sort by

28 publications mentioning bta-mir-223

Open access articles that are associated with the species Bos taurus and mention the gene name mir-223. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 77
Other miRNAs from this paper: bta-mir-21, bta-mir-146a, bta-mir-9-1, bta-mir-9-2
Based on the direct interaction in PPI and GGI networks, the down-regulation of CXCL14 and KIT might directly influence the expression of multiple innate immune-related genes (e. g., CX3CR1, CXCR2, CCR9, CCR1, SPI1, JAK2, IL1RAP, IL7R, and CSF3) and lipid-metabolism-related genes (e. g., LPL) as well as other target genes of bta-mir-223 and bta-mir-21-3p (e. g., AQP1, ADAMTSL2, SCN1A, and ISLR) (Figure 6). [score:10]
These findings indicate that CEBPE could play a regulatory role in bovine mammary responses to IMI through regulating the expression of bta-mir-223, which in turn post-transcriptionally regulates the expression of other important immune-related genes. [score:8]
More interestingly, out of these 28 genes successfully annotated in the disease susceptibility/mastitis-related QTLs, AJUBA, AQP5, CXCL14, and SCN1A were target genes of bta-mir-223, while KERA, TEX101, and TRIM29 were target genes of bta-mir-21-3p. [score:7]
Additionally, it has been reported that the up-regulation of mir-223 was partly controlled by the up-regulation of CEBPE (CCAAT enhancer binding protein) both in human and bovine studies (Fazi et al., 2005; Moyes et al., 2009). [score:7]
Bta-mir-223 and bta-mir-21-3p were likely to be the central post-transcriptional regulators of the innate immune response to IMI with S. aureus in bovine mammary gland through regulating the expression of some key immune-related genes (e. g., CXCL14 and KIT), which demonstrated that the response to S. aureus in bovine mammary gland was regulated by a miRNA-gene-pathway network. [score:6]
The up-regulation of bta-mir-223 was observed, which was consistent with the present study. [score:4]
Control comparison, while both bta-mir-223 and bta-mir-21-3p were reasonably detected to be significantly up-regulated in High vs. [score:4]
The biological roles of mir-223 include inhibition of cell cycle progression, negative regulation of neutrophil proliferation, and granulocyte differentiation (Laios et al., 2008), and it has also been identified as sensitive and specific biomarkers for sepsis defined as the combination of infection and inflammatory response syndrome (Wang et al., 2010). [score:4]
The proteins encoded by CCR9, CXCL14, CX3CR1, KIT, and PDYN, the target genes of bta-mir-223 or bta-mir-21-3p, were closely interconnected with multiple immune-related proteins in the PPI network, providing supportive evidence that bta-mir-223 and bta-mir-21-3p played crucial roles in regulating the mammary transcriptional response to S. aureus infection. [score:4]
Of most interest were the two target genes of bta-mir-223 and bta-mir-21-3p, CXCL14 and KIT, which were shared by the enriched BPs and KEGG pathways and were also structurally presented as the pivotal nodes in both GGI and PPI networks (Figure 4). [score:3]
Genes in red are the target genes of bta-mir-223. [score:3]
Control comparison, a total of 107 unique genes was obtained, containing DEGs in the enriched BPs, DEGs in the enriched KEGG pathways and target genes of bta-mir-223 or bta-mir-21-3p (Table S11), as a gene list for the following interaction analyses. [score:3]
The gene in blue is a common target gene of both bta-mir-223 and bta-mir-21-3p. [score:3]
Genes in black are not the target genes of either bta-mir-223 or bta-mir-21-3p. [score:3]
A minicircuitry comprised of microRNA-223 and transcription factors NFI-A and C/EBPα regulates human granulopoiesis. [score:2]
However, it remains to be investigated whether and how the expression of bta-mir-223 is regulated by CEBPE gene. [score:2]
Figure 6 Gene-pathway interactive network modulated by bta-mir-223 and bta-mir-21-3p. [score:1]
Serum miR-146a and miR-223 as potential new biomarkers for sepsis. [score:1]
Potential role of miR-9 and miR-223 in recurrent ovarian cancer. [score:1]
Control comparison, namely bta-mir-223 [FDR = 0.001 and log [2](fold-change) = 3.25] and bta-mir-21-3p [FDR = 0.003 and log [2](fold-change) = 2.12]. [score:1]
[1 to 20 of 20 sentences]
2
[+] score: 55
The expression of 14 miRNAs (miR-10a, -15b, -16a, -17, -21, -31, -145, -146a, -146b, -155, -181a, -205, -221, and -223) associated with regulation of innate immunity and mammary epithelial cell function in tissue challenged with Streptococcus uberis, Three miRNAs (181a, 16, and 31) were downregulated approximately 3- to 5-fold and miR-223 was upregulated approximately 2.5-fold in infected versus healthy tissue [15]. [score:10]
The expression of miR-223, miR-184, miR-132, miR-1246 and miR-130b were up-regulated while miR-196a, miR-205, miR-200b, miR-31 and miR-145 were down-regulated, which was in agreement with the high-throughput sequencing results (Figure 4). [score:9]
A previous study observed down-regulation of miR-223 in bovine blood monocytes challenged with S. aureus enterotoxin B [14], but in another study, miR-223 was upregulated in dairy cow mammary gland tissues infected with streptococcus [15]. [score:7]
In our study, the expression of miR-223 in breast mammary tissue infected with S. aureus was significantly up-regulated relative to the control group (log2 = 4.88). [score:6]
miR-223 has been studied primarily in granulocytes and neutrophils, it negatively regulates the proliferation and differentiation of neutrophils through down-regulation of the transcription factor Mef2c, a known promoter of myeloid progenitor proliferation. [score:5]
Thus, a deeper analysis of the biological functions and effects of the expression of miR-223 in mammary epithelial cells is needed to clarify and it may participate in regulation of mastitis in dairy cows and could be used as a candidate for further research. [score:4]
miRNA Target Genes miR-1246 ATP2B4, MAP3K1, ADCK3, PSD2, SLC5A1 miR-130b EXOC3L1, TIE1, BAZ2B, C3, GRAMD1C miR-145 HSD3B7, SLCO4A1, PDIA4, ACADL, PTPN11, KRT9, RASSF6, RNF43, LAMC2 miR-196a ADAP1, GPR97, POMT1 miR-200b ARID3A, MLXIP, GPR110 miR-205 IL13RA2, COL5A2, ADM, CXCR2, XPO6, SPSB1, FMO5, PSMF1 miR-31 MEX3D, PFKFB3, ST3GAL3, IL2RB, ANKRD32, MGST1 miR-184 HSPA1L, SLC25A15, HEG1, MAPRE2, ACP6, SYNE2 miR-223 TMEM165 miR-132 IQCA1 Figure 5 Gene ontology statistics. [score:3]
