sort by

21 publications mentioning bta-mir-196a-2

Open access articles that are associated with the species Bos taurus and mention the gene name mir-196a-2. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 199
In this study we identified a miRNA (miR-196a) targeting bovine NOBOX, examined the temporal expression of miR-196a during bovine early embryonic development and determined the effect and specificity of miR-196a in regulating bovine NOBOX expression both exogenously (HeLa cells) and endogenously in early embryos. [score:9]
Since we determined in heterologous systems that miR-196a is capable of regulating NOBOX expression through direct binding to the 3' UTR of its mRNA, the ability of miR-196a to regulate endogenous NOBOX expression in early embryos was determined. [score:8]
In order to examine if miR-196a expression is inversely correlated to bovine NOBOX expression during early embryonic development, we analyzed miR-196 expression during oocyte maturation and early embryogenesis. [score:8]
Moreover, when the spatio-temporal expression pattern of miR-196a is compared with the expression pattern of bovine NOBOX during early embryogenesis, miR-196a expression increases steadily from two-cell to eight-cell stage of embryogenesis, while NOBOX expression decreases gradually during the same period [29]. [score:8]
A significant inhibition of NOBOX expression was observed in HeLa cells ectopically expressing both NOBOX and miR-196a (Figure 3A) relative to cells transfected with NOBOX alone. [score:7]
Furthermore, miR-196a regulates mammalian development via targeting homoeobox clusters [22] and misexpression of miR-196a leads to specific eye anomalies in a dose -dependent manner in Xenopus laevis [23]. [score:7]
Similarly, the activity of a luciferase construct containing the entire 3' UTR of bovine NOBOX was suppressed, and the regulation was abolished by mutations in the miR-196a binding site indicating that the predicted MRE is critical for the direct and specific binding of miR-196a to the NOBOX mRNA. [score:6]
Collectively, our results demonstrate the ability of miR-196a to negatively regulate NOBOX expression in a sequence specific fashion and the ability of miR-196a to suppress NOBOX mRNA and protein in early embryos. [score:6]
Expression analysis of miR-196a in bovine oocytes and during early embryonic development indicated that it is expressed both in oocytes and embryos and tends to increase at the four-cell and eight-cell stages. [score:6]
Ectopic expression of NOBOX and miR-196a in HeLa cells inhibited the expression of NOBOX protein compared to the control cells without miR-196a. [score:6]
Semi-quantitative analysis of western blot data showed a significant inhibition of NOBOX expression in the miR-196a -transfected cells (Figure 3B). [score:5]
Ectopic expression of miR-196a by transfection of miR-196a duplex into the HeLa cells suppressed activity of a chimeric luciferase construct containing the miR-196a MRE of NOBOX at its 3' end (Figure 4B). [score:5]
miR-196a specifically suppresses the expression of bovine NOBOX. [score:5]
The involvement of miR-196a in regulating the expression of NOBOX supports a new role of this miRNA in early embryonic development during MET. [score:5]
Furthermore, ectopic expression of miR-196a mimic in bovine early embryos significantly reduced the NOBOX expression at the both mRNA and protein levels. [score:5]
Figure 3Regulation of bovine NOBOX expression by miR-196a in vitro in HeLa cells. [score:4]
In addition, when the NOBOX sequence was analyzed with other miRNA target prediction algorithms, miR-196a always was listed as a top candidate miRNA, further indicating that miRNA-196a might be a potential post-transcriptional regulator of NOBOX in early embryos. [score:4]
Recent studies showed that 75% of tumors express high levels of miR-196a and miR-196a is involved in regulating key pathways such as AKT signaling, p53 and WNT signaling pathways [49, 50]. [score:4]
It has also been reported that miR-196a is differently regulated during polycystic kidney disease suggesting that miR-196 is important for normal functioning of kidney [51]. [score:4]
Thus, the inverse relationship between miR-196a and NOBOX expression/activity supports the proposed role of miR-196a as a physiological regulator of NOBOX during early embryogenesis. [score:4]
Figure 4 miR-196a specifically binds to the 3' UTR of bovine NOBOX and regulates its expression. [score:4]
Ectopic expression of miR-196a mimic in bovine embryos effectively reduced NOBOX protein expression in eight-cell embryos compared to uninjected and the negative control miRNA -injected embryos (Figure 5A). [score:4]
Thus, a similar mechanism is likely to be involved in the miR-196a negative regulation of NOBOX expression in bovine embryos during MET. [score:4]
