285cb, bta-mir-2285cc, bta-mir-2285cd, bta-mir-2285ce, bta-mir-2285cf, bta-mir-2285cg, bta-mir-2285ch, bta-mir-2285ci, bta-mir-2285cj, bta-mir-2285ck, bta-mir-2285cl, bta-mir-2285cm, bta-mir-2285cn, bta-mir-2285co, bta-mir-2285cp, bta-mir-2285cq, bta-mir-2285cr-1, bta-mir-2285cr-2, bta-mir-2285cs, bta-mir-2285ct, bta-mir-2285cu, bta-mir-2285cv-1, bta-mir-2285cv-2, bta-mir-2285cw-1, bta-mir-2285cw-2, bta-mir-2285cx, bta-mir-2285cy, bta-mir-2285cz, bta-mir-2285da, bta-mir-2285db, bta-mir-2285dc, bta-mir-2285dd, bta-mir-2285de, bta-mir-2285df, bta-mir-2285dg, bta-mir-2285dh, bta-mir-2285di, bta-mir-2285dj, bta-mir-2285dk, bta-mir-2285dl-1, bta-mir-2285dl-2, bta-mir-2285dm
A recent RT-qPCR study, for example, highlighted the differential expression of five inflammation related miRNAs (miR-9, miR-125b, miR-155, miR-146a and miR-223) in response to E. coli lipopolysaccharide (LPS) and S. aureus enterotoxin B stimulation of bovine monocytes [10]. [score:3]
[1 to 20 of 1 sentences]
29
[+] score: 3
MiR-155 induction by F. novicida but not the virulent F. tularensis results in SHIP down-regulation and enhanced pro-inflammatory cytokine response. [score:3]
[1 to 20 of 1 sentences]
30
[+] score: 3
Increases in expression of miR-155 and miR-132 due to oxidative stress was reported in an ALD (alchololic liver disorder) mouse mo del [26]. [score:3]
[1 to 20 of 1 sentences]
31
[+] score: 3
For instance, miR-885, miR-29b and miR-29c showed a significantly higher expression at D70, D170 and D290 compared with D1 (p < 0.05) after RNA-sequencing and confirmed by qPCR meanwhile miR-193b and miR-155 showed a significantly lower expression at D70, D170 and D290 compared with D1 (p < 0.05) after RNA-sequencing and confirmed by qPCR (Fig. 8). [score:3]
[1 to 20 of 1 sentences]
32
[+] score: 3
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-21, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-99a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-16-2, hsa-mir-192, hsa-mir-148a, hsa-mir-10b, hsa-mir-181a-2, hsa-mir-181a-1, hsa-mir-215, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-mir-15b, hsa-mir-27b, hsa-mir-125b-1, hsa-mir-141, hsa-mir-143, hsa-mir-152, hsa-mir-125b-2, hsa-mir-126, hsa-mir-146a, hsa-mir-184, hsa-mir-200c, hsa-mir-155, hsa-mir-29c, hsa-mir-200a, hsa-mir-99b, hsa-mir-296, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-378a, hsa-mir-342, hsa-mir-148b, hsa-mir-451a, ssc-mir-125b-2, ssc-mir-148a, ssc-mir-15b, ssc-mir-184, ssc-mir-224, ssc-mir-23a, ssc-mir-24-1, ssc-mir-26a, ssc-mir-29b-1, ssc-let-7f-1, ssc-mir-103-1, ssc-mir-21, ssc-mir-29c, hsa-mir-486-1, hsa-mir-499a, hsa-mir-671, hsa-mir-378d-2, bta-mir-26a-2, bta-mir-29a, bta-let-7f-2, bta-mir-103-1, bta-mir-148a, bta-mir-16b, bta-mir-21, bta-mir-499, bta-mir-99a, bta-mir-125b-1, bta-mir-126, bta-mir-181a-2, bta-mir-27b, bta-mir-31, bta-mir-15b, bta-mir-215, bta-mir-30e, bta-mir-148b, bta