For example, five inflammation-related miRNAs (miR-9, miR-125b, miR-155, miR-146a and miR-223) were differentially expressed in bovine CD14+ monocytes stimulated with either LPS or Staphylococcus aureus enterotoxin B (SEB) [14]. [score:3]
miRNA Target Genes miR-1246 ATP2B4, MAP3K1, ADCK3, PSD2, SLC5A1 miR-130b EXOC3L1, TIE1, BAZ2B, C3, GRAMD1C miR-145 HSD3B7, SLCO4A1, PDIA4, ACADL, PTPN11, KRT9, RASSF6, RNF43, LAMC2 miR-196a ADAP1, GPR97, POMT1 miR-200b ARID3A, MLXIP, GPR110 miR-205 IL13RA2, COL5A2, ADM, CXCR2, XPO6, SPSB1, FMO5, PSMF1 miR-31 MEX3D, PFKFB3, ST3GAL3, IL2RB, ANKRD32, MGST1 miR-184 HSPA1L, SLC25A15, HEG1, MAPRE2, ACP6, SYNE2 miR-223 TMEM165 miR-132 IQCA1 Figure 5 Gene ontology statistics. [score:3]
In a miR-223 knockout mouse, increased neutrophil numbers, spontaneous inflammation in the lung and exaggerated tissue destruction was observed following LPS challenge. [score:2]
Wang J. F. Yu M. L. Yu G. Bian J. J. Deng X. M. Wan X. J. Zhu K. M. Serum miR-146a and miR-223 as potential new biomarkers for sepsis Biochem. [score:1]
miR-223 also has been identified as a specific and sensitive biomarker for sepsis in humans [28]. [score:1]
It supported a mo del in which miR-223 acts as a fine-tuner of granulocyte production and the inflammatory response [27]. [score:1]
[1 to 20 of 13 sentences]
3
[+] score: 31
According to the results of TargetScan analysis, totally 2743 bovine genes were predicted as the targets of c-miRNAs significantly down-regulated by grazing (miR-19b, miR-148a, miR-150, miR-221, miR-223 miR-320a, miR-361, and miR-486). [score:8]
There was temporary up-regulation of miR-223 in the housed cattle. [score:4]
Although the roles of miR-223 in human exercise or the grazing of animals remains unknown, our observation is similar to the result of down-regulated miR-223 level in circulation at 1 h post-exercise [43]. [score:4]
A high expression level of miR-223 is seen in cells of myeloid lineage, with granulocytes showing the highest levels. [score:3]
Of these c-miRNAs, circulation levels of miR-19b, miR-148a, miR-150, miR-221, miR-223, miR-320a, miR-361, and miR-486 were significantly down-regulated in the grazing cattle compared to housed cattle, whereas the miR-451 level was higher in the grazing than in the housed cattle. [score:3]
In addition, miR-223 is also considered as an inflammatory miRNA due to its specific expression in the haematopoietic system [52]. [score:2]
In this overview, it was noted that the only miRNAs that were observed to increase in the grazing but not in the housed cattle were miR-144 and miR-451, whereas there were many more miRNAs with an increasing tendency in the housed but not in the grazing, such as miR-150 and miR-223. [score:1]
miR-223: infection, inflammation and cancer. [score:1]
The temporary lowering of circulating miR-223 in the grazing cattle might indicate haematopoiesis in those cattle. [score:1]
The miR-223 level in the housed cattle increased from time 0 to 1 or 2 mo (P < 0.008), while in the grazing cattle, it decreased from 0 to 4 and 7 mo (P < 0.006). [score:1]
Grazing -induced miRNAs: miR-19b, miR-150, miR-223, miR-320a, miR-361. [score:1]
At 2 mo, the levels of miR-19b, miR-150, miR-223, miR-320a, and miR-361 in the grazing cattle were lower than in the housed cattle (P = 0.015, 0.020, 0.026, 0.023, and 0.089, respectively). [score:1]
Meanwhile, in the present study, circulating levels of miR-19b, miR-150, miR-223, and miR-320a were temporarily lower in the grazing cattle than in the housed, suggesting that there might be some stress on the grazing cattle. [score:1]
[1 to 20 of 13 sentences]
4
[+] score: 27
S3 FigReal-time PCR of miR-16 and its target genes (TNFα and IGF2), miR-223 and its target gene (IGF2), and miR-215 and its target gene (INOS) in BOEC after LPS challenge for 48hr. [score:7]
Real-time PCR of miR-16 and its target genes (TNFα and IGF2), miR-223 and its target gene (IGF2), and miR-215 and its target gene (INOS) in BOEC after LPS challenge for 48hr. [score:7]
We identified the potential regulatory miRNAs (miR-155, miR-146a, miR-223, miR-21, miR-16 and miR-215) targeting the candidate genes in oviductal epithelial cells, using bioinformatics tools. [score:4]
Interestingly, miR-16, miR-21, miR-223 and miR-215 were reported by [24], where these miRNAs are differentially expressed between healthy and sub-clinical endometritis cows, but miR-146a and miR-155 are indicated to be endotoxin-responsive genes [25, 26]. [score:3]
The overall results showed that miR-155, miR-146a, miR-223, miR-21, miR-16 and miR-215 have shown a clear inhibition in challenged group after BOEC treated with LPS for 24h (Fig. 4). [score:3]
Then we filtered the miRNA hits on the basis their potential relevance for physiological function and immune response of oviduct at least in four different search algorithms, and thus, miR-16, miR-21, miR-223, miR-215, miR-146a and miR-155 were identified as a potential miRNAs targeting our genes of interest. [score:3]
[1 to 20 of 6 sentences]
5
[+] score: 14
Interestingly, in RAW264.7 cells challenged with lipopolysaccharide (LPS), miR-223 has been reported to be downregulated, allowing the upregulation of signal transducer and activator of transcription 3 (STAT3), which promotes proinflammatory IL-6 and IL-1β transcription. [score:7]
miR-223, for example, which was upregulated at 36 hpi in MIMs, has a multifactorial role in neutrophils, regulating their proliferation, activation, and granulopoiesis (Chen et al. 2004; Fazi et al. 2005). [score:5]
Biokhimiia 77: 327– 338 Fazi F. Rosa A. Fatica A. Gelmetti V. De Marchis M. L. 2005  A minicircuitry comprised of microRNA-223 and transcription factors NFI-A and C/EBPalpha regulates human granulopoiesis. [score:2]
[1 to 20 of 3 sentences]
6
[+] score: 13
miR-223 has been shown to up-regulate miR-142 expression through transcription factors (LMO2-L/-S isoforms and CEBP-β) [83]. [score:6]
Moreover, miR-223 was down-regulated after lactation peak, and might play a role in the mammary response to pathogens after parturition [32]. [score:4]
Sun W. Shen W. Yang S. Hu F. Li H. Zhu T. -H. MiR-223 and miR-142 attenuate hematopoietic cell proliferation, and miR-223 positively regulates miR-142 through LMO2 isoforms and CEBP-βCell. [score:2]
Interestingly, miR-223 and miR-142 showed strong interaction in the TURQUOISE module. [score:1]
[1 to 20 of 4 sentences]
7
[+] score: 13
