sort by

2 publications mentioning bta-mir-340

Open access articles that are associated with the species Bos taurus and mention the gene name mir-340. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

[+] score: 3
This identified non-annotated 5p or 3p variants of four miRNAs; miR-224-3p, miR-324-3p, miR-340-5p and miR-542-3p (Table  1 and Supplementary Fig.   S2b). [score:1]
miRNA Current annotation Sequence from this data set Sequence count bta-miR-224-3p Only 5p annotated CAAAATGGTACCCTAGTGACT 443 bta-miR-324-3p Only 5p annotated CCACTGCCCCAGGTGCTGCTGG 652 bta-miR-340-5p Only 3p annotated TTATAAAGCAATGAGACTGA 669 bta-miR-542-3p Only 5p annotated TGTGACAGATTGATAACTGAA 475 For bta-miR-340-5p and bta-miR-542-3p, despite lack of annotation, a deep sequencing profile consistent with what is reported here is presented in miRbase. [score:1]
Here, we used this to define the bovine miRNAs, miR-224-3p, miR-324-3p, miR-340-5p and miR-542-3p, not previously registered in miRBase [17]. [score:1]
[1 to 20 of 3 sentences]
[+] score: 1
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-32, hsa-mir-33a, hsa-mir-99a, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, mmu-let-7g, mmu-let-7i, mmu-mir-15b, mmu-mir-99a, mmu-mir-126a, mmu-mir-128-1, mmu-mir-130a, mmu-mir-140, mmu-mir-154, mmu-mir-204, mmu-mir-143, hsa-mir-204, hsa-mir-211, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-222, hsa-mir-223, mmu-mir-301a, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-128-1, hsa-mir-130a, hsa-mir-140, hsa-mir-143, hsa-mir-126, hsa-mir-129-2, hsa-mir-154, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-26a-1, mmu-mir-26b, mmu-mir-29a, mmu-mir-29c, mmu-mir-27a, mmu-mir-129-2, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-340, mmu-mir-107, mmu-mir-32, mmu-mir-218-1, mmu-mir-218-2, mmu-mir-223, mmu-mir-26a-2, mmu-mir-211, mmu-mir-222, mmu-mir-128-2, hsa-mir-128-2, hsa-mir-29c, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-26a-2, hsa-mir-379, mmu-mir-379, hsa-mir-340, mmu-mir-409, hsa-mir-409, hsa-mir-499a, hsa-mir-455, hsa-mir-670, mmu-mir-1249, mmu-mir-670, mmu-mir-499, mmu-mir-455, bta-mir-26a-2, bta-mir-29a, bta-let-7f-2, bta-mir-101-2, bta-mir-103-1, bta-mir-16b, bta-mir-222, bta-mir-26b, bta-mir-27a, bta-mir-499, bta-mir-99a, bta-mir-126, bta-mir-128-1, bta-mir-34b, bta-mir-107, bta-mir-140, bta-mir-15b, bta-mir-218-2, bta-let-7d, bta-mir-29c, bta-mir-455, bta-let-7g, bta-let-7a-1, bta-let-7f-1, bta-let-7i, bta-mir-34c, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-204, hsa-mir-1249, hsa-mir-1306, hsa-mir-103b-1, hsa-mir-103b-2, bta-mir-128-2, bta-mir-129-2, bta-mir-130a, bta-mir-143, bta-mir-154a, bta-mir-211, bta-mir-218-1, bta-mir-223, bta-mir-26a-1, bta-mir-301a, bta-mir-32, bta-mir-33a, bta-mir-379, bta-mir-409a, bta-mir-670, mmu-mir-1306, bta-mir-1306, bta-mir-1249, bta-mir-2284i, bta-mir-2285a, bta-mir-2284s, bta-mir-2285d, bta-mir-2284l, bta-mir-2284j, bta-mir-2284t, bta-mir-2285b-1, bta-mir-2284d, bta-mir-2284n, bta-mir-2284g, bta-mir-2284p, bta-mir-2284u, bta-mir-2284f, bta-mir-2284a, bta-mir-2284k, bta-mir-2284c, bta-mir-2284v, bta-mir-2285c, bta-mir-2284q, bta-mir-2284m, bta-mir-2284b, bta-mir-2284r, bta-mir-2284h, bta-mir-2284o, bta-mir-2284e, hsa-mir-1260b, bta-mir-2284w, bta-mir-2284x, bta-mir-409b, hsa-mir-499b, bta-mir-1260b, bta-mir-2284y-1, bta-mir-2285e-1, bta-mir-2285e-2, bta-mir-2285f-1, bta-mir-2285f-2, bta-mir-2285g-1, bta-mir-2285h, bta-mir-2285i, bta-mir-2285j-1, bta-mir-2285j-2, bta-mir-2285k-1, bta-mir-2285l, bta-