-mir-192, bta-mir-200a, bta-mir-200c, bta-mir-23a, bta-mir-29b-2, bta-mir-29c, bta-mir-10b, bta-mir-24-2, bta-mir-30a, bta-mir-200b, bta-let-7a-1, bta-mir-342, bta-let-7f-1, bta-let-7a-2, bta-let-7a-3, bta-mir-103-2, bta-mir-125b-2, bta-mir-15a, bta-mir-99b, hsa-mir-664a, ssc-mir-99b, hsa-mir-103b-1, hsa-mir-103b-2, ssc-mir-15a, ssc-mir-16-2, ssc-mir-16-1, bta-mir-141, bta-mir-143, bta-mir-146a, bta-mir-152, bta-mir-16a, bta-mir-184, bta-mir-24-1, bta-mir-223, bta-mir-224, bta-mir-26a-1, bta-mir-296, bta-mir-29d, bta-mir-378-1, bta-mir-451, bta-mir-486, bta-mir-671, bta-mir-29e, bta-mir-29b-1, bta-mir-181a-1, ssc-mir-181a-1, ssc-mir-215, ssc-mir-30a, bta-mir-2318, bta-mir-2339, bta-mir-2430, bta-mir-664a, bta-mir-378-2, ssc-let-7a-1, ssc-mir-378-1, ssc-mir-29a, ssc-mir-30e, ssc-mir-499, ssc-mir-143, ssc-mir-10b, ssc-mir-486-1, ssc-mir-152, ssc-mir-103-2, ssc-mir-181a-2, ssc-mir-27b, ssc-mir-24-2, ssc-mir-99a, ssc-mir-148b, ssc-mir-664, ssc-mir-192, ssc-mir-342, ssc-mir-125b-1, oar-mir-21, oar-mir-29a, oar-mir-125b, oar-mir-181a-1, hsa-mir-378b, hsa-mir-378c, ssc-mir-296, ssc-mir-155, ssc-mir-146a, bta-mir-148c, ssc-mir-126, ssc-mir-378-2, ssc-mir-451, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-451b, hsa-mir-499b, ssc-let-7a-2, ssc-mir-486-2, hsa-mir-664b, hsa-mir-378j, ssc-let-7f-2, ssc-mir-29b-2, ssc-mir-31, ssc-mir-671, bta-mir-378b, bta-mir-378c, hsa-mir-486-2, oar-let-7a, oar-let-7f, oar-mir-103, oar-mir-10b, oar-mir-143, oar-mir-148a, oar-mir-152, oar-mir-16b, oar-mir-181a-2, oar-mir-200a, oar-mir-200b, oar-mir-200c, oar-mir-23a, oar-mir-26a, oar-mir-29b-1, oar-mir-30a, oar-mir-99a, bta-mir-664b, chi-let-7a, chi-let-7f, chi-mir-103, chi-mir-10b, chi-mir-125b, chi-mir-126, chi-mir-141, chi-mir-143, chi-mir-146a, chi-mir-148a, chi-mir-148b, chi-mir-155, chi-mir-15a, chi-mir-15b, chi-mir-16a, chi-mir-16b, chi-mir-184, chi-mir-192, chi-mir-200a, chi-mir-200b, chi-mir-200c, chi-mir-215, chi-mir-21, chi-mir-223, chi-mir-224, chi-mir-2318, chi-mir-23a, chi-mir-24, chi-mir-26a, chi-mir-27b, chi-mir-296, chi-mir-29a, chi-mir-29b, chi-mir-29c, chi-mir-30a, chi-mir-30e, chi-mir-342, chi-mir-378, chi-mir-451, chi-mir-499, chi-mir-671, chi-mir-99a, chi-mir-99b, bta-mir-378d, ssc-mir-378b, oar-mir-29b-2, ssc-mir-141, ssc-mir-200b, ssc-mir-223, bta-mir-148d
A differential expression of four immune related miRNAs, miR-125b, miR-155, miR-146a, and miR-223 upon stimulation of bovine monocytes with LPS or Staphylococcus aureus enterotoxin B was demonstrated (Dilda et al., 2012). [score:3]
[1 to 20 of 1 sentences]
33
[+] score: 2
Inflammation-related miR-155 [38] was detected, but its circulation level did not significantly differ among cattle groups or time points. [score:1]
Although circulation levels of miR-29b, miR-30a, miR-30d, miR-103, miR-126-5p, miR-144, miR-155, miR-425-5p, miR-489, miR-1249, and miR-2888 were also examined, no significant differences in these miRNAs were observed between the cattle groups at any time points or between the time points in either of the cattle groups. [score:1]