The expression levels of miR-25, miR-155, miR-182, miR-191, miR-221, miR-223, and/or miR-375 have been reported to change in the mammary gland tissues of cows [7], goats [8], milk from pigs [3], and rat milk whey [29] during lactation, and therefore we also analyzed these miRNAs. [score:3]
As well as miR-148a, miR-103 and miR-223 expression in BMEC culture media was also elevated by DIP-treatment, suggesting secretion of miR-103 and miR-223 in BMEC was also enhanced by lactogenic hormones. [score:3]
The cellular expression of miR-21-5p, miR-25, miR-26a, miR-223, and miR-320a was lower in the DIP -treated BMECs than in the untreated BMECs (P = 0.005, = 0.059, = 0.016, = 0.054, and = 0.011, respectively), whereas that of the other miRNAs was not significantly changed by the treatment (Fig.   4a). [score:3]
The medium-to-cell expression ratios of miR-103 (P = 0.025), miR-148a (P < 0.001), and miR-223 (P = 0.013) were elevated in the DIP -treated BMECs, suggesting that the lactogenic differentiation -induced secretion of these three miRNAs in BMECs. [score:3]
The ratios of miR-25, miR-103, miR-148a, and miR-223 were elevated (P = 0.062, = 0.025, < 0.001, and = 0.014, respectively) but those of miR-107, miR-182, and miR-339a were reduced in the DIP -treated BMECs (P = 0.057, = 0.022, and = 0.020, respectively) in comparison to those in the untreated cells (Fig.   4c). [score:1]
[1 to 20 of 5 sentences]
8
[+] score: 10
Other miRNAs from this paper: bta-let-7f-2, bta-mir-21, bta-mir-221, bta-mir-222, bta-mir-26b, bta-mir-125a, bta-mir-125b-1, bta-mir-128-1, bta-mir-181a-2, bta-mir-27b, bta-mir-30b, bta-mir-140, bta-mir-15b, bta-mir-92a-2, bta-let-7d, bta-let-7g, bta-mir-30a, bta-let-7a-1, bta-let-7f-1, bta-let-7i, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-125b-2, bta-mir-374a, bta-mir-128-2, bta-mir-146b, bta-mir-152, bta-mir-155, bta-mir-181d, bta-mir-24-1, bta-mir-374b, bta-mir-500, bta-mir-708, bta-mir-92a-1, bta-mir-9-1, bta-mir-9-2, bta-mir-1249, bta-mir-181a-1, bta-mir-2285a, bta-mir-2285d, bta-mir-2285b-1, bta-mir-2285c, bta-mir-2478, bta-mir-2898, bta-mir-2285e-1, bta-mir-2285e-2, bta-mir-2285f-1, bta-mir-2285f-2, bta-mir-2285g-1, bta-mir-2285h, bta-mir-2285i, bta-mir-2285j-1, bta-mir-2285j-2, bta-mir-2285k-1, bta-mir-2285l, bta-mir-2285o-1, bta-mir-2285o-2, bta-mir-2285n-1, bta-mir-2285n-2, bta-mir-2285p, bta-mir-2285m-1, bta-mir-2285m-2, bta-mir-2285n-3, bta-mir-2285n-4, bta-mir-2285o-3, bta-mir-2285o-4, bta-mir-2285m-3, bta-mir-2285m-4, bta-mir-2285o-5, bta-mir-2285m-5, bta-mir-2285n-5, bta-mir-2285n-6, bta-mir-2285n-7, bta-mir-2285k-2, bta-mir-2285k-3, bta-mir-2285k-4, bta-mir-2285k-5, bta-mir-2285q, bta-mir-2285r, bta-mir-2285s, bta-mir-2285t, bta-mir-2285b-2, bta-mir-2285v, bta-mir-2285g-2, bta-mir-2285g-3, bta-mir-2285af-1, bta-mir-2285af-2, bta-mir-2285y, bta-mir-2285w, bta-mir-2285x, bta-mir-2285z, bta-mir-2285u, bta-mir-2285aa, bta-mir-2285ab, bta-mir-2285ac, bta-mir-2285ad, bta-mir-2285ae, bta-mir-2285ag, bta-mir-2285ah, bta-mir-2285ai, bta-mir-2285aj, bta-mir-2285ak, bta-mir-2285al, bta-mir-2285am, bta-mir-2285ar, bta-mir-2285as-1, bta-mir-2285as-2, bta-mir-2285as-3, bta-mir-2285at-1, bta-mir-2285at-2, bta-mir-2285at-3, bta-mir-2285at-4, bta-mir-2285au, bta-mir-2285av, bta-mir-2285aw, bta-mir-2285ax-1, bta-mir-2285ax-2, bta-mir-2285ax-3, bta-mir-2285ay, bta-mir-2285az, bta-mir-2285an, bta-mir-2285ao-1, bta-mir-2285ao-2, bta-mir-2285ap, bta-mir-2285ao-3, bta-mir-2285aq-1, bta-mir-2285aq-2, bta-mir-2285ba-1, bta-mir-2285ba-2, bta-mir-2285bb, bta-mir-2285bc, bta-mir-2285bd, bta-mir-2285be, bta-mir-2285bf-1, bta-mir-2285bf-2, bta-mir-2285bf-3, bta-mir-2285bg, bta-mir-2285bh, bta-mir-2285bi-1, bta-mir-2285bi-2, bta-mir-2285bj-1, bta-mir-2285bj-2, bta-mir-2285bk, bta-mir-2285bl, bta-mir-2285bm, bta-mir-2285bn, bta-mir-2285bo, bta-mir-2285bp, bta-mir-2285bq, bta-mir-2285br, bta-mir-2285bs, bta-mir-2285bt, bta-mir-2285bu-1, bta-mir-2285bu-2, bta-mir-2285bv, bta-mir-2285bw, bta-mir-2285bx, bta-mir-2285by, bta-mir-2285bz, bta-mir-2285ca, bta-mir-2285cb, bta-mir-2285cc, bta-mir-2285cd, bta-mir-2285ce, bta-mir-2285cf, bta-mir-2285cg, bta-mir-2285ch, bta-mir-2285ci, bta-mir-2285cj, bta-mir-2285ck, bta-mir-2285cl, bta-mir-2285cm, bta-mir-2285cn, bta-mir-2285co, bta-mir-2285cp, bta-mir-2285cq, bta-mir-2285cr-1, bta-mir-2285cr-2, bta-mir-2285cs, bta-mir-2285ct, bta-mir-2285cu, bta-mir-2285cv-1, bta-mir-2285cv-2, bta-mir-2285cw-1, bta-mir-2285cw-2, bta-mir-2285cx, bta-mir-2285cy, bta-mir-2285cz, bta-mir-2285da, bta-mir-2285db, bta-mir-2285dc, bta-mir-2285dd, bta-mir-2285de, bta-mir-2285df, bta-mir-2285dg, bta-mir-2285dh, bta-mir-2285di, bta-mir-2285dj, bta-mir-2285dk, bta-mir-2285dl-1, bta-mir-2285dl-2, bta-mir-2285dm
MiR-223 regulates inflammation (reviewed in [58]) and was found to be up-regulated in bovine mammary tissue infected with S. uberis [59]. [score:4]
Both strains induced miR-221, ST12 induced miR-30b, miR-223, miR-374b and miR-500 but down-regulated miR-125a and miR-125b, while ST103 induced miR-222, all associated with alternative macrophage activation [34– 37]. [score:4]
For three of the ST12-unique DE miRNAs (bta-miR-155, bta-miR-125b and bta-miR-223) evidence of induction by bacteria has been previously documented. [score:1]
86887514:+ chrX_3864 40,373,00 6,00 20,590,60 hsa-miR-223-5p cguguauuugacaagcugaguug chrX:99936328.. [score:1]
[1 to 20 of 4 sentences]
9
[+] score: 10
Other miRNAs from this paper: hsa-mir-17, hsa-mir-19a, hsa-mir-29a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-198, hsa-mir-208a, hsa-mir-10a, hsa-mir-223, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-126, hsa-mir-146a, hsa-mir-150, hsa-mir-155, hsa-mir-29c, hsa-mir-99b, hsa-mir-296, hsa-mir-196b, hsa-mir-515-1, hsa-mir-515-2, hsa-mir-548a-1, hsa-mir-548b, hsa-mir-548a-2, hsa-mir-550a-1, hsa-mir-550a-2, hsa-mir-548a-3, hsa-mir-548c, hsa-mir-640, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-550a-3, bta-mir-29a, bta-mir-125b-1, bta-mir-126, bta-mir-10a, bta-mir-124a-1, bta-mir-17, bta-mir-29b-2, bta-mir-29c, bta-mir-150, bta-mir-122, bta-mir-125b-2, bta-mir-19a, bta-mir-99b, hsa-mir-208b, hsa-mir-548e, hsa-mir-548j, hsa-mir-548k, hsa-mir-548l, hsa-mir-548f-1, hsa-mir-548f-2, hsa-mir-548f-3, hsa-mir-548f-4, hsa-mir-548f-5, hsa-mir-548g, hsa-mir-548n, hsa-mir-548m, hsa-mir-548o, hsa-mir-548h-1, hsa-mir-548h-2, hsa-mir-548h-3, hsa-mir-548h-4, hsa-mir-548p, hsa-mir-548i-1, hsa-mir-548i-2, hsa-mir-548i-3, hsa-mir-548i-4, bta-mir-124a-2, bta-mir-124b, bta-mir-146a, bta-mir-155, bta-mir-196b, bta-mir-208a, bta-mir-208b, bta-mir-296