Moreover, recent studies support a functional role for this specific miRNA as miR-196a targets specific homeobox genes (HoxB8, HoxC8, HoxD8 and HoxA7) in mouse embryos and mammalian cells and plays a major role in animal development [22]. [score:4]
Mutation of the mir-196a miRNA recognition element (MRE) in the NOBOX 3' UTR was performed using the QuickChange site-directed mutagenesis kit (Stratagene, Santaclara, CA) according to the manufacturer's instructions. [score:3]
These results unequivocally show that bovine NOBOX is regulated at the post-transcriptional level by miR-196a and further supports the hypothesis that miR-196a is responsible for the negative regulation of NOBOX. [score:3]
Expression analysis indicates that bovine miR-196a is increased in four-cell and eight-cell stage embryos relative to germinal vesicle stage oocytes and declines at morula and blastocyst stages (Figure 2B). [score:3]
The increased expression level of miR-196a near the eight-cell stage of embryogenesis potentially indicates miR-196a involvement in maternal transcript degradation during the maternal-to-zygotic transition, as was observed for miR-430 in zebrafish [10] miR-427 in Xenopus [38] and miR-290 in mouse [20]. [score:3]
Figure 2 Spatial and temporal expression profile of miR-196a. [score:3]
As shown in Figure 2A, miR-196a is expressed predominantly in kidney; it is also detected significantly in fetal and adult ovary, brain and hypothalamus. [score:3]
miR-196a is spatio-temporally regulated during development. [score:3]
A similar expression pattern was observed in mice where miR-196a is enriched in the kidney and adult reproductive tissues [37]. [score:3]
The relative amount of miR-196a was expressed as relative fold change using the sample with the lowest value as the calibrator (n = 4, mean ± SEM). [score:3]
Nucleotides changed to generate the target site mutant 3' UTR are underlined (B) Repression of luciferase activity due to specific interaction between miR-196a and the predicted MRE in the luciferase-NOBOX-3' UTR constructs. [score:3]
Figure 5 Microinjection of miR-196a mimic represses endogenous NOBOX expression in bovine early embryos. [score:3]
Quantity of miRNA-196a was normalized to abundance of RPS18 mRNA and abundance expressed as relative fold change using the sample with the lowest value as the calibrator (n = 4 per tissue; mean ± SEM depicted). [score:3]
To determine the tissue specific expression pattern of miR-196a, quantitative real-time PCR was performed. [score:3]
Mature miRNA-196a mimic (MIMAT0000226) and negative control cel-miR-67 (CN-001000-01-05) were obtained from Dharmacon Technologies (Dharmacon Inc, Lafayette, CO), and diluted with RNase free water to a final concentration of 10 μM and 20 μM before microinjection (The final concentration used for microinjection was 20 μM based on initial experiments showing this concentration is more effective in repressing Nobox expression). [score:3]
The efficiency of NOBOX mRNA/protein knockdown in miRNA-196a mimic injected and control embryos was determined by quantitative real-time PCR analysis and immunocytochemistry in eight-cell stage embryos as described previously [30]. [score:2]
Collectively, our results demonstrate that miR-196a is a bona fide negative regulator of NOBOX during bovine early embryogenesis. [score:2]
Luciferase activity was restored when a four-base mismatch mutation was introduced into the seed region of the miRNA-196a recognition sequence in the NOBOX 3' UTR (Figure 4B). [score:2]
Mutations in the predicted MRE in the 3' UTR of the NOBOX for miR-196a were created such that interaction between miR-196a and NOBOX is compromised (Figure 4A). [score:2]
These data indicate the predicted MRE is critical for the direct and specific binding of miR-196a to NOBOX transcript. [score:2]
Future studies of interest will investigate whether loss of miR-196a has any effect on the early embryonic development and identify putative miR-196a targets by next generation sequencing analysis of miR-196a depleted and wild type embryos. [score:2]
To confirm the binding of miR-196a to bovine NOBOX in vitro, HeLa cell transfection studies were conducted. [score:1]
miR-196a is an evolutionary conserved miRNA that has been identified in a wide range of vertebrate species. [score:1]
RNA secondary structure prediction analysis using Mfold [34] revealed that the apparent miR-196a binding site was positioned on a hairpin-loop structure, in an exposed position, which might facilitate miRNA accessibility. [score:1]
Figure 1 Prediction of a miR-196a binding site in the 3' UTR of bovine NOBOX mRNA. [score:1]
miR-196a binds to the 3' UTR of bovine NOBOX. [score:1]
miR-196a was chosen for further studies, because the predicted MRE in the bovine NOBOX 3' UTR had a low predicted free energy of hybridization with the cognate miRNA (-19.8 kcal/mol), suggesting a stable miRNA: mRNA duplex within the 9 nucleotide (nt) seed region at the 5' end of the miRNA (Figure 1). [score:1]