mir-6119, mmu-let-7j, bta-mir-2285o-1, bta-mir-2285o-2, bta-mir-2285n-1, bta-mir-2285n-2, bta-mir-2285p, bta-mir-2285m-1, bta-mir-2285m-2, bta-mir-2284y-2, bta-mir-2285n-3, bta-mir-2285n-4, bta-mir-2284y-3, bta-mir-154c, bta-mir-154b, bta-mir-2285o-3, bta-mir-2285o-4, bta-mir-2285m-3, bta-mir-2284y-4, bta-mir-2284y-5, bta-mir-2284y-6, bta-mir-2285m-4, bta-mir-2285o-5, bta-mir-2285m-5, bta-mir-2285n-5, bta-mir-2285n-6, bta-mir-2284y-7, bta-mir-2285n-7, bta-mir-2284z-1, bta-mir-2284aa-1, bta-mir-2285k-2, bta-mir-2284z-3, bta-mir-2284aa-2, bta-mir-2284aa-3, bta-mir-2285k-3, bta-mir-2285k-4, bta-mir-2284z-4, bta-mir-2285k-5, bta-mir-2284z-5, bta-mir-2284z-6, bta-mir-2284z-7, bta-mir-2284aa-4, bta-mir-2285q, bta-mir-2285r, bta-mir-2285s, bta-mir-2285t, bta-mir-2285b-2, bta-mir-2285v, bta-mir-2284z-2, mmu-let-7k, mmu-mir-126b, bta-mir-2285g-2, bta-mir-2285g-3, bta-mir-2285af-1, bta-mir-2285af-2, bta-mir-2285y, bta-mir-2285w, bta-mir-2285x, bta-mir-2285z, bta-mir-2285u, bta-mir-2285aa, bta-mir-2285ab, bta-mir-2284ab, bta-mir-2285ac, bta-mir-2285ad, bta-mir-2284ac, bta-mir-2285ae, chi-let-7a, chi-let-7b, chi-let-7c, chi-let-7d, chi-let-7e, chi-let-7f, chi-let-7g, chi-let-7i, chi-mir-103, chi-mir-107, chi-mir-1249, chi-mir-126, chi-mir-1306, chi-mir-130a, chi-mir-140, chi-mir-143, chi-mir-154a, chi-mir-154b, chi-mir-15b, chi-mir-16b, chi-mir-204, chi-mir-211, chi-mir-222, chi-mir-223, chi-mir-2284a, chi-mir-2284b, chi-mir-2284c, chi-mir-2284d, chi-mir-2284e, chi-mir-26a, chi-mir-26b, chi-mir-27a, chi-mir-29a, chi-mir-29c, chi-mir-301a, chi-mir-33a, chi-mir-340, chi-mir-34b, chi-mir-34c, chi-mir-379, chi-mir-409, chi-mir-455, chi-mir-499, chi-mir-99a, bta-mir-2285ag, bta-mir-2285ah, bta-mir-2285ai, bta-mir-2285aj, bta-mir-2285ak, bta-mir-2285al, bta-mir-2285am, bta-mir-2285ar, bta-mir-2285as-1, bta-mir-2285as-2, bta-mir-2285as-3, bta-mir-2285at-1, bta-mir-2285at-2, bta-mir-2285at-3, bta-mir-2285at-4, bta-mir-2285au, bta-mir-2285av, bta-mir-2285aw, bta-mir-2285ax-1, bta-mir-2285ax-2, bta-mir-2285ax-3, bta-mir-2285ay, bta-mir-2285az, bta-mir-2285an, bta-mir-2285ao-1, bta-mir-2285ao-2, bta-mir-2285ap, bta-mir-2285ao-3, bta-mir-2285aq-1, bta-mir-2285aq-2, bta-mir-2285ba-1, bta-mir-2285ba-2, bta-mir-2285bb, bta-mir-2285bc, bta-mir-2285bd, bta-mir-2285be, bta-mir-2285bf-1, bta-mir-2285bf-2, bta-mir-2285bf-3, bta-mir-2285bg, bta-mir-2285bh, bta-mir-2285bi-1, bta-mir-2285bi-2, bta-mir-2285bj-1, bta-mir-2285bj-2, bta-mir-2285bk, bta-mir-2285bl, bta-mir-2285bm, bta-mir-2285bn, bta-mir-2285bo, bta-mir-2285bp, bta-mir-2285bq, bta-mir-2285br, bta-mir-2285bs, bta-mir-2285bt, bta-mir-2285bu-1, bta-mir-2285bu-2, bta-mir-2285bv, bta-mir-2285bw, bta-mir-2285bx, bta-mir-2285by, bta-mir-2285bz, bta-mir-2285ca, bta-mir-2285cb, bta-mir-2285cc, bta-mir-2285cd, bta-mir-2285ce, bta-mir-2285cf, bta-mir-2285cg, bta-mir-2285ch, bta-mir-2285ci, bta-mir-2285cj, bta-mir-2285ck, bta-mir-2285cl, bta-mir-2285cm, bta-mir-2285cn, bta-mir-2285co, bta-mir-2285cp, bta-mir-2285cq, bta-mir-2285cr-1, bta-mir-2285cr-2, bta-mir-2285cs, bta-mir-2285ct, bta-mir-2285cu, bta-mir-2285cv-1, bta-mir-2285cv-2, bta-mir-2285cw-1, bta-mir-2285cw-2, bta-mir-2285cx, bta-mir-2285cy, bta-mir-2285cz, bta-mir-2285da, bta-mir-2285db, bta-mir-2285dc, bta-mir-2285dd, bta-mir-2285de, bta-mir-2285df, bta-mir-2285dg, bta-mir-2285dh, bta-mir-2285di, bta-mir-2285dj, bta-mir-2285dk, bta-mir-2285dl-1, bta-mir-2285dl-2, bta-mir-2285dm
Furthermore, on BTA 7, mir-340 was only found in QTL associated with milk fat. [score:1]
[1 to 20 of 1 sentences]