, bta-mir-29d, bta-mir-9-1, bta-mir-9-2, bta-mir-29e, bta-mir-29b-1, hsa-mir-548q, bta-mir-2284i, bta-mir-2285a, bta-mir-2284s, bta-mir-2285d, bta-mir-2284l, bta-mir-2284j, bta-mir-2284t, bta-mir-2285b-1, bta-mir-2284d, bta-mir-2284n, bta-mir-2284g, bta-mir-2284p, bta-mir-2284u, bta-mir-2284f, bta-mir-2284a, bta-mir-2284k, bta-mir-2284c, bta-mir-2284v, bta-mir-2285c, bta-mir-2284q, bta-mir-2284m, bta-mir-2284b, bta-mir-2284r, bta-mir-2284h, bta-mir-2284o, bta-mir-2284e, hsa-mir-548s, hsa-mir-548t, hsa-mir-548u, hsa-mir-548v, hsa-mir-548w, hsa-mir-548x, bta-mir-2284w, bta-mir-2284x, hsa-mir-548y, hsa-mir-550b-1, hsa-mir-550b-2, hsa-mir-548z, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548o-2, hsa-mir-548h-5, hsa-mir-548ab, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548x-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-548am, hsa-mir-548an, hsa-mir-548ao, hsa-mir-548ap, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, bta-mir-2284y-1, bta-mir-2285e-1, bta-mir-2285e-2, bta-mir-2285f-1, bta-mir-2285f-2, bta-mir-2285g-1, bta-mir-2285h, bta-mir-2285i, bta-mir-2285j-1, bta-mir-2285j-2, bta-mir-2285k-1, bta-mir-2285l, hsa-mir-548ay, hsa-mir-548az, bta-mir-2285o-1, bta-mir-2285o-2, bta-mir-2285n-1, bta-mir-2285n-2, bta-mir-2285p, bta-mir-2285m-1, bta-mir-2285m-2, bta-mir-2284y-2, bta-mir-2285n-3, bta-mir-2285n-4, bta-mir-2284y-3, bta-mir-2285o-3, bta-mir-2285o-4, bta-mir-2285m-3, bta-mir-2284y-4, bta-mir-2284y-5, bta-mir-2284y-6, bta-mir-2285m-4, bta-mir-2285o-5, bta-mir-2285m-5, bta-mir-2285n-5, bta-mir-2285n-6, bta-mir-2284y-7, bta-mir-2285n-7, bta-mir-2284z-1, bta-mir-2284aa-1, bta-mir-2285k-2, bta-mir-2284z-3, bta-mir-2284aa-2, bta-mir-2284aa-3, bta-mir-2285k-3, bta-mir-2285k-4, bta-mir-2284z-4, bta-mir-2285k-5, bta-mir-2284z-5, bta-mir-2284z-6, bta-mir-2284z-7, bta-mir-2284aa-4, bta-mir-2285q, bta-mir-2285r, bta-mir-2285s, bta-mir-2285t, bta-mir-2285b-2, bta-mir-2285v, bta-mir-2284z-2, bta-mir-2285g-2, bta-mir-2285g-3, bta-mir-2285af-1, bta-mir-2285af-2, bta-mir-2285y, bta-mir-2285w, bta-mir-2285x, bta-mir-2285z, bta-mir-2285u, bta-mir-2285aa, bta-mir-2285ab, bta-mir-2284ab, bta-mir-2285ac, bta-mir-2285ad, bta-mir-2284ac, bta-mir-2285ae, hsa-mir-548ba, hsa-mir-548bb, hsa-mir-548bc, bta-mir-2285ag, bta-mir-2285ah, bta-mir-2285ai, bta-mir-2285aj, bta-mir-2285ak, bta-mir-2285al, bta-mir-2285am, bta-mir-2285ar, bta-mir-2285as-1, bta-mir-2285as-2, bta-mir-2285as-3, bta-mir-2285at-1, bta-mir-2285at-2, bta-mir-2285at-3, bta-mir-2285at-4, bta-mir-2285au, bta-mir-2285av, bta-mir-2285aw, bta-mir-2285ax-1, bta-mir-2285ax-2, bta-mir-2285ax-3, bta-mir-2285ay, bta-mir-2285az, bta-mir-2285an, bta-mir-2285ao-1, bta-mir-2285ao-2, bta-mir-2285ap, bta-mir-2285ao-3, bta-mir-2285aq-1, bta-mir-2285aq-2, bta-mir-2285ba-1, bta-mir-2285ba-2, bta-mir-2285bb, bta-mir-2285bc, bta-mir-2285bd, bta-mir-2285be, bta-mir-2285bf-1, bta-mir-2285bf-2, bta-mir-2285bf-3, bta-mir-2285bg, bta-mir-2285bh, bta-mir-2285bi-1, bta-mir-2285bi-2, bta-mir-2285bj-1, bta-mir-2285bj-2, bta-mir-2285bk, bta-mir-2285bl, bta-mir-2285bm, bta-mir-2285bn, bta-mir-2285bo, bta-mir-2285bp, bta-mir-2285bq, bta-mir-2285br, bta-mir-2285bs, bta-mir-2285bt, bta-mir-2285bu-1, bta-mir-2285bu-2, bta-mir-2285bv, bta-mir-2285bw, bta-mir-2285bx, bta-mir-2285by, bta-mir-2285bz, bta-mir-2285ca, bta-mir-2285cb, bta-mir-2285cc, bta-mir-2285cd, bta-mir-2285ce, bta-mir-2285cf, bta-mir-2285cg, bta-mir-2285ch, bta-mir-2285ci, bta-mir-2285cj, bta-mir-2285ck, bta-mir-2285cl, bta-mir-2285cm, bta-mir-2285cn, bta-mir-2285co, bta-mir-2285cp, bta-mir-2285cq, bta-mir-2285cr-1, bta-mir-2285cr-2, bta-mir-2285cs, bta-mir-2285ct, bta-mir-2285cu, bta-mir-2285cv-1, bta-mir-2285cv-2, bta-mir-2285cw-1, bta-mir-2285cw-2, bta-mir-2285cx, bta-mir-2285cy, bta-mir-2285cz, bta-mir-2285da, bta-mir-2285db, bta-mir-2285dc, bta-mir-2285dd, bta-mir-2285de, bta-mir-2285df, bta-mir-2285dg, bta-mir-2285dh, bta-mir-2285di, bta-mir-2285dj, bta-mir-2285dk, bta-mir-2285dl-1, bta-mir-2285dl-2, bta-mir-2285dm
Bovine HMGB1 has been shown to be targeted by bta-miR-223, a miRNA that is up-regulated during S. aureus infection (48). [score:6]
Reference miRNA Tissue Source Condition(31) Genome-wide embryo, thymus, lymph node, and small intestine Holstein–Friesian None(44) Genome-wide Bos taurus kidney cells (MDBK) Cell line Bovine herpesvirus 1(46) miR-10a, -15b, 16a, -17, -21, 31, -145, 146a, 146b, 155, -181a, -205, -221, and -223 Mammary tissue Holstein–Friesian Mastitis(48) miR-223 Venous blood Holstein–Friesian Mastitis(45) miR-9, -125b, -155, -146a, and -223CD14 monocytes ex vivo Holstein–Friesian LPS and SEB(49) miR-296, -2430, -671, and -2318 Mammary tissue Holstein–Friesian Mastitis(39) miR-17-5p, -20b, and -93 Mammary tissue Holstein–Friesian Mastitis(40) Genome-wideMammary epithelial cells ex vivo Holstein–Friesian Mastitis(41) Genome-wide Alveolar macrophages Holstein–Friesian None(39) Genome-wide Peripheral blood Holstein–Friesian Mastitis(42) Genome-wide CD14 monocytes Holstein–Friesian Mastitis(47) Genome-wide MAC-T cells Cell lineHeat-inactivated E. coli or S. aureus More recent studies have employed high-throughput sequencing approaches to temporally profile genome-wide changes in miRNA expression in different cell-types in response to challenge with bovine mastitis-causing pathogens such as Escherichia coli, S. aureus, and S. uberis. [score:3]
Exosome miRNAs – including a number of immune-relevant ones, such as bta-miR-223 and bta-miR-125b – have been found in both human breast milk and bovine milk (54– 56). [score:1]
[1 to 20 of 3 sentences]
10
[+] score: 10