Repression of luciferase reporter gene activity by miR-196a was abolished when the MRE was mutated. [score:1]
The predicted miR-196a binding site is underlined. [score:1]
miR-196a represses endogenous NOBOX in bovine early embryos. [score:1]
Microinjection of miR-196a mimic in bovine embryos significantly reduced NOBOX mRNA levels in eight-cell embryos by more than 80% relative to uninjected and negative control miRNA -injected embryos (Figure 5B). [score:1]
Using an algorithm "MicroInspector", a potential microRNA recognition element (MRE) for miR-196a was identified in the 3' UTR of the bovine NOBOX mRNA. [score:1]
The lack of conservation of miR-196a recognition sequence in bovine NOBOX might be due to the rapid drifting of 3' UTR during evolution [31, 35]. [score:1]
Furthermore, luciferase reporter assays were performed to validate specificity of the miR-196a regulation of NOBOX through the predicted miR-196a recognition sequence in the 3' UTR of NOBOX. [score:1]
[1 to 20 of 57 sentences]
2
[+] score: 22
Investigations using the bovine fetus will also be important to further define what factors regulate miR-196 expression since GALT development is initiated during the second trimester of fetal development in the absence of the microbiome. [score:4]
Thus it may not be surprising to observe high and regional-specific expression of miR-196 in the ileum during early life. [score:3]
The expression of some miRNAs such as miR-29, miR-196 and miR-15/16 families were significantly correlated with the number of Bifidobacterium and Lactobacillus spp. [score:3]
Further studies are required to determine if miR-196 expression is associated with GALT, such as PPs and mesenteric lymph nodes. [score:3]
MiR-196 family was only detected in the ileum (Figure 5), and its expression varied over time (Table S2). [score:2]
The miR-196 family was only detected in ileum, while miR-31 had lower expression in the ileum compared to the mid-jejunum and rumen (Figure 5). [score:2]
A total of 13 regional and temporal DE miRNAs (regional DE miRNAs: miR-192, miR-194, miR-205, miR-31, and miR-196; temporal DE miRNAs: miR-146b, miR-191, miR-99a, miR-145, miR-211, miR-486, miR-33, miR-7, and miR-196b) that identified from miRNA-seq were selected for validation using stem-loop qRT-PCR. [score:1]
The main function of the miR-29 family is related to dendritic cells (DCs) maturation, the miR-196 family is involved in lymphangiogenesis, and the miR-15/16 family is involved in leukocytes differentiation. [score:1]
on D21; r = −0.87, P = 0.01), the miR-196 family (positively correlated with the population of both Bifidobacterium and Lactobacillus spp. [score:1]
In addition, the temporally DE miRNA-196 was only detected in ileum (Table 1), and was significantly correlated with bacterial density (data not shown). [score:1]
For example, miR-196 induces the cleavage of homeobox mRNA in hematopoietic stem cells (HSCs) and modulates HSC homeostasis [17], [18]. [score:1]
[1 to 20 of 11 sentences]
3
[+] score: 21
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-mir-21, hsa-mir-26a-1, hsa-mir-27a, hsa-mir-28, hsa-mir-30a, hsa-mir-96, hsa-mir-98, hsa-mir-99a, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-196a-1, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-30d, hsa-mir-34a, hsa-mir-196a-2, hsa-mir-199a-2, hsa-mir-23b, hsa-mir-27b, hsa-mir-125b-1, hsa-mir-143, hsa-mir-145, hsa-mir-152, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-194-1, hsa-mir-194-2, hsa-mir-200a, hsa-mir-99b, hsa-mir-26a-2, hsa-mir-378a, hsa-mir-342, hsa-mir-148b, hsa-mir-338, hsa-mir-335, hsa-mir-196b, hsa-mir-484, hsa-mir-486-1, hsa-mir-1271, hsa-mir-378d-2, bta-mir-26a-2, bta-mir-103-1, bta-mir-148a, bta-mir-21, bta-mir-27a, bta-mir-30d, bta-mir-484, bta-mir-99a, bta-mir-125a, bta-mir-125b-1, bta-mir-145, bta-mir-199a-1, bta-mir-27b, bta-mir-98, bta-mir-148b, bta-mir-200a, bta-mir-30a, bta-let-7a-1, bta-mir-342, bta-mir-23b, bta-let-7a-2, bta-let-7a-3, bta-mir-103-2, bta-mir-125b-2, bta-mir-34a, bta-mir-99b, hsa-mir-885, hsa-mir-103b-1, hsa-mir-103b-2, bta-mir-143, bta-mir-152, bta-mir-16a, bta-mir-194-2, bta-mir-196a-1, bta-mir-196b, bta-mir-199a-2, bta-mir-26a-1, bta-mir-28, bta-mir-335, bta-mir-338, bta-mir-378-1, bta-mir-486, bta-mir-885, bta-mir-96, bta-mir-1271, bta-mir-2299, bta-mir-199c, bta-mir-1388, bta-mir-194-1, bta-mir-378-2, hsa-mir-378b, bta-mir-3431, hsa-mir-378c, hsa-mir-4286, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, bta-mir-4286-1, bta-mir-4286-2, hsa-mir-378j, bta-mir-378b, bta-mir-378c, hsa-mir-486-2, bta-mir-378d, bta-mir-194b, bta-mir-194b-2