[1 to 20 of 2 sentences]
34
[+] score: 2
Highly significantly affected upstream regulators in our data set were v-myc myelocytomatosis viral related oncogene (neuroblastoma derived, MYCN), the T cell receptor complex TCR, the CD40 ligand (CD40LG), CD28, E2F transcription factor 1 (E2F1), interleukin 2 (IL2), transforming growth factor beta 1 (TGFB1), CD3, and microRNAs miR-30c-5p, miR-155-5p and miR-124-3p (Table  2, Additional file 13). [score:2]
[1 to 20 of 1 sentences]
35
[+] score: 2
PLoS Pathogens 6. 17 Zhao YG, Yao YX, Xu HT, Lambeth L, Smith LP, et al (2009) A Functional MicroRNA-155 Ortholog Encoded by the Oncogenic Marek's Disease Virus. [score:2]
[1 to 20 of 1 sentences]
36
[+] score: 2
Immunomodulatory miRNAs including miR-155, miR-146a, and miR-21 have now been proposed as bioactive molecules that elicit the atopy-protective effects of raw milk and colostrum by promoting the maturation of demethylated CD4 [+]CD25 [+]FoxP3 [+] regulatory T cells [15]. [score:2]
[1 to 20 of 1 sentences]
37
[+] score: 1
Other miRNAs from this paper: hsa-mir-17, hsa-mir-28, hsa-mir-223, hsa-mir-127, hsa-mir-188, hsa-mir-194-1, hsa-mir-155, hsa-mir-194-2, hsa-mir-30e, hsa-mir-362, hsa-mir-363, hsa-mir-367, hsa-mir-379, hsa-mir-196b, hsa-mir-450a-1, hsa-mir-431, ssc-mir-28, hsa-mir-493, hsa-mir-512-1, hsa-mir-512-2, hsa-mir-500a, hsa-mir-501, hsa-mir-502, hsa-mir-450a-2, hsa-mir-513a-1, hsa-mir-513a-2, hsa-mir-506, hsa-mir-508, hsa-mir-509-1, hsa-mir-532, hsa-mir-615, hsa-mir-660, bta-mir-127, bta-mir-30e, bta-mir-17, bta-mir-450a-2, bta-mir-532, bta-mir-363, bta-mir-660, hsa-mir-891a, hsa-mir-892a, hsa-mir-509-2, hsa-mir-450b, hsa-mir-892b, hsa-mir-708, hsa-mir-509-3, hsa-mir-1285-1, hsa-mir-1285-2, hsa-mir-1248, ssc-mir-17, bta-mir-188, bta-mir-194-2, bta-mir-196b, bta-mir-223, bta-mir-28, bta-mir-362, bta-mir-367, bta-mir-379, bta-mir-431, bta-mir-493, bta-mir-500, bta-mir-502a-1, bta-mir-502a-2, bta-mir-502b, bta-mir-615, bta-mir-708, bta-mir-1248-1, bta-mir-1248-2, ssc-mir-450a, bta-mir-2320, bta-mir-1388, bta-mir-194-1, bta-mir-450a-1, eca-mir-30e, eca-mir-367, eca-mir-684, eca-mir-196b, eca-mir-615, eca-mir-708, eca-mir-194-1, eca-mir-493a, eca-mir-17, eca-mir-1248, eca-mir-28, eca-mir-127, eca-mir-379, eca-mir-431, eca-mir-493b, eca-mir-155, eca-mir-194-2, eca-mir-188, eca-mir-223, eca-mir-362, eca-mir-363, eca-mir-450a, eca-mir-450b, eca-mir-450c, eca-mir-500-1, eca-mir-500-2, eca-mir-501, eca-mir-502, eca-mir-508, eca-mir-509a, eca-mir-532, eca-mir-660, ssc-mir-30e, ssc-mir-196b-1, ssc-mir-450b, ssc-mir-127, ssc-mir-532, ssc-mir-708, ssc-mir-1285, ssc-mir-500, hsa-mir-514b, ssc-mir-363-1, ssc-mir-450c, hsa-mir-500b, ssc-mir-194b, ssc-mir-155, ssc-mir-362, bta-mir-3601, ssc-mir-615, ssc-mir-2320, bta-mir-450b, ssc-mir-194a, ssc-mir-196b-2, ssc-mir-363-2, ssc-mir-493, hsa-mir-892c, eca-mir-1388, eca-mir-514b, eca-mir-506a, eca-mir-509b, bta-mir-194b, ssc-mir-1388, ssc-mir-223, ssc-mir-660, bta-mir-194b-2, bta-mir-1949