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-21, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-99a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-16-2, hsa-mir-192, hsa-mir-148a, hsa-mir-10b, hsa-mir-181a-2, hsa-mir-181a-1, hsa-mir-215, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-mir-15b, hsa-mir-27b, hsa-mir-125b-1, hsa-mir-141, hsa-mir-143, hsa-mir-152, hsa-mir-125b-2, hsa-mir-126, hsa-mir-146a, hsa-mir-184, hsa-mir-200c, hsa-mir-155, hsa-mir-29c, hsa-mir-200a, hsa-mir-99b, hsa-mir-296, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-378a, hsa-mir-342, hsa-mir-148b, hsa-mir-451a, ssc-mir-125b-2, ssc-mir-148a, ssc-mir-15b, ssc-mir-184, ssc-mir-224, ssc-mir-23a, ssc-mir-24-1, ssc-mir-26a, ssc-mir-29b-1, ssc-let-7f-1, ssc-mir-103-1, ssc-mir-21, ssc-mir-29c, hsa-mir-486-1, hsa-mir-499a, hsa-mir-671, hsa-mir-378d-2, bta-mir-26a-2, bta-mir-29a, bta-let-7f-2, bta-mir-103-1, bta-mir-148a, bta-mir-16b, bta-mir-21, bta-mir-499, bta-mir-99a, bta-mir-125b-1, bta-mir-126, bta-mir-181a-2, bta-mir-27b, bta-mir-31, bta-mir-15b, bta-mir-215, bta-mir-30e, bta-mir-148b, bta-mir-192, bta-mir-200a, bta-mir-200c, bta-mir-23a, bta-mir-29b-2, bta-mir-29c, bta-mir-10b, bta-mir-24-2, bta-mir-30a, bta-mir-200b, bta-let-7a-1, bta-mir-342, bta-let-7f-1, bta-let-7a-2, bta-let-7a-3, bta-mir-103-2, bta-mir-125b-2, bta-mir-15a, bta-mir-99b, hsa-mir-664a, ssc-mir-99b, hsa-mir-103b-1, hsa-mir-103b-2, ssc-mir-15a, ssc-mir-16-2, ssc-mir-16-1, bta-mir-141, bta-mir-143, bta-mir-146a, bta-mir-152, bta-mir-155, bta-mir-16a, bta-mir-184, bta-mir-24-1, bta-mir-224, bta-mir-26a-1, bta-mir-296, bta-mir-29d, bta-mir-378-1, bta-mir-451, bta-mir-486, bta-mir-671, bta-mir-29e, bta-mir-29b-1, bta-mir-181a-1, ssc-mir-181a-1, ssc-mir-215, ssc-mir-30a, bta-mir-2318, bta-mir-2339, bta-mir-2430, bta-mir-664a, bta-mir-378-2, ssc-let-7a-1, ssc-mir-378-1, ssc-mir-29a, ssc-mir-30e, ssc-mir-499, ssc-mir-143, ssc-mir-10b, ssc-mir-486-1, ssc-mir-152, ssc-mir-103-2, ssc-mir-181a-2, ssc-mir-27b, ssc-mir-24-2, ssc-mir-99a, ssc-mir-148b, ssc-mir-664, ssc-mir-192, ssc-mir-342, ssc-mir-125b-1, oar-mir-21, oar-mir-29a, oar-mir-125b, oar-mir-181a-1, hsa-mir-378b, hsa-mir-378c, ssc-mir-296, ssc-mir-155, ssc-mir-146a, bta-mir-148c, ssc-mir-126, ssc-mir-378-2, ssc-mir-451, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-451b, hsa-mir-499b, ssc-let-7a-2, ssc-mir-486-2, hsa-mir-664b, hsa-mir-378j, ssc-let-7f-2, ssc-mir-29b-2, ssc-mir-31, ssc-mir-671, bta-mir-378b, bta-mir-378c, hsa-mir-486-2, oar-let-7a, oar-let-7f, oar-mir-103, oar-mir-10b, oar-mir-143, oar-mir-148a, oar-mir-152, oar-mir-16b, oar-mir-181a-2, oar-mir-200a, oar-mir-200b, oar-mir-200c, oar-mir-23a, oar-mir-26a, oar-mir-29b-1, oar-mir-30a, oar-mir-99a, bta-mir-664b, chi-let-7a, chi-let-7f, chi-mir-103, chi-mir-10b, chi-mir-125b, chi-mir-126, chi-mir-141, chi-mir-143, chi-mir-146a, chi-mir-148a, chi-mir-148b, chi-mir-155, chi-mir-15a, chi-mir-15b, chi-mir-16a, chi-mir-16b, chi-mir-184, chi-mir-192, chi-mir-200a, chi-mir-200b, chi-mir-200c, chi-mir-215, chi-mir-21, chi-mir-223, chi-mir-224, chi-mir-2318, chi-mir-23a, chi-mir-24, chi-mir-26a, chi-mir-27b, chi-mir-296, chi-mir-29a, chi-mir-29b, chi-mir-29c, chi-mir-30a, chi-mir-30e, chi-mir-342, chi-mir-378, chi-mir-451, chi-mir-499, chi-mir-671, chi-mir-99a, chi-mir-99b, bta-mir-378d, ssc-mir-378b, oar-mir-29b-2, ssc-mir-141, ssc-mir-200b, ssc-mir-223, bta-mir-148d
Similarly, Naeem et al. (2012) demonstrated a differential regulation of four miRNAs (Bta-miR-181a, miR-16, miR-31, and miR223) in bovine mammary tissue infected with Streptococcus uberis as compared to healthy tissue while Hou et al. (2012) showed that bta-miR-296, miR-2430, and miR-671 were up-regulated and miR-2318 was down-regulated in mammary tissues of cows with mastitis. [score:7]
A differential expression of four immune related miRNAs, miR-125b, miR-155, miR-146a, and miR-223 upon stimulation of bovine monocytes with LPS or Staphylococcus aureus enterotoxin B was demonstrated (Dilda et al., 2012). [score:3]
[1 to 20 of 2 sentences]
11
[+] score: 7
miR-146a-5p, miR-155-5p, miR-147b, and miR-223-3p were downregulated, while miR-182-5p, miR-183-5p, and miR-9-3p were upregulated. [score:7]
[1 to 20 of 1 sentences]
12
[+] score: 6
Other miRNAs from this paper: bta-mir-26a-2, bta-mir-101-2, bta-mir-148a, bta-mir-30d, bta-mir-126, bta-mir-181a-2, bta-mir-27b, bta-mir-30b, bta-mir-142, bta-mir-30e, bta-mir-148b, bta-mir-186, bta-mir-191, bta-mir-22, bta-mir-30a, bta-mir-150, bta-mir-30c, bta-mir-101-1, bta-mir-141, bta-mir-146a, bta-mir-26a-1, bta-mir-30f, bta-mir-181a-1, bta-mir-2284i, bta-mir-2285a, bta-mir-2284s, bta-mir-2285d, bta-mir-2284l, bta-mir-2284j, bta-mir-2284t, bta-mir-2285b-1, bta-mir-2284d, bta-mir-2284n, bta-mir-2284g, bta-mir-2284p, bta-mir-2284u, bta-mir-2284f, bta-mir-2284a, bta-mir-2284k, bta-mir-2284c, bta-mir-2284v, bta-mir-2285c, bta-mir-2284q, bta-mir-2284m, bta-mir-2284b, bta-mir-2284r, bta-mir-2284h, bta-mir-2284o, bta-mir-2284e, bta-mir-1388, bta-mir-2898, bta-mir-2904-1, bta-mir-2904-2, bta-mir-2904-3, bta-mir-2284w, bta-mir-2284x, bta-mir-148c, bta-mir-2284y-1, bta-mir-2285e-1, bta-mir-2285e-2, bta-mir-2285f-1, bta-mir-2285f-2, bta-mir-2285g-1, bta-mir-2285h, bta-mir-2285i, bta-mir-2285j-1, bta-mir-2285j-2, bta-mir-2285k-1, bta-mir-2285l, bta-mir-2285o-1, bta-mir-2285o-2, bta-mir-2285n-1, bta-mir-2285n-2, bta-mir-2285p, bta-mir-2285m-1, bta-mir-2285m-2, bta-mir-2284y-2, bta-mir-2285n-3, bta-mir-2285n-4, bta-mir-2284y-3, bta-mir-2285o-3, bta-mir-2285o-4, bta-mir-2285m-3, bta-mir-2284y-4, bta-mir-2284y-5, bta-mir-2284y-6, bta-mir-2285m-4, bta-mir-2285o-5, bta-mir-2285m-5, bta-mir-2285n-5, bta-mir-2285n-6, bta-mir-2284y-7, bta-mir-2285n-7, bta-mir-2284z-1, bta-mir-2284aa-1, bta-mir-2285k-2, bta-mir-2284z-3, bta-mir-2284aa-2, bta-mir-2284aa-3, bta-mir-2285k-3, bta-mir-2285k-4, bta-mir-2284z-4, bta-mir-2285k-5, bta-mir-2284z-5, bta-mir-2284z-6, bta-mir-2284z-7, bta-mir-2284aa-4, bta-mir-2285q, bta-mir-2285r, bta-mir-2285s, bta-mir-2285t, bta-mir-2285b-2, bta-mir-2285v, bta-mir-2284z-2, bta-mir-2285g-2, bta-mir-2285g-3, bta-mir-2285af-1, bta-mir-2285af-2, bta-mir-2285y, bta-mir-2285w, bta-mir-2285x, bta-mir-2285z, bta-mir-2285u, bta-mir-2285aa, bta-mir-2285ab, bta-mir-2284ab, bta-mir-2285ac, bta-mir-2285ad, bta-mir-2284ac, bta-mir-2285ae, bta-mir-1842, bta-mir-2285ag, bta-mir-2285ah, bta-mir-2285ai, bta-mir-2285aj, bta-mir-2285ak, bta-mir-2285al, bta-mir-2285am, bta-mir-2285ar, bta-mir-2285as-1, bta-mir-2285as-2, bta-mir-2285as-3, bta-mir-2285at-1, bta-mir-2285at-2, bta-mir-2285at-3, bta-mir-2285at-4, bta-mir-2285au, bta-mir-2285av, bta-mir-2285aw, bta-mir-2285ax-1, bta-mir-2285ax-2, bta-mir-2285ax-3, bta-mir-2285ay, bta-mir-2285az, bta-mir-2285an, bta-mir-2285ao-1, bta-mir-2285ao-2, bta-mir-2285ap, bta-mir-2285ao-3, bta-mir-2285aq-1, bta-mir-2285aq-2, bta-mir-2285ba-1, bta-mir-2285ba-2, bta-mir-2285bb, bta-mir-2285bc, bta-mir-2285bd, bta-mir-2285be, bta-mir-2285bf-1, bta-mir-2285bf-2, bta-mir-2285bf-3, bta-mir-2285bg, bta-mir-2285bh, bta-mir-2285bi-1, bta-mir-2285bi-2, bta-mir-2285bj-1, bta-mir-2285bj-2, bta-mir-2285bk, bta-mir-2285bl, bta-mir-2285bm, bta-mir-2285bn, bta-mir-2285bo, bta-mir-2285bp, bta-mir-2285bq, bta-mir-2285br, bta-mir-2285bs, bta-mir-2285bt, bta-mir-2285bu-1, bta-mir-2285bu-2, bta-mir-2285bv, bta-mir-2285bw, bta-mir-2285bx, bta-mir-2285by, bta-mir-2285bz, bta-mir-2285ca, bta-mir-2285cb, bta-mir-2285cc, bta-mir-2285cd, bta-mir-2285ce, bta-mir-2285cf, bta-mir-2285cg, bta-mir-148d, bta-mir-2285ch, bta-mir-2285ci, bta-mir-2285cj, bta-mir-2285ck, bta-mir-2285cl, bta-mir-2285cm, bta-mir-2285cn, bta-mir-2285co, bta-mir-2285cp, bta-mir-2285cq, bta-mir-2285cr-1, bta-mir-2285cr-2, bta-mir-2285cs, bta-mir-2285ct, bta-mir-2285cu, bta-mir-2285cv-1, bta-mir-2285cv-2, bta-mir-2285cw-1, bta-mir-2285cw-2, bta-mir-2285cx, bta-mir-2285cy, bta-mir-2285cz, bta-mir-2285da, bta-mir-2285db, bta-mir-2285dc, bta-mir-2285dd, bta-mir-2285de, bta-mir-2285df, bta-mir-2285dg, bta-mir-2285dh, bta-mir-2285di, bta-mir-2285dj, bta-mir-2285dk, bta-mir-2285dl-1, bta-mir-2285dl-2, bta-mir-2285dm