Our analysis indicates that, about 3594 genes could be targeted by the eleven up-regulated miRNAs (bta-199a-3p, miR-98, miR-378, miR-21-5p, miR-148b, miR-4286, miR-885, miR-196a, miR-23b-3p, bta-miR-199c and miR-3431) whereas 1163 genes could be targeted by the three down-regulated miRNAs (bta-miR-335, miR-200a and bta-miR-2299-5p) in linseed oil -treated cows. [score:11]
Out of this number, 11 were up-regulated (bta-miR-4286, miR-885, miR-199c, miR-199a-3p, miR-3431, miR-98, miR-196a, miR-378, miR-23b-3p, miR-148b and miR-21-5p) while only 3 were down-regulated (miR-200a, miR-335 and miR-2299-5p) (Table  2). [score:7]
miR-196 has a higher expression in visceral than subcutaneous fat in beef cattle, showing tissue specificity, which could be associated with adipogenesis [29]. [score:3]
[1 to 20 of 3 sentences]
4
[+] score: 18
In this study, we found miRNAs influenced mainly by adipose depot location, such as miR-196a, which was highly expressed in visceral fat while miR-2454 was highly expressed in subcutaneous fat. [score:5]
MiR-2454 expression was higher in subcutaneous fat compared to visceral fat (32.20 fold in Control and 2.67 fold in high fat) whereas, conversely, miR-196a had a higher expression in visceral than subcutaneous fat (43.06 fold in Control and 17.25 fold in High fat). [score:4]
The amount of potential gene targets varied among miRNAs with a high of seven predicted genes for miR-101 and miR-2368* and a low of one predicted gene for miRNA-196a. [score:3]
Further qRT-PCR analysis confirmed that the expression of some miRNAs was highly influenced by diet (miR-19a, -92a, -92b, -101, -103, -106, -142–5p, and 296) or fat depot (miR-196a and -2454). [score:3]
Six miRNAs (miR-16b, miR-19a, miR-106, miR142–5 p, miR-196a and miR-2454) had the expression in agreement between qRT-PCR and microarray, however the other six (miR92a, miR-92b, miR-101, miR-103, miR-296 and miR-2368*) had divergent results. [score:3]
[1 to 20 of 5 sentences]
5
[+] score: 17
And antiviral interferon response could induce the expression of miR-196, which then inhibited the gene expression and replication of hepatitis C virus [47, 48]. [score:7]
Together with LPS-stimulated MAPK pathway that is the most enriched for up-regulated miRNAs in sera, our results suggest that sera uniquely expressed miRNAs (such as miR-196) may play important roles in regulating inflammation and immune response in cattle. [score:7]
For example, miR-196, which was uniquely expressed in sera, has recently been reported to be involved in the antiviral immunity in human [46]. [score:3]
[1 to 20 of 3 sentences]
6
[+] score: 15
The expression of miR-223, miR-184, miR-132, miR-1246 and miR-130b were up-regulated while miR-196a, miR-205, miR-200b, miR-31 and miR-145 were down-regulated, which was in agreement with the high-throughput sequencing results (Figure 4). [score:9]
miRNA Target Genes miR-1246 ATP2B4, MAP3K1, ADCK3, PSD2, SLC5A1 miR-130b EXOC3L1, TIE1, BAZ2B, C3, GRAMD1C miR-145 HSD3B7, SLCO4A1, PDIA4, ACADL, PTPN11, KRT9, RASSF6, RNF43, LAMC2 miR-196a ADAP1, GPR97, POMT1 miR-200b ARID3A, MLXIP, GPR110 miR-205 IL13RA2, COL5A2, ADM, CXCR2, XPO6, SPSB1, FMO5, PSMF1 miR-31 MEX3D, PFKFB3, ST3GAL3, IL2RB, ANKRD32, MGST1 miR-184 HSPA1L, SLC25A15, HEG1, MAPRE2, ACP6, SYNE2 miR-223 TMEM165 miR-132 IQCA1 Figure 5 Gene ontology statistics. [score:3]
miRNA Target Genes miR-1246 ATP2B4, MAP3K1, ADCK3, PSD2, SLC5A1 miR-130b EXOC3L1, TIE1, BAZ2B, C3, GRAMD1C miR-145 HSD3B7, SLCO4A1, PDIA4, ACADL, PTPN11, KRT9, RASSF6, RNF43, LAMC2 miR-196a ADAP1, GPR97, POMT1 miR-200b ARID3A, MLXIP, GPR110 miR-205 IL13RA2, COL5A2, ADM, CXCR2, XPO6, SPSB1, FMO5, PSMF1 miR-31 MEX3D, PFKFB3, ST3GAL3, IL2RB, ANKRD32, MGST1 miR-184 HSPA1L, SLC25A15, HEG1, MAPRE2, ACP6, SYNE2 miR-223 TMEM165 miR-132 IQCA1 Figure 5 Gene ontology statistics. [score:3]
[1 to 20 of 3 sentences]
7
[+] score: 12
confirmed the down-regulation of 8 miRNAs (novel-miR-51, novel-miR-99, miR-30d, miR-574, miR-222, miR-196a, miR-3613a, and miR-27a-5p) and the up-regulation of 4 miRNAs (novel-miR-75, miR-1246, miR-2478, and miR-2904) in infected MDBK cells compared with the uninfected (Figure 4A). [score:6]
Primer Sequence (5′-3′) bta-miR-30d TGTAAACATCCCCGACTGGAAGCT bta-miR-574 TGAGTGTGTGTGTGTGAGTGTGTG bta-miR-222 GAGCTACATCTGGCTACTGGGT bta-miR-196a GGCTAGGTAGTTTCATGTTGTTGGG bta-miR-3613a GCGGCTGTTGTACTTTTTTTTTTGTTC bta-miR-1246 GGCAATGGATTTTTGGAGCAGG bta-miR-2478 GCCGTATCCCACTTCTGACACCA bta-miR-2904 GGGAGCCTCGGTTGGCCT bta-miR-27a-5p GGCTTCACAGTGGCTAAGTTCCG novel-miR-51 TAATACTGCCTGGTAATGATGAC novel-miR-99 TTGGGAAGCACAGACACTAGGACT novel-miR-75 TCAAAGACTCGGACGTGACTGA 5S rRNA-F GTCTACGGCCATACCACCCT Table 2 Primers used to detect target genes expression with RT-qPCR. [score:3]