Sometimes these duplicated annotations were found twice on the same chromosome in close proximity (for example mir-196b twice on the same strand, and both mir-615 and mir-194 twice, once on each strand) and sometimes they were found both on the assembled chromosomes and within the unplaced contigs (for example mir-127, mir-155). [score:1]
[1 to 20 of 1 sentences]
38
[+] score: 1
Other miRNAs from this paper: hsa-let-7c, hsa-let-7d, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-20a, hsa-mir-21, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-99a, hsa-mir-148a, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-181a-2, hsa-mir-181a-1, hsa-mir-125b-1, hsa-mir-143, hsa-mir-125b-2, hsa-mir-126, hsa-mir-146a, hsa-mir-155, hsa-mir-106b, hsa-mir-99b, hsa-mir-26a-2, hsa-mir-378a, hsa-mir-151a, hsa-mir-450a-1, hsa-mir-452, hsa-mir-450a-2, hsa-mir-92b, hsa-mir-151b, hsa-mir-378d-2, bta-mir-26a-2, bta-let-7f-2, bta-mir-148a, bta-mir-151, bta-mir-16b, bta-mir-20a, bta-mir-21, bta-mir-26b, bta-mir-99a, bta-mir-125b-1, bta-mir-126, bta-mir-181a-2, bta-mir-92a-2, bta-let-7d, bta-mir-17, bta-mir-450a-2, bta-mir-7-3, bta-let-7f-1, bta-let-7c, bta-mir-125b-2, bta-mir-15a, bta-mir-99b, hsa-mir-450b, bta-mir-106b, bta-mir-143, bta-mir-146a, bta-mir-16a, bta-mir-26a-1, bta-mir-378-1, bta-mir-452, bta-mir-92a-1, bta-mir-92b, bta-mir-7-2, bta-mir-7-1, bta-mir-181a-1, bta-mir-2284i, bta-mir-2285a, bta-mir-2284s, bta-mir-2285d, bta-mir-2284l, bta-mir-2284j, bta-mir-2284t, bta-mir-2285b-1, bta-mir-2284d, bta-mir-2284n, bta-mir-2284g, bta-mir-2284p, bta-mir-2284u, bta-mir-2284f, bta-mir-2284a, bta-mir-2284k, bta-mir-2284c, bta-mir-2284v, bta-mir-2285c, bta-mir-2284q, bta-mir-2284m, bta-mir-2284b, bta-mir-2284r, bta-mir-2284h, bta-mir-2284o, bta-mir-2284e, bta-mir-450a-1, bta-mir-378-2, hsa-mir-378b, bta-mir-2284w, bta-mir-2284x, hsa-mir-378c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, bta-mir-450b, bta-mir-2284y-1, bta-mir-2285e-1, bta-mir-2285e-2, bta-mir-2285f-1, bta-mir-2285f-2, bta-mir-2285g-1, bta-mir-2285h, bta-mir-2285i, bta-mir-2285j-1, bta-mir-2285j-2, bta-mir-2285k-1, bta-mir-2285l, hsa-mir-378j, bta-mir-2285o-1, bta-mir-2285o-2, bta-mir-2285n-1, bta-mir-2285n-2, bta-mir-2285p, bta-mir-2285m-1, bta-mir-2285m-2, bta-mir-2284y-2, bta-mir-378b, bta-mir-2285n-3, bta-mir-2285n-4, bta-mir-2284y-3, bta-mir-2285o-3, bta-mir-2285o-4, bta-mir-2285m-3, bta-mir-378c, bta-mir-2284y-4, bta-mir-2284y-5, bta-mir-2284y-6, bta-mir-2285m-4, bta-mir-2285o-5, bta-mir-2285m-5, bta-mir-2285n-5, bta-mir-2285n-6, bta-mir-2284y-7, bta-mir-2285n-7, bta-mir-2284z-1, bta-mir-2284aa-1, bta-mir-2285k-2, bta-mir-2284z-3, bta-mir-2284aa-2, bta-mir-2284aa-3, bta-mir-2285k-3, bta