Beyond its role in response to mammary infection in cattle, miR-223 was also recently reported to regulate granulopoiesis [70]. [score:2]
On the other hand, miR-223 has a potential role in balancing metabolism and immune response during infection [19], as previous bioinformatic analysis provides support for its importance in down -regulating lipid metabolism [66]; a process very important during milk production. [score:2]
For example, we detected increases of bta-miR-142-5p and −223 in milk exosomes 48 h post-infection, while both lactating mammary epithelium [66] and bovine monocytes [19] under infection challenge with S. uberis also were found to increase levels of miR-223. [score:1]
Other reports surveying bovine milk [26, 27] found higher levels of miR-223 in colostrum possibly in support of increased immunity for early neonates or the mammary gland during a period of higher susceptibility (post-partum) to bacterial infection. [score:1]
[1 to 20 of 4 sentences]
13
[+] score: 6
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-27a, hsa-mir-31, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-16-2, hsa-mir-192, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-181a-2, hsa-mir-205, hsa-mir-181a-1, hsa-mir-214, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-146a, hsa-mir-184, hsa-mir-186, hsa-mir-193a, hsa-mir-194-1, hsa-mir-155, hsa-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-219a-2, hsa-mir-99b, hsa-mir-26a-2, hsa-mir-365a, hsa-mir-365b, hsa-mir-374a, hsa-mir-148b, hsa-mir-423, hsa-mir-486-1, hsa-mir-499a, hsa-mir-532, hsa-mir-590, bta-mir-26a-2, bta-let-7f-2, bta-mir-103-1, bta-mir-148a, bta-mir-16b, bta-mir-21, bta-mir-221, bta-mir-222, bta-mir-27a, bta-mir-499, bta-mir-125b-1, bta-mir-181a-2, bta-mir-205, bta-mir-27b, bta-mir-30b, bta-mir-31, bta-mir-193a, bta-let-7d, bta-mir-148b, bta-mir-186, bta-mir-191, bta-mir-192, bta-mir-200a, bta-mir-214, bta-mir-22, bta-mir-23a, bta-mir-29c, bta-mir-423, bta-let-7g, bta-mir-24-2, bta-let-7a-1, bta-mir-532, bta-let-7f-1, bta-mir-30c, bta-let-7i, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-125b-2, bta-mir-365-1, bta-mir-374a, bta-mir-99b, hsa-mir-374b, hsa-mir-664a, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-1915, bta-mir-146a, bta-mir-155, bta-mir-16a, bta-mir-184, bta-mir-24-1, bta-mir-194-2, bta-mir-219-1, bta-mir-26a-1, bta-mir-365-2, bta-mir-374b, bta-mir-486, bta-mir-763, bta-mir-9-1, bta-mir-9-2, bta-mir-181a-1, bta-mir-2284i, bta-mir-2284s, bta-mir-2284l, bta-mir-2284j, bta-mir-2284t, bta-mir-2284d, bta-mir-2284n, bta-mir-2284g, bta-mir-2339, bta-mir-2284p, bta-mir-2284u, bta-mir-2284f, bta-mir-2284a, bta-mir-2284k, bta-mir-2284c, bta-mir-2284v, bta-mir-2284q, bta-mir-2284m, bta-mir-2284b, bta-mir-2284r, bta-mir-2284h, bta-mir-2284o, bta-mir-664a, bta-mir-2284e, bta-mir-1388, bta-mir-194-1, bta-mir-193a-2, bta-mir-2284w, bta-mir-2284x, bta-mir-148c, hsa-mir-374c, hsa-mir-219b, hsa-mir-499b, hsa-mir-664b, bta-mir-2284y-1, bta-mir-2284y-2, bta-mir-2284y-3, bta-mir-2284y-4, bta-mir-2284y-5, bta-mir-2284y-6, bta-mir-2284y-7, bta-mir-2284z-1, bta-mir-2284aa-1, bta-mir-2284z-3, bta-mir-2284aa-2, bta-mir-2284aa-3, bta-mir-2284z-4, bta-mir-2284z-5, bta-mir-2284z-6, bta-mir-2284z-7, bta-mir-2284aa-4, bta-mir-2284z-2, hsa-mir-486-2, hsa-mir-6516, bta-mir-2284ab, bta-mir-664b, bta-mir-6516, bta-mir-219-2, bta-mir-2284ac, bta-mir-219b, bta-mir-374c, bta-mir-148d
A recent study using quantitative real time PCR technique revealed differential expression of five inflammation related miRNAs (miR-9, miR-125b, miR-155, miR-146a and miR-223) after stimulation of bovine monocytes with lipopolysaccharide (LPS) and S. aureus enterotoxin B [22]. [score:3]
Using the same technique, four miRNAs (bta-miR-181a, miR-16, miR-31 and miR-223) out of 14 miRNAs associated with regulation of innate immunity and mammary cell function were shown to be differentially regulated in bovine mammary tissue challenged with Streptococcus uberis (S. uberis) [23]. [score:3]
[1 to 20 of 2 sentences]
14
[+] score: 5
Bta-miR-423-5p which was found to be a whey enriched miRNA by DE analysis showed the highest expression in whey (p < 0.05) while the four cell enriched miRNAs (bta-miR-142-5p, miR-146a, miR-221, miR-223) were most highly expressed in milk cells than in the other two milk fractions (p < 0.05). [score:5]
[1 to 20 of 1 sentences]
15
[+] score: 5
Other miRNAs from this paper: bta-mir-137, bta-mir-155
For example, miR-137 targets the mind bomb-1 ubiquitin ligase in neuronal maturation [43] and miR-223 targets the Fbw7 component of the SCF ubiquitin ligase complex [44]. [score:5]
[1 to 20 of 1 sentences]
16
[+] score: 4
Other miRNAs from this paper: ssc-mir-122, ssc-mir-125b-2, ssc-mir-181b-2, ssc-mir-20a, ssc-mir-23a, ssc-mir-26a, ssc-mir-29b-1, ssc-mir-181c, ssc-mir-214, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-103-1, ssc-mir-107, ssc-mir-21, ssc-mir-29c, ssc-mir-30c-2, bta-mir-26a-2, bta-mir-29a, bta-let-7f-2, bta-mir-103-1, bta-mir-20a, bta-mir-21, bta-mir-26b, bta-mir-30d, bta-mir-499, bta-mir-99a, bta-mir-125b-1, bta-mir-126, bta-mir-181a-2, bta-mir-199a-1, bta-mir-30b, bta-mir-107, bta-mir-10a, bta-mir-127, bta-mir-142, bta-mir-181b-2, bta-mir-30e, bta-mir-92a-2, bta-let-7d, bta-mir-132, bta-mir-138-2, bta-mir-17, bta-mir-181c, bta-mir-192, bta-mir-199b, bta-mir-200a, bta-mir-200c, bta-mir-214, bta-mir-23a, bta-mir-29b-2, bta-mir-29c, bta-mir-455, bta-let-7g, bta-mir-10b, bta-mir-30a, bta-mir-200b, bta-let-7a-1, bta-let-7f-1, bta-mir-122, bta-mir-30c, bta-let-7i, bta-mir-25, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-125b-2, bta-mir-99b, ssc-mir-99b, ssc-mir-17, ssc-mir-30b, ssc-mir-199b, bta-mir-1-2, bta-mir-1-1, bta-mir-129-1, bta