sort by

27 publications mentioning bta-mir-486

Open access articles that are associated with the species Bos taurus and mention the gene name mir-486. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 319
Other miRNAs from this paper: bta-mir-126, bta-mir-15a, bta-mir-212
For example, miR-486 represses the development of pancreatic ductal adenocarcinomas by inhibiting the expression the gene CD40 [11], inhibits SIRT1 deacetylase activity in human adipose tissue-derived mesenchymal stem cells [12], stimulates muscle myoblast differentiation by downregulating Pax7 [13], and downregulating PTEN (phosphatase and tensin homolog) and Foxo1a in muscle cells [14]. [score:14]
The overexpression of miR-486 inhibited the expression of PTEN both at the mRNA and protein levels and thus increased the levels of AKT, phosphorylated AKT, mTOR and phosphorylated mTOR. [score:7]
A: Secretion of triglyceride following overexpressive miR-486, compared with negative control (miR-NC); B: Secretion of triglyceride following inhibiting miR-486, compared with negative control (Anti-NC); C: Secretion of β-casein following overexpressive miR-486, compared with negative control (miR-NC); D: Secretion of β-casein following inhibiting miR-486, compared with negative control (Anti-NC); E: Secretion of lactose following overexpressive miR-486, compared with negative control (miR-NC); F: Secretion of lactose following inhibiting miR-486, compared with negative control (Anti-NC). [score:7]
Expression of AKT and mTOR after the over -expression and inhibition of miR-486 in BMECs. [score:7]
0118284.g007 Fig 7A: Secretion of triglyceride following overexpressive miR-486, compared with negative control (miR-NC); B: Secretion of triglyceride following inhibiting miR-486, compared with negative control (Anti-NC); C: Secretion of β-casein following overexpressive miR-486, compared with negative control (miR-NC); D: Secretion of β-casein following inhibiting miR-486, compared with negative control (Anti-NC); E: Secretion of lactose following overexpressive miR-486, compared with negative control (miR-NC); F: Secretion of lactose following inhibiting miR-486, compared with negative control (Anti-NC). [score:7]
The overexpression of miR-486 increased the concentrations of triglycerides, β-casein and lactose (Fig. 7 A, 7 C, and 7 E, P<0.0001; P<0.0001; P<0.001); conversely, inhibition of miR-486 suppressed the concentrations of triglycerides, β-casein and lactose (Fig. 7 B, 7 D, and 7 F, P<0.0001). [score:7]
To assess whether miR-486 affects the proliferation of bovine mammary epithelial cells, these cells were transfected with miR-486 mimics/inhibitor and analyzed using CCK-8 assays after 48 h. We measured the proliferation rate of the miR-486 mimics group and the miR-486 inhibitor group; miR-486 mimics increased the ability of the cells to proliferate, and the miR-486 inhibitor suppressed the ability of the cells to proliferate (Fig. 5 A). [score:6]
Here we suppose that miR-486 regulates expression of cytoplasmic PTEN, PTEN shift from cellular towards nuclear in mammary epithelial cells increase AKT/ MTOR pathway, and regulate mammary epithelial cells secretion of β-casein, triglyceride, and lactose, and plays a critical role in lactation related signaling pathways. [score:5]
A high expression of miR-486 repressed the expression of PTEN in mammary epithelium cell nuclei. [score:5]
After the overexpression and inhibition of miR-486, the cell lysates were separated on a 10% SDS-PAGE gel (30 μg protein per sample), and the proteins were then transferred onto nitrocellulose membranes (Bio-Rad, Shanghai, China). [score:5]
0118284.g004 Fig 4A: mRNA level of AKT and mTOR after treatment with miR-486 mimics and negative control (miR-NC) in BMECs; B: mRNA level of AKT and mTOR during treatment with miR-486 inhibitors and negative control (Anti-NC) in BMECs; C: Protein level of AKT, p-AKT, mTOR and p-mTOR after transfected with miR-486 mimics and negative control (miR-NC) in BMECs; D: mRNA level of AKT and mTOR during treatment with miR-486 inhibitors and negative control (Anti-NC) in BMECs. [score:5]
B: qRT-PCR analysis of miR-486 expression in BMECs after treatment with miR-486 inhibitors or the negative control (Anti-NC). [score:5]
We found that the level of miR-486 changed concomitantly with the mRNA level of PTEN and that miR-486 inhibited the expression of PTEN (Fig. 3 C, Fig. 3 E, P<0.0001). [score:5]
We assessed the expression of PTEN after treatment with miR-486 mimics/inhibitors in BMECs using immunohistochemistry. [score:5]