-mir-2285k-4, bta-mir-2284z-4, bta-mir-2285k-5, bta-mir-2284z-5, bta-mir-2284z-6, bta-mir-2284z-7, bta-mir-2284aa-4, bta-mir-2285q, bta-mir-2285r, bta-mir-2285s, bta-mir-2285t, bta-mir-2285b-2, bta-mir-2285v, bta-mir-2284z-2, bta-mir-2285g-2, bta-mir-2285g-3, bta-mir-2285af-1, bta-mir-2285af-2, bta-mir-2285y, bta-mir-2285w, bta-mir-2285x, bta-mir-2285z, bta-mir-2285u, bta-mir-2285aa, bta-mir-2285ab, bta-mir-2284ab, bta-mir-2285ac, bta-mir-2285ad, bta-mir-2284ac, bta-mir-2285ae, bta-mir-378d, bta-mir-2285ag, bta-mir-2285ah, bta-mir-2285ai, bta-mir-2285aj, bta-mir-2285ak, bta-mir-2285al, bta-mir-2285am, bta-mir-2285ar, bta-mir-2285as-1, bta-mir-2285as-2, bta-mir-2285as-3, bta-mir-2285at-1, bta-mir-2285at-2, bta-mir-2285at-3, bta-mir-2285at-4, bta-mir-2285au, bta-mir-2285av, bta-mir-2285aw, bta-mir-2285ax-1, bta-mir-2285ax-2, bta-mir-2285ax-3, bta-mir-2285ay, bta-mir-2285az, bta-mir-2285an, bta-mir-2285ao-1, bta-mir-2285ao-2, bta-mir-2285ap, bta-mir-2285ao-3, bta-mir-2285aq-1, bta-mir-2285aq-2, bta-mir-2285ba-1, bta-mir-2285ba-2, bta-mir-2285bb, bta-mir-2285bc, bta-mir-2285bd, bta-mir-2285be, bta-mir-2285bf-1, bta-mir-2285bf-2, bta-mir-2285bf-3, bta-mir-2285bg, bta-mir-2285bh, bta-mir-2285bi-1, bta-mir-2285bi-2, bta-mir-2285bj-1, bta-mir-2285bj-2, bta-mir-2285bk, bta-mir-2285bl, bta-mir-2285bm, bta-mir-2285bn, bta-mir-2285bo, bta-mir-2285bp, bta-mir-2285bq, bta-mir-2285br, bta-mir-2285bs, bta-mir-2285bt, bta-mir-2285bu-1, bta-mir-2285bu-2, bta-mir-2285bv, bta-mir-2285bw, bta-mir-2285bx, bta-mir-2285by, bta-mir-2285bz, bta-mir-2285ca, bta-mir-2285cb, bta-mir-2285cc, bta-mir-2285cd, bta-mir-2285ce, bta-mir-2285cf, bta-mir-2285cg, bta-mir-2285ch, bta-mir-2285ci, bta-mir-2285cj, bta-mir-2285ck, bta-mir-2285cl, bta-mir-2285cm, bta-mir-2285cn, bta-mir-2285co, bta-mir-2285cp, bta-mir-2285cq, bta-mir-2285cr-1, bta-mir-2285cr-2, bta-mir-2285cs, bta-mir-2285ct, bta-mir-2285cu, bta-mir-2285cv-1, bta-mir-2285cv-2, bta-mir-2285cw-1, bta-mir-2285cw-2, bta-mir-2285cx, bta-mir-2285cy, bta-mir-2285cz, bta-mir-2285da, bta-mir-2285db, bta-mir-2285dc, bta-mir-2285dd, bta-mir-2285de, bta-mir-2285df, bta-mir-2285dg, bta-mir-2285dh, bta-mir-2285di, bta-mir-2285dj, bta-mir-2285dk, bta-mir-2285dl-1, bta-mir-2285dl-2, bta-mir-2285dm
7 mir-155 14,390 2,101.7 let-7c 14,020 2,047.7 mir-143 12,204 1,782.4 mir-181a-2//mir-181a-1 11,882 1,735.4 mir-146a 10,952 1,599.6 mir-15a 9,938 1,451.5 mir-99b 9,755 1,424.8 mir-148a 9,502 1,387.8 mir-125b-1//mir-125b-2 9,395 1,372.2 mir-106b 9,284 1,356.0 mir-26b 9,146 1,335.8 mir-16b 8,750 1,278.0 let-7d 8,273 1,208.3 mir-16a 8,007 1,169.5 mir-92//mir-92a 7,427 1,084.7 mir-7//mir-7-2//mir-7-1 6,852 1,000.8 Fig. 2IsomiRs and detection of star sequences. [score:1]
[1 to 20 of 1 sentences]
39
[+] score: 1
Second, after transcription, cellular AID mRNA levels are modulated by two microRNAs (miR-155 and miR181b) (77– 79). [score:1]
[1 to 20 of 1 sentences]