-mir-129-2, bta-mir-133a-2, bta-mir-133a-1, bta-mir-133b, bta-mir-135b, bta-mir-138-1, bta-mir-143, bta-mir-144, bta-mir-146b, bta-mir-146a, bta-mir-181d, bta-mir-190a, bta-mir-199a-2, bta-mir-202, bta-mir-206, bta-mir-211, bta-mir-212, bta-mir-26a-1, bta-mir-29d, bta-mir-30f, bta-mir-338, bta-mir-33a, bta-mir-33b, bta-mir-375, bta-mir-429, bta-mir-451, bta-mir-92a-1, bta-mir-92b, bta-mir-29e, bta-mir-29b-1, bta-mir-181a-1, bta-mir-181b-1, ssc-mir-133a-1, ssc-mir-1, ssc-mir-146b, ssc-mir-181a-1, ssc-mir-30a, bta-mir-199c, ssc-mir-206, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-133b, ssc-mir-29a, ssc-mir-30d, ssc-mir-30e, ssc-mir-199a-2, ssc-mir-499, ssc-mir-143, ssc-mir-10a, ssc-mir-10b, ssc-mir-103-2, ssc-mir-181a-2, ssc-mir-181b-1, ssc-mir-181d, ssc-mir-99a, ssc-mir-92a-2, ssc-mir-92a-1, ssc-mir-92b, ssc-mir-192, ssc-mir-142, ssc-mir-127, ssc-mir-202, ssc-mir-129a, ssc-mir-455, ssc-mir-125b-1, ssc-mir-338, ssc-mir-133a-2, ssc-mir-146a, bta-mir-26c, ssc-mir-30c-1, ssc-mir-126, ssc-mir-199a-1, ssc-mir-451, ssc-let-7a-2, ssc-mir-129b, ssc-mir-429, ssc-let-7d, ssc-let-7f-2, ssc-mir-29b-2, ssc-mir-132, ssc-mir-138, ssc-mir-144, ssc-mir-190a, ssc-mir-212, bta-mir-133c, ssc-mir-26b, ssc-mir-200b, ssc-mir-223, ssc-mir-375, ssc-mir-33b
In comparison to other approaches, however, using metabolic alterations, Wang D. et al. (2017) showed that miR-223-3p promotes upregulation of pou1f1, a key transcription factor related to somatic growth in Nile tilapia. [score:4]
[1 to 20 of 1 sentences]
17
[+] score: 4
A study by Dilda et al. challenging bovine monocytes with E. coli LPS revealed the upregulation of miR-9, miR-125b, miR-155, miR-146a, and miR-223. [score:4]
[1 to 20 of 1 sentences]
18
[+] score: 4
Subsequently, we analyzed miRNA content and found a number of immune-related miRNAs expressed in these vesicles, including miR-21, miR-30a, miR-92a, miR-99a and miR-223 (Fig 1e). [score:3]
Sequence bta-miR-21 MI0004742 AUGCUUAUCAGACUGAUGUUGACU bta-miR-30a MI0005054 UGUAAACAUCCUCGACUGGAAGC bta-miR-92a MI0009905 UAUUGCACUUCUGGGCCGGUCU bta-miR-99a MI0004751 AACCCGUAGAUCCGAUCUUGU bta-miR-223 MI0009782 UGUCAGUUUGUCAAAUACCCCA Bovine milk-derived EVs were isolated as described above. [score:1]
[1 to 20 of 2 sentences]
19
[+] score: 3
The miRNAs which were most abundant in plasma (Fig 3B) in our experiment are reportedly expressed at high levels in blood cells, including erythrocytes (miR-451, miR-16b), leukocytes (miR-150, miR-27a, miR-23a) and thrombocytes (miR-223, miR-20a, miR-24) and are putatively released into the plasma through apoptosis, lysis or active shedding [41, 42, 14]. [score:3]
[1 to 20 of 1 sentences]
20
[+] score: 3
Other miRNAs from this paper: bta-mir-143
Also the dampener of inflammasome formation mir223 [35] and the inhibitor of NF-κB p65 phosphorylation NR4A1 [36] have only been induced during the E. coli infection. [score:3]
[1 to 20 of 1 sentences]
21
[+] score: 3
Other miRNAs from this paper: bta-mir-26a-2, bta-mir-29a, bta-let-7f-2, bta-mir-151, bta-mir-21, bta-mir-27a, bta-mir-125b-1, bta-mir-205, bta-mir-27b, bta-mir-193a, bta-mir-98, bta-let-7d, bta-mir-17, bta-mir-200a, bta-mir-200c, bta-mir-210, bta-mir-29b-2, bta-mir-29c, bta-let-7g, bta-mir-200b, bta-let-7a-1, bta-mir-150, bta-let-7f-1, bta-let-7i, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-125b-2, bta-mir-15a, bta-mir-100, bta-mir-130a, bta-mir-146a, bta-mir-155, bta-mir-184, bta-mir-219-1, bta-mir-28, bta-mir-494, bta-mir-708, bta-mir-9-1, bta-mir-9-2, bta-mir-29e, bta-mir-29b-1, bta-mir-2284i, bta-mir-2285a, bta-mir-2284s, bta-mir-2285d, bta-mir-2284l, bta-mir-2284j, bta-mir-2284t, bta-mir-2285b-1, bta-mir-2284d, bta-mir-2284n, bta-mir-2284g, bta-mir-2284p, bta-mir-2284u, bta-mir-2284f, bta-mir-2284a, bta-mir-2284k, bta-mir-2284c, bta-mir-2284v, bta-mir-2285c, bta-mir-2284q, bta-mir-2284m, bta-mir-2284b, bta-mir-2284r, bta-mir-2284h, bta-mir-2284o, bta-mir-664a, bta-mir-2284e, bta-mir-2284w, bta-mir-2284x, bta-mir-3596, bta-mir-652, bta-mir-2284y-1, bta-mir-2285e-1, bta-mir-2285e-2, bta-mir-2285f-1, bta-mir-2285f-2, bta-mir-2285g-1, bta-mir-2285h, bta-mir-2285i, bta-mir-2285j-1, bta-mir-2285j-2, bta-mir-2285k-1, bta-mir-2285l, bta-mir-2285o-1, bta-mir-2285o-2, bta-mir-2285n-1, bta-mir-2285n-2, bta-mir-2285p, bta-mir-2285m-1, bta-mir-2285m-2, bta-mir-2284y-2, bta-mir-2285n-3, bta-mir-2285n-4, bta-mir-2284y-3, bta-mir-2285o-3, bta-mir-2285o-4, bta-mir-2285m-3, bta-mir-2284y-4, bta-mir-2284y-5, bta-mir-2284y-6, bta-mir-2285m-4, bta-mir-2285o-5, bta-mir-2285m-5, bta-mir-2285n-5, bta-mir-2285n-6, bta-mir-2284y-7, bta-mir-2285n-7, bta-mir-2284z-1, bta-mir-2284aa-1, bta-mir-2285k-2, bta-mir-2284z-3, bta-mir-2284aa-2, bta-mir-2284aa-3, bta-mir-2285k-3, bta-mir-2285k-4, bta-mir-2284z-4, bta-mir-2285k-5, bta-mir-2284z-5, bta-mir-2284z-6, bta-mir-2284z-7, bta-mir-2284aa-4, bta-mir-2285q, bta-mir-2285r, bta-mir-2285s, bta-mir-2285t, bta-mir-2285b-2, bta-mir-2285v, bta-mir-2284z-2, bta-mir-2285g-2, bta-mir-2285g-3, bta-mir-2285af-1, bta-mir-2285af-2, bta-mir-2285y, bta-mir-2285w, bta-mir-2285x, bta-mir-2285z, bta-mir-2285u, bta-mir-2285aa, bta-mir-2285ab, bta-mir-2284ab, bta-mir-664b, bta-mir-2285ac, bta-mir-2285ad, bta-mir-2284ac, bta-mir-2285ae, bta-mir-2285ag, bta-mir-2285ah, bta-mir-2285ai, bta-mir-2285aj, bta-mir-2285ak, bta-mir-2285al, bta-mir-2285am, bta-mir-2285ar, bta-mir-2285as-1, bta-mir-2285as-2, bta-mir-2285as-3, bta-mir-2285at-1, bta-mir-2285at-2, bta-mir-2285at-3, bta-mir-2285at-4, bta-mir-2285au, bta-mir-2285av, bta-mir-2285aw, bta-mir-2285ax-1, bta-mir-2285ax-2, bta-mir-2285ax-3, bta-mir-2285ay, bta-mir-2285az, bta-mir-2285an, bta-mir-2285ao-1, bta-mir-2285ao-2, bta-mir-2285ap, bta-mir-2285ao-3, bta-mir-2285aq-1, bta-mir-2285aq-2, bta-mir-2285ba-1, bta-mir-2285ba-2, bta-mir-2285bb, bta-mir-2285bc, bta-mir-2285bd, bta-mir-2285be, bta-mir-2285bf-1, bta-mir-2285bf-2, bta-mir-2285bf-3, bta-mir-2285bg, bta-mir-2285bh, bta-mir-2285bi-1, bta-mir-2285bi-2, bta-mir-2285bj-1, bta-mir-2285bj-2, bta-mir-2285bk, bta-mir-2285bl, bta-mir-2285bm, bta-mir-2285bn, bta-mir-2285bo, bta-mir-2285bp, bta-mir-2285bq, bta-mir-2285br, bta-mir-2285bs, bta-mir-2285bt, bta-mir-2285bu-1, bta-mir-2285bu-2, bta-mir-2285bv, bta-mir-2285bw, bta-mir-2285bx, bta-mir-2285by, bta-mir-2285bz, bta-mir-2285ca, bta-mir-2285cb, bta-mir-2285cc, bta-mir-2285cd, bta-mir-2285ce, bta-mir-2285cf, bta-mir-2285cg, bta-mir-2285ch, bta-mir-2285ci, bta-mir-2285cj, bta-mir-2285ck, bta-mir-2285cl, bta-mir-2285cm, bta-mir-2285cn, bta-mir-2285co, bta-mir-2285cp, bta-mir-2285cq, bta-mir-2285cr-1, bta-mir-2285cr-2, bta-mir-2285cs, bta-mir-2285ct, bta-mir-2285cu, bta-mir-2285cv-1, bta-mir-2285cv-2, bta-mir-2285cw-1, bta-mir-2285cw-2, bta-mir-2285cx, bta-mir-2285cy, bta-mir-2285cz, bta-mir-2285da, bta-mir-2285db, bta-mir-2285dc, bta-mir-2285dd, bta-mir-2285de, bta-mir-2285df, bta-mir-2285dg, bta-mir-2285dh, bta-mir-2285di, bta-mir-2285dj, bta-mir-2285dk, bta-mir-2285dl-1, bta-mir-2285dl-2, bta-mir-2285dm