Primer Sequence (5′-3′) bta-miR-30d TGTAAACATCCCCGACTGGAAGCT bta-miR-574 TGAGTGTGTGTGTGTGAGTGTGTG bta-miR-222 GAGCTACATCTGGCTACTGGGT bta-miR-196a GGCTAGGTAGTTTCATGTTGTTGGG bta-miR-3613a GCGGCTGTTGTACTTTTTTTTTTGTTC bta-miR-1246 GGCAATGGATTTTTGGAGCAGG bta-miR-2478 GCCGTATCCCACTTCTGACACCA bta-miR-2904 GGGAGCCTCGGTTGGCCT bta-miR-27a-5p GGCTTCACAGTGGCTAAGTTCCG novel-miR-51 TAATACTGCCTGGTAATGATGAC novel-miR-99 TTGGGAAGCACAGACACTAGGACT novel-miR-75 TCAAAGACTCGGACGTGACTGA 5S rRNA-F GTCTACGGCCATACCACCCT Table 2 Primers used to detect target genes expression with RT-qPCR. [score:3]
[1 to 20 of 3 sentences]
8
[+] score: 11
MicroRNA-196a regulates bovine newborn ovary homeobox gene (NOBOX) expression during early embryogenesis. [score:3]
In bovine, miR-196a is believed to regulate newborn ovary homeobox gene (NOBOX), a transcription factor, implicated in the early bovine embryo development (Tripurani et al., 2011). [score:3]
Evidence across species suggests that the miR-196 plays a key role in regulating HOX genes which encode transcription factors vital to embryonic development (Chen et al., 2011). [score:3]
HOX genes have complementary binding sites to miR-196a2, where it was shown that miR-196 binds with high complementarity to HOXB8 to cleave the mRNA (Yekta et al., 2004). [score:1]
MicroRNA-196: critical roles and clinical applications in development and cancer. [score:1]
[1 to 20 of 5 sentences]
9
[+] score: 8
When cows were fed AL diet, expression of three ruminal miRNAs including miR-125-5p, -130a, -2376, three duodenal miRNAs including miR-2483-5p, -2286l, -2336, two hepatic miRNAs including miR-199a-3p, -2399-5p and fourteen mammary gland miRNAs such as miR-196a, -205 was positively correlated with feed (R ranged from 0.81 ~ 0.99, P < 0.05) and N efficiency (R ranged from 0.81 ~ 0.98, P < 0.05), whereas the expression ruminal miR-1296, duodenal miR-6123, two jejunal miRNAs including miR-30b-3p, -652, five hepatic miRNAs including miR-1, -2285e, -421, -455-3p, -671, and mammary gland miR-99b was negatively correlated with feed (R ranged from −0.82 ~ −0.94, P < 0.05) and N efficiency (R ranged from −0.84 ~ −0.92, P < 0.05) (Table S6). [score:5]
Our study revealed that systematic phosphorylation (duodenal miR-1296, jejunal miR-30b-3p, hepatic miR-199a-3p and mammary miR-196 (data not shown)) and transport of AAs (ruminal miR-130a, duodenal miR-1296, jejunal miR-30b-3p and mammary miR-196 (data not shown)) may be conducted by mediated-miRNAs, suggesting that miRNA -mediated mechanisms regulated N efficiency by regulating AAs transport and phosphorylation throughout all these five tissues. [score:3]
[1 to 20 of 2 sentences]
10
[+] score: 8
Based on this hypothesis, including presumptive declines in the expression of miR-196a, miR-885, PPARG2, SCD1, and ELOVL6 by grazing, the significance of the differences in the t-test results for those targets was analyzed at one side. [score:5]
Notably, we have demonstrated that miR-196a/b and miR-885 in cattle are expressed exclusively in fast-glycolytic semitendinosus (ST) muscle but not in slow-oxidative masseter muscle [4]. [score:3]
[1 to 20 of 2 sentences]
11
[+] score: 7
14/26s highly expressed in the HM fraction (let-7d-5p, miR-103a-3p, miR-142-3p, miR-17-5p, miR-18a-5p, miR-196a-5p, miR-20a-5p, miR-24-1-5p, miR-26a-5p, miR-301a-3p, miR-30b-5p, miR-34b-5p, miR-34c-5p, miR-378a-3p) and 7/14s highly expressed in the LM fraction (miR-10b-5p, miR-122-5p, miR-1-3p, miR-184, miR-486-5p, miR-7-5p, miR-99b-5p) were predicted to target 327 and 281 experimentally observed genes, respectively. [score:7]
[1 to 20 of 1 sentences]
12
[+] score: 6
Other miRNAs from this paper: mmu-mir-1a-1, mmu-mir-127, mmu-mir-134, mmu-mir-136, mmu-mir-154, mmu-mir-181a-2, mmu-mir-143, mmu-mir-196a-1, mmu-mir-196a-2, mmu-mir-21a, rno-mir-329, mmu-mir-329, mmu-mir-1a-2, mmu-mir-181a-1, mmu-mir-181b-1, mmu-mir-181c, mmu-mir-375, mmu-mir-379, mmu-mir-181b-2, rno-mir-21, rno-mir-127, rno-mir-134, rno-mir-136, rno-mir-143, rno-mir-154, rno-mir-181c, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-196a, rno-mir-181a-1, mmu-mir-196b, rno-mir-196b-1, mmu-mir-412, mmu-mir-370, oar-mir-431, oar-mir-127, oar-mir-432, oar-mir-136, mmu-mir-431, mmu-mir-433, rno-mir-431, rno-mir-433, ssc-mir-181b-2, ssc-mir-181c, ssc-mir-136, ssc-mir-196a-2, ssc-mir-21, rno-mir-370, rno-mir-412, rno-mir-1, mmu-mir-485, mmu-mir-541, rno-mir-541, rno-mir-493, rno-mir-379, rno-mir-485, mmu-mir-668, bta-mir-21, bta-mir-181a-2, bta-mir-127, bta-mir-181b-2, bta-mir-181c, mmu-mir-181d, mmu-mir-493, rno-mir-181d, rno-mir-196c, rno-mir-375, mmu-mir-1b, bta-mir-1-2, bta-mir-1-1, bta-mir-134, bta-mir-136, bta-mir-143, bta-mir-154a, bta-mir-181d, bta-mir-196a-1, bta-mir-196b, bta-mir-329a, bta-mir-329b, bta-mir-370, bta-mir-375, bta-mir-379, bta-mir-412, bta-mir-431, bta-mir-432, bta-mir-433, bta-mir-485, bta-mir-493, bta-mir-541, bta-mir-181a-1, bta-mir-181b-1, ssc-mir-1, ssc-mir-181a-1, mmu-mir-432, rno-mir-668, ssc-mir-143, ssc-mir-181a-2, ssc-mir-181b-1, ssc-mir-181d, ssc-mir-196b-1, ssc-mir-127, ssc-mir-432, oar-mir-21, oar-mir-181a-1, oar-mir-493, oar-mir-433, oar-mir-370, oar-mir-379, oar-mir-329b, oar-mir-329a, oar-mir-134, oar-mir-668, oar-mir-485, oar-mir-154a, oar-mir-154b, oar-mir-541, oar-mir-412, mmu-mir-21b, mmu-mir-21c, ssc-mir-196a-1, ssc-mir-196b-2, ssc-mir-370, ssc-mir-493, bta-mir-154c, bta-mir-154b, oar-mir-143, oar-mir-181a-2, chi-mir-1, chi-mir-127, chi-mir-134, chi-mir-136, chi-mir-143, chi-mir-154a, chi-mir-154b, chi-mir-181b, chi-mir-181c, chi-mir-181d, chi-mir-196a, chi-mir-196b, chi-mir-21, chi-mir-329a, chi-mir-329b, chi-mir-379, chi-mir-412, chi-mir-432, chi-mir-433, chi-mir-485, chi-mir-493, rno-mir-196b-2, bta-mir-668, ssc-mir-375