A: mRNA level of AKT and mTOR after treatment with miR-486 mimics and negative control (miR-NC) in BMECs; B: mRNA level of AKT and mTOR during treatment with miR-486 inhibitors and negative control (Anti-NC) in BMECs; C: Protein level of AKT, p-AKT, mTOR and p-mTOR after transfected with miR-486 mimics and negative control (miR-NC) in BMECs; D: mRNA level of AKT and mTOR during treatment with miR-486 inhibitors and negative control (Anti-NC) in BMECs. [score:5]
The relative protein expression of AKT, phospho-AKT (p-AKT), MTOR, and phospho-MTOR (p-MTOR) increased as the expression of miR-486 was increased (Fig. 4 C, P<0.0001). [score:5]
Bovine mammary epithelial cells overexpressing miR-486 had decreased PTEN expression in their nuclei; however, BMECs lacking miR-486 had increased PTEN levels. [score:5]
F: Western blotting analysis of PTEN protein expression in BMECs after treatment with miR-486 inhibitors or negative control (Anti-NC). [score:5]
Using the prediction software TargetScan6.2, we found that miR-486 target sites are present at nt 725–732 and nt 3,183–3,190 of the PTEN 3′UTR; these two sites are conserved in mammals. [score:5]
In situ hybridization using a DIG-labeled locked nucleic acid probe against miR-486 revealed that miR-486 was primarily expressed in bovine mammary glandular epithelium tissue (Fig. 1A: H-a, L-a, P-a) and was not expressed in bovine mammary adipose tissue (Fig. 1A: H-c, L-c, P-c). [score:5]
Transfecting BMECs with a miR-486 inhibitor increased the expression of PTEN (Fig. 3 D, P<0.01; Fig. 3F, P<0.0001). [score:5]
MiR-486 inhibited the expression of PTEN, and as same time cytoplasmic PTEN cellular staining towards nuclear staining, for PTEN/AKT/MTOR pathway plays prominent roles in development and lactation of mammary gland [26]. [score:5]
G: Confocal microscopy analysis of PTEN expression in BMECs after treatment with miR-486 mimics (30 μM), negative control (miR-NC) (30 μM), miR-486 inhibitors (30 μM), or negative control (Anti-NC) (20 μM). [score:5]
D: qRT-PCR analysis of PTEN expression in BMECs after treatment with miR-486 inhibitors or negative control (Anti-NC). [score:5]
We found that the expression of miR-486 increased after treatment with miR-486 mimics (Fig. 3 A, P<0.0001) and decreased after treatment with miR-486 inhibitors (Fig. 3 B, P<0.0001). [score:5]
However, a reduced expression of miR-486 stimulated PTEN expression in mammary epithelial cell nuclei. [score:5]
To examine whether miR-486 expression depends on the stage of mammary development specifically during the high-milk-quality lactation period (H) (Fig. 1A-1D), the low-milk-quality lactation period (L) (Fig. 1E-1H), and the pregnant period (P) (Fig. 1I-1L), we used in situ hybridization to evaluate the expression of miR-486 in bovine glandular tissue and adipose tissue (Fig. 1A). [score:4]
The results of this study show that triglyceride, β-casein and lactose levels were regulated by the transfection of miR-486 mimics or miR-486 inhibitors, indicating that miR-486 stimulated the lactation of milk fat, milk protein and lactose in the cow mammary gland. [score:4]
MiR-486 targets PTEN and represses the expression of PTEN mRNA and protein. [score:4]
Moreover, the knockdown miR-486 repressed the expression of AKT and MTOR (Fig. 4 B, P<0.0001). [score:4]
MiR-486 significantly repressed PTEN expression in cell culture and induced AKT and MTOR expression in BMECs. [score:4]
MiR-486 plays a key role in the mammary gland and directly downregulates the PTEN gene and affects downstream genes, such as AKT, mTOR, and β-casein, which play important roles in the mammary gland. [score:4]
β-casein levels, lactose secretion, and triglyceride levels are upregulated by miR-486. [score:4]
This study shows that the tumor suppressor PTEN is negatively regulated by miR-486 via two specific sites (nt 725–732 and nt 3,183–3,190) within the 3`UTR. [score:4]
We observed that, compared to a negative control, the high-level expression of miR-486 stimulated the expression of AKT and MTOR (Fig. 4 A, P<0.0001). [score:4]
0118284.g006 Fig 6A: With the treatment of miR-486 mimics and negative control (miR-NC) in BMECs and stained with propidium iodide for flow cytometry; B: With the treatment of miR-486 inhibitors and negative control (Anti-NC) in BMECs and stained with propidium iodide for flow cytometry. [score:3]
After 24 h of transfection with miR-486 mimics/inhibitors, BMECs were seeded onto a 96-well plate (4×10 [4] cells per 100 μl per well), and 10 μl of CCK-8 solution was added to each well. [score:3]
After the transfection of the cells with the miR-486 mimics/inhibitors, total RNA was purified using Trizol reagent (Invitrogen) following the manufacturer’s instructions. [score:3]
Furthermore, qRT-PCR analysis showed that the expression of miR-486 was higher in the H group than in the L (P<0.01) and P groups (P<0.01) (Fig. 1C). [score:3