A recent RT-qPCR study, for example, highlighted the differential expression of five inflammation related miRNAs (miR-9, miR-125b, miR-155, miR-146a and miR-223) in response to E. coli lipopolysaccharide (LPS) and S. aureus enterotoxin B stimulation of bovine monocytes [10]. [score:3]
[1 to 20 of 1 sentences]
22
[+] score: 3
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-27a, hsa-mir-31, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-101-1, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-16-2, hsa-mir-192, hsa-mir-199a-1, hsa-mir-30c-2, hsa-mir-199a-2, hsa-mir-223, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-125b-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-140, hsa-mir-141, hsa-mir-152, hsa-mir-191, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-149, hsa-mir-150, hsa-mir-320a, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-101-2, hsa-mir-99b, hsa-mir-26a-2, hsa-mir-379, hsa-mir-423, hsa-mir-451a, hsa-mir-486-1, hsa-mir-496, hsa-mir-520a, hsa-mir-525, hsa-mir-518b, hsa-mir-516b-2, hsa-mir-516b-1, hsa-mir-516a-1, hsa-mir-516a-2, hsa-mir-92b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, bta-mir-26a-2, bta-let-7f-2, bta-mir-101-2, bta-mir-103-1, bta-mir-16b, bta-mir-20a, bta-mir-21, bta-mir-27a, bta-mir-320a-2, bta-mir-125a, bta-mir-125b-1, bta-mir-199a-1, bta-mir-31, bta-mir-140, bta-mir-92a-2, bta-let-7d, bta-mir-132, bta-mir-191, bta-mir-192, bta-mir-22, bta-mir-23a, bta-mir-29c, bta-mir-423, bta-let-7g, bta-mir-24-2, bta-let-7a-1, bta-mir-150, bta-let-7f-1, bta-mir-30c, bta-let-7i, bta-mir-23b, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-125b-2, bta-mir-99b, hsa-mir-1249, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, bta-mir-101-1, bta-mir-133a-2, bta-mir-133a-1, bta-mir-141, bta-mir-152, bta-mir-16a, bta-mir-24-1, bta-mir-199a-2, bta-mir-26a-1, bta-mir-379, bta-mir-451, bta-mir-486, bta-mir-496, bta-mir-92a-1, bta-mir-92b, bta-mir-1249, bta-mir-320b, bta-mir-320a-1, hsa-mir-320e, hsa-mir-23c, hsa-mir-451b, bta-mir-149, hsa-mir-486-2
We detected a total of 208 miRNAs in bovine plasma (based on mean Cq < 35 across all sample pools; Fig.   4a), the most abundant of which (Fig.   4b) corresponded to miRNAs reportedly expressed at high levels in blood cells including erythrocytes (miR-451, miR-486, miR-16), leukocytes (miR-150, miR-27a, miR-23a) and thrombocytes (miR-223, miR-20a, miR-24), and which are putatively released into the plasma through apoptosis, lysis or active secretion [36– 38]. [score:3]
[1 to 20 of 1 sentences]
23
[+] score: 2
Neudecker V Myeloid-derived miR-223 regulates intestinal inflammation via repression of the NLRP3 inflammasomeJ. [score:2]
[1 to 20 of 1 sentences]
24
[+] score: 2
miR-193a-5p is involved in the endometrial and oocyte development [53, 70] and miR-223 and miR-125a have been found in extracellular uterine fluid vesicles [54]. [score:2]
[1 to 20 of 1 sentences]
25
[+] score: 1
Recently, 200–300 nm large, miRNA-223- and miRNA-125b-enriched EVs have been demonstrated in cow’s milk that also resist digestion under simulated gastrointestinal tract conditions [66]. [score:1]
[1 to 20 of 1 sentences]
26
[+] score: 1
Eight miRNAs (miR-15a-5p, miR-17-5p, miR-20a-5p, miR-33a-3p, miR-126-3p, miR-181a-5p, miR-142-5p and miR-223-3p; Supplementary S1 Table) were chosen for further study on the basis of their ranking and their function highlighted in the literature. [score:1]
[1 to 20 of 1 sentences]
27
[+] score: 1
# 4427975: hsa-miR-1-3p (002222), hsa-miR-16-5p (000391), hsa-miR-125b-5p (000449), hsa-miR-223-3p (002295), hsa-miR-29b-3p (000413), ath-MIR156a (000333), ath-MIR166a (000347), and cel-miR-39 (000200); and ath-MIR167a (000348) under "Made to Order" Cat. [score:1]
[1 to 20 of 1 sentences]
28
[+] score: 1
Other miRNAs from this paper: hsa-mir-17, hsa-mir-28, hsa-mir-223, hsa-mir-127, hsa-mir-188, hsa-mir-194-1, hsa-mir-155, hsa-mir-194-2, hsa-mir-30e, hsa-mir-362, hsa-mir-363, hsa-mir-367, hsa-mir-379, hsa-mir-196b, hsa-mir-450a-1, hsa-mir-431, ssc-mir-28, hsa-mir-493, hsa-mir-512-1, hsa-mir-512-2, hsa-mir-500a, hsa-mir-501, hsa-mir-502, hsa-mir-450a-2, hsa-mir-513a-1, hsa-mir-513a-2, hsa-mir-506, hsa-mir-508, hsa-mir-509-1, hsa-mir-532, hsa-mir-615, hsa-mir-660, bta-mir-127, bta-mir-30e, bta-mir-17, bta-mir-450a-2, bta-mir-532, bta-mir-363, bta-mir-660, hsa-mir-891a, hsa-mir-892a, hsa-mir-509-2, hsa-mir-450b, hsa-mir-892b, hsa-mir-708, hsa-mir-509-3, hsa-mir-1285-1, hsa-mir-1285-2, hsa-mir-1248, ssc-mir-17, bta-mir-155, bta-mir-188, bta-mir-194-2, bta-mir-196b, bta-mir-28, bta-mir-362, bta-mir-367, bta-mir-379, bta-mir-431, bta-mir-493, bta-mir-500, bta-mir-502a-1, bta-mir-502a-2, bta-mir-502b, bta-mir-615, bta-mir-708, bta-mir-1248-1, bta-mir-1248-2, ssc-mir-450a, bta-mir-2320, bta-mir-1388, bta-mir-194-1, bta-mir-450a-1, eca-mir-30e, eca-mir-367, eca-mir-684, eca-mir-196b, eca-mir-615, eca-mir-708, eca-mir-194-1, eca-mir-493a, eca-mir-17, eca-mir-1248, eca-mir-28, eca-mir-127, eca-mir-379, eca-mir-431, eca-mir-493b, eca-mir-155, eca-mir-194-2, eca-mir-188, eca-mir-223, eca-mir-362, eca-mir-363, eca-mir-450a, eca-mir-450b, eca-mir-450c, eca-mir-500-1, eca-mir-500-2, eca-mir-501, eca-mir-502, eca-mir-508, eca-mir-509a, eca-mir-532, eca-mir-660, ssc-mir-30e, ssc-mir-196b-1, ssc-mir-450b, ssc-mir-127, ssc-mir-532, ssc-mir-708, ssc-mir-1285, ssc-mir-500, hsa-mir-514b, ssc-mir-363-1, ssc-mir-450c, hsa-mir-500b, ssc-mir-194b, ssc-mir-155, ssc-mir-362, bta-mir-3601, ssc-mir-615, ssc-mir-2320, bta-mir-450b, ssc-mir-194a, ssc-mir-196b-2, ssc-mir-363-2, ssc-mir-493, hsa-mir-892c, eca-mir-1388, eca-mir-514b, eca-mir-506a, eca-mir-509b, bta-mir-194b, ssc-mir-1388, ssc-mir-223, ssc-mir-660, bta-mir-194b-2, bta-mir-1949
And amongst these examples we find 2 miRNAs that are missed by both high confident BLAST and miRDeep, but identifies the read profile as miRNA like, and low confident BLAST identifies the miRNAs as mir-223 and mir-431. [score:1]
[1 to 20 of 1 sentences]