For example, miR-273 and the lys-6 miRNA have been shown to be involved in the development of the nervous system in nematode worm [3]; miR-430 was reported to regulate the brain development of zebrafish [4]; miR-181 controlled the differentiation of mammalian blood cell to B cells [5]; miR-375 regulated mammalian islet cell growth and insulin secretion [6]; miR-143 played a role in adipocyte differentiation [7]; miR-196 was found to be involved in the formation of mammalian limbs [8]; and miR-1 was implicated in cardiac development [9]. [score:6]
[1 to 20 of 1 sentences]
13
[+] score: 3
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-21, hsa-mir-23a, hsa-mir-30a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-196a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-196a-2, hsa-mir-210, hsa-mir-181a-1, hsa-mir-218-1, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-30b, hsa-mir-128-1, hsa-mir-145, hsa-mir-191, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-30c-1, hsa-mir-99b, hsa-mir-296, hsa-mir-30e, hsa-mir-361, hsa-mir-337, hsa-mir-148b, hsa-mir-196b, hsa-mir-425, hsa-mir-20b, hsa-mir-486-1, hsa-mir-488, hsa-mir-181d, hsa-mir-498, hsa-mir-519c, hsa-mir-520a, hsa-mir-526b, hsa-mir-520d, hsa-mir-506, hsa-mir-92b, hsa-mir-608, hsa-mir-617, hsa-mir-625, hsa-mir-641, hsa-mir-1264, hsa-mir-1271, bta-let-7f-2, bta-mir-103-1, bta-mir-148a, bta-mir-21, bta-mir-30d, bta-mir-128-1, bta-mir-145, bta-mir-181a-2, bta-mir-30b, bta-mir-181b-2, bta-mir-20b, bta-mir-30e, bta-mir-92a-2, bta-let-7d, bta-mir-148b, bta-mir-181c, bta-mir-191, bta-mir-210, bta-mir-23a, bta-mir-361, bta-mir-425, bta-let-7g, bta-mir-30a, bta-let-7a-1, bta-let-7f-1, bta-mir-30c, bta-let-7i, bta-mir-23b, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-99b, hsa-mir-890, hsa-mir-888, hsa-mir-889, hsa-mir-938, hsa-mir-1184-1, hsa-mir-1203, hsa-mir-1204, hsa-mir-1265, hsa-mir-103b-1, hsa-mir-103b-2, bta-mir-128-2, bta-mir-181d, bta-mir-196a-1, bta-mir-196b, bta-mir-218-1, bta-mir-296, bta-mir-30f, bta-mir-486, bta-mir-488, bta-mir-92a-1, bta-mir-92b, bta-mir-1271, bta-mir-181a-1, bta-mir-181b-1, bta-mir-148c, hsa-mir-1184-2, hsa-mir-1184-3, hsa-mir-486-2, bta-mir-1264, bta-mir-148d
Interestingly, the expression level of certain miRNA families namely, the let 7 family (let-7a, let-7c, let-7d, let-7d*, let-7e, let-7f, let-7i), miR-181 family (miR-181a, miR-181b), miR-30 family (miR-30b*, miR-30c-2*, miR-30e ), miR-425 family (miR-425, miR-425*), miR-92 family (miR-92a, miR-92a-1*, miR-92b) and miR-196 family (miR-196a, and miR-196b) were repressed in SE animal group. [score:3]
[1 to 20 of 1 sentences]
14
[+] score: 2
Recently we demonstrated that miR-196a and miR-181a function as negative regulators for two key oocyte-specific maternal effect genes (NOBOX and NPM2) essential for early embryogenesis [33] [29]. [score:2]
[1 to 20 of 1 sentences]
15
[+] score: 2
In the present study, we found that the expression levels of miR-142-3p, miR-379 and miR-196a were higher in the adipose tissue of Wagyu cattle compared with Holstein (Table 2). [score:2]
[1 to 20 of 1 sentences]
16
[+] score: 1
Other miRNAs from this paper: mmu-let-7g, mmu-let-7i, mmu-mir-23b, mmu-mir-29b-1, mmu-mir-30b, mmu-mir-99a, mmu-mir-126a, mmu-mir-132, mmu-mir-141, mmu-mir-181a-2, mmu-mir-185, mmu-mir-193a, mmu-mir-199a-1, mmu-mir-200b, mmu-mir-34c, mmu-let-7d, mmu-mir-196a-1, mmu-mir-196a-2, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-20a, mmu-mir-22, mmu-mir-23a, mmu-mir-26a-1, mmu-mir-26b, mmu-mir-34a, mmu-mir-200c, mmu-mir-212, mmu-mir-181a-1, mmu-mir-26a-2, mmu-mir-29b-2, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-378a, mmu-mir-451a, mmu-mir-674, mmu-mir-423, mmu-mir-146b, bta-mir-26a-2, bta-let-7f-2, bta-mir-16b, bta-mir-20a, bta-mir-26b, bta-mir-99a, bta-mir-126, bta-mir-181a-2, bta-mir-199a-1, bta-mir-30b, bta-mir-193a, bta-let-7d, bta-mir-132, bta-mir-199b, bta-mir-200a, bta-mir-200c, bta-mir-22, bta-mir-23a, bta-mir-29b-2, bta-mir-423, bta-let-7g, bta-mir-200b, bta-let-7a-1, bta-let-7f-1, bta-let-7i, bta-mir-23b, bta-mir-34c, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-34a, bta-mir-141, bta-mir-146b, bta-mir-16a, bta-mir-185, bta-mir-196a-1, bta-mir-199a-2, bta-mir-212, bta-mir-26a-1, bta-mir-29b-1, bta-mir-181a-1, bta-mir-2284i, bta-mir-2284s, bta-mir-2284l, bta-mir-2284j, bta-mir-2284t, bta-mir-2284d, bta-mir-2284n, bta-mir-2284g, bta-mir-2284p, bta-mir-2284u, bta-mir-2284f, bta-mir-2284a, bta-mir-2284k, bta-mir-2284c, bta-mir-2284v, bta-mir-2284q, bta-mir-2284m, bta-mir-2284b, bta-mir-2284r, bta-mir-2284h, bta-mir-2284o, bta-mir-2284e, bta-mir-2284w, bta-mir-2284x, bta-mir-2284y-1, mmu-let-7j, bta-mir-2284y-2, bta-mir-2284y-3, bta-mir-2284y-4, bta-mir-2284y-5, bta-mir-2284y-6, bta-mir-2284y-7, bta-mir-2284z-1, bta-mir-2284aa-1, bta-mir-2284z-3, bta-mir-2284aa-2, bta-mir-2284aa-3, bta-mir-2284z-4, bta-mir-2284z-5, bta-mir-2284z-6, bta-mir-2284z-7, bta-mir-2284aa-4, bta-mir-2285t, bta-mir-2284z-2, mmu-let-7k, mmu-mir-126b, bta-mir-2284ab, bta-mir-2284ac
Sixty miRNA were significantly less loaded (or depleted) in AGO2-RISC (p-value<0.05), including seven that were loaded at less than 10% (miR-674-5p, miR-34c-5p, miR-196a-5p, let-7j-5p, miR-34a-5p, let-7d-5p and miR-185-5p). [score:1]
[1 to 20 of 1 sentences]
17
[+] score: 1
Other miRNAs from this paper: bta-mir-26a-2, bta-mir-29a, bta-let-7f-2, bta-mir-16b, bta-mir-21, bta-mir-221, bta-mir-222, bta-mir-30d, bta-mir-99a, bta-mir-145, bta-mir-181a-2, bta-mir-199a-1, bta-mir-27b, bta-mir-142, bta-mir-181b-2, bta-mir-30e, bta-mir-92a-2, bta-let-7d, bta-mir-132, bta-mir-181c, bta-mir-191, bta-mir-199b, bta-mir-214, bta-mir-29b-2, bta-mir-29c, bta-mir-455, bta-let-7g, bta-mir-10b, bta-mir-24-2, bta-let-7a-1, bta-mir-150, bta-let-7f-1, bta-mir-122, bta-let-7i, bta-mir-34c, bta-mir-363, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-195, bta-mir-34a, bta-mir-365-1, bta-mir-99b, bta-mir-100, bta-mir-129-1, bta-mir-129-2, bta-mir-130a, bta-mir-130b, bta-mir-133a-2, bta-mir-133a-1, bta-mir-143, bta-mir-146b, bta-mir-146a, bta-mir-155, bta-mir-181d, bta-mir-182, bta-mir-183, bta-mir-184, bta-mir-24-1, bta-mir-196a-1, bta-mir-199a-2, bta-mir-212, bta-mir-26a-1, bta-mir-28, bta-mir-29d, bta-mir-32, bta-mir-335, bta-mir-338, bta-mir-339a, bta-mir-346, bta-mir-365-2, bta-mir-378-1, bta-mir-383, bta-mir-409a, bta-mir-449a, bta-mir-449b, bta-mir-449c, bta-mir-592, bta-mir-708, bta-mir-92a-1, bta-mir-92b, bta-mir-29e, bta-mir-29b-1, bta-mir-1271, bta-mir-1249, bta-mir-181a-1, bta-mir-181b-1, bta-mir-2285a, bta-mir-2285d, bta-mir-2285b-1, bta-mir-2332, bta-mir-199c, bta-mir-2389, bta-mir-2285c, bta-mir-2404-1, bta-mir-449d, bta-mir-2411, bta-mir-2446, bta-mir-339b, bta-mir-2404-2, bta-mir-2483, bta-mir-424, bta-mir-378-2, bta-mir-409b, bta-mir-2285e-1, bta-mir-2285e-2, bta-mir-2285f-1, bta-mir-2285f-2, bta-mir-2285g-1, bta-mir-2285h, bta-mir-2285i, bta-mir-2285j-1, bta-mir-2285j-2, bta-mir-2285k-1, bta-mir-2285l, bta-mir-2285o-1, bta-mir-2285o-2, bta-mir-2285n-1, bta-mir-2285n-2, bta-mir-2285p, bta-mir-2285m-1, bta-mir-2285m-2, bta-mir-378b, bta-mir-2285n-3, bta-mir-2285n-4, bta-mir-2285o-3, bta-mir-2285o-4, bta-mir-2285m-3, bta-mir-378c, bta-mir-2285m-4, bta-mir-2285o-5, bta-mir-2285m-5, bta-mir-2285n-5, bta-mir-2285n-6, bta-mir-2285n-7, bta-mir-2285k-2, bta-mir-2285k-3, bta-mir-2285k-4, bta-mir-2285k-5, bta-mir-2285q, bta-mir-2285r, bta-mir-2285s, bta-mir-2285t, bta-mir-2285b-2, bta-mir-2285v, bta-mir-2285g-2, bta-mir-2285g-3, bta-mir-2285af-1, bta-mir-2285af-2, bta-mir-2285y, bta-mir-2285w, bta-mir-2285x, bta-mir-2285z, bta-mir-2285u, bta-mir-2285aa, bta-mir-2285ab, bta-mir-2285ac, bta-mir-2285ad, bta-mir-2285ae, bta-mir-378d, bta-mir-2285ag, bta-mir-2285ah, bta-mir-2285ai, bta-mir-2285aj, bta-mir-2285ak, bta-mir-2285al, bta-mir-2285am, bta-mir-2285ar, bta-mir-2285as-1, bta-mir-2285as-2, bta-mir-2285as-3, bta-mir-2285at-1, bta-mir-2285at-2, bta-mir-2285at-3, bta-mir-2285at-4, bta-mir-2285au, bta-mir-2285av, bta-mir-2285aw, bta-mir-2285ax-1, bta-mir-2285ax-2, bta-mir-2285ax-3, bta-mir-2285ay, bta-mir-2285az, bta-mir-2285an, bta-mir-2285ao-1, bta-mir-2285ao-2, bta-mir-2285ap, bta-mir-2285ao-3, bta-mir-2285aq-1, bta-mir-2285aq-2, bta-mir-2285ba-1, bta-mir-2285ba-2, bta-mir-2285bb, bta-mir-2285bc, bta-mir-2285bd, bta-mir-2285be, bta-mir-2285bf-1, bta-mir-2285bf-2, bta-mir-2285bf-3, bta-mir-2285bg, bta-mir-2285bh, bta-mir-2285bi-1, bta-mir-2285bi-2, bta-mir-2285bj-1, bta-mir-2285bj-2, bta-mir-2285bk, bta-mir-2285bl, bta-mir-2285bm, bta-mir-2285bn, bta-mir-2285bo, bta-mir-2285bp, bta-mir-2285bq, bta-mir-2285br, bta-mir-2285bs, bta-mir-2285bt, bta-mir-2285bu-1, bta-mir-2285bu-2, bta-mir-2285bv, bta-mir-2285bw, bta-mir-2285bx, bta-mir-2285by, bta-mir-2285bz, bta-mir-2285ca, bta-mir-2285cb, bta-mir-2285cc, bta-mir-2285cd, bta-mir-2285ce, bta-mir-2285cf, bta-mir-2285cg, bta-mir-2285ch, bta-mir-2285ci, bta-mir-2285cj, bta-mir-2285ck, bta-mir-2285cl, bta-mir-2285cm, bta-mir-2285cn, bta-mir-2285co, bta-mir-2285cp, bta-mir-2285cq, bta-mir-2285cr-1, bta-mir-2285cr-2, bta-mir-2285cs, bta-mir-2285ct, bta-mir-2285cu, bta-mir-2285cv-1, bta-mir-2285cv-2, bta-mir-2285cw-1, bta-mir-2285cw-2, bta-mir-2285cx, bta-mir-2285cy, bta-mir-2285cz, bta-mir-2285da, bta-mir-2285db, bta-mir-2285dc, bta-mir-2285dd, bta-mir-2285de, bta-mir-2285df, bta-mir-2285dg, bta-mir-2285dh, bta-mir-2285di, bta-mir-2285dj, bta-mir-2285dk, bta-mir-2285dl-1, bta-mir-2285dl-2, bta-mir-2285dm
On the other hand, among the miRNAs that were repressed at day 7 of the estrous cycle bta-miR-409a, bta-miR-2332 and bta-miR-196a were detected at day 3 but disappeared at day 7 of the estrous cycle (Figure 9A). [score:1]
[1 to 20 of 1 sentences]
18
[+] score: 1
Other miRNAs from this paper: ssc-mir-122, ssc-mir-135-1, ssc-mir-135-2, ssc-mir-148a, ssc-mir-19a, ssc-mir-20a, ssc-mir-224, ssc-mir-24-1, ssc-mir-323, ssc-mir-140, ssc-mir-183, ssc-mir-214, ssc-mir-27a, ssc-mir-325, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-103-1, ssc-mir-107, ssc-mir-136, ssc-mir-153, ssc-mir-18a, ssc-mir-186, ssc-mir-196a-2, ssc-mir-204, ssc-mir-21, bta-mir-18b, bta-let-7f-2, bta-mir-101-2, bta-mir-103-1, bta-mir-148a, bta-mir-18a, bta-mir-20a, bta-mir-21, bta-mir-221, bta-mir-27a, bta-mir-27b, bta-mir-107, bta-mir-140, bta-mir-20b, bta-mir-215, bta-let-7d, bta-mir-17, bta-mir-186, bta-mir-199b, bta-mir-210, bta-mir-214, bta-mir-450a-2, bta-let-7g, bta-mir-24-2, bta-let-7a-1, bta-let-7f-1, bta-mir-122, bta-let-7i, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-15a, bta-mir-19a, bta-mir-204, ssc-mir-15a, ssc-mir-17, ssc-mir-199b, ssc-mir-210, ssc-mir-221, bta-mir-101-1, bta-mir-133a-2, bta-mir-133a-1, bta-mir-135a-2, bta-mir-135a-1, bta-mir-135b, bta-mir-136, bta-mir-146b, bta-mir-153-1, bta-mir-153-2, bta-mir-183, bta-mir-24-1, bta-mir-196a-1, bta-mir-196b, bta-mir-224, bta-mir-323, ssc-mir-101-1, ssc-mir-101-2, ssc-mir-133a-1, ssc-mir-450a, ssc-mir-146b, ssc-mir-215, bta-mir-1343, bta-mir-2320, bta-mir-2326, bta-mir-2366, bta-mir-2411, bta-mir-2483, bta-mir-450a-1, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-103-2, ssc-mir-27b, ssc-mir-24-2, ssc-mir-196b-1, ssc-mir-450b, ssc-mir-450c, ssc-mir-133a-2, ssc-let-7a-2, ssc-mir-18b, ssc-mir-1343, ssc-mir-2320, bta-mir-450b, ssc-let-7d, ssc-let-7f-2, ssc-mir-20b-1, ssc-mir-20b-2, ssc-mir-196a-1, ssc-mir-196b-2, ssc-mir-2366-1, ssc-mir-2366-2, ssc-mir-2411, ssc-mir-2483
Moreover, published report showed that miR-196, miR-214, miR-199b, miR-186, miR-101 and miR-27a were related to bovine backfat thickness [36]. [score:1]
[1 to 20 of 1 sentences]
19
[+] score: 1
MiR-196a is a bona fide negative regulator of the newborn ovary homeobox gene (NOBOX) during bovine early embryogenesis [18]. [score:1]
[1 to 20 of 1 sentences]
20
[+] score: 1
On the other hand, one of the known human mir-196 paralogs is located in the 5'UTR of a HoxA9 transcript [54]. [score:1]
[1 to 20 of 1 sentences]
21
[+] score: 1
Other miRNAs from this paper: bta-mir-29a, bta-let-7f-2, bta-mir-103-1, bta-mir-151, bta-mir-30d, bta-mir-320a-2, bta-mir-126, bta-mir-181a-2, bta-mir-27b, bta-mir-30b, bta-mir-31, bta-mir-34b, bta-mir-107, bta-mir-15b, bta-mir-181b-2, bta-mir-30e, bta-let-7d, bta-mir-124a-1, bta-mir-138-2, bta-mir-181c, bta-mir-214, bta-mir-455, bta-mir-93, bta-let-7g, bta-mir-10b, bta-mir-30a, bta-let-7a-1, bta-mir-487b, bta-let-7f-1, bta-mir-122, bta-mir-30c, bta-let-7i, bta-mir-25, bta-mir-34c, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-15a, bta-mir-34a, bta-mir-1-2, bta-mir-1-1, bta-mir-105b, bta-mir-124a-2, bta-mir-124b, bta-mir-133a-2, bta-mir-133a-1, bta-mir-133b, bta-mir-138-1, bta-mir-152, bta-mir-181d, bta-mir-196a-1, bta-mir-206, bta-mir-30f, bta-mir-409a, bta-mir-432, bta-mir-486, bta-mir-495, bta-mir-543, bta-mir-9-1, bta-mir-9-2, bta-mir-1185, bta-mir-1271, bta-mir-181a-1, bta-mir-181b-1, bta-mir-2284i, bta-mir-2284s, bta-mir-2284l, bta-mir-2284j, bta-mir-2284t, bta-mir-2284d, bta-mir-2284n, bta-mir-2284g, bta-mir-2284p, bta-mir-2284u, bta-mir-2363-1, bta-mir-2363-2, bta-mir-2284f, bta-mir-2284a, bta-mir-2284k, bta-mir-2284c, bta-mir-2384, bta-mir-2284v, bta-mir-2284q, bta-mir-2404-1, bta-mir-2284m, bta-mir-2284b, bta-mir-320b, bta-mir-2424, bta-mir-2284r, bta-mir-2284h, bta-mir-2404-2, bta-mir-2284o, bta-mir-2284e, bta-mir-320a-1, bta-mir-424, bta-mir-2284w, bta-mir-2284x, bta-mir-409b, bta-mir-2284y-1, bta-mir-2284y-2, bta-mir-2284y-3, bta-mir-2284y-4, bta-mir-2284y-5, bta-mir-2284y-6, bta-mir-2284y-7, bta-mir-2284z-1, bta-mir-2284aa-1, bta-mir-2284z-3, bta-mir-2284aa-2, bta-mir-2284aa-3, bta-mir-2284z-4, bta-mir-2284z-5, bta-mir-2284z-6, bta-mir-2284z-7, bta-mir-2284aa-4, bta-mir-2284z-2, bta-mir-133c, bta-mir-2284ab, bta-mir-2284ac
MiR-196a is a bona fide negative regulator of the newborn ovary homeobox gene (NOBOX) during bovine early embryogenesis [19]. [score:1]
[1 to 20 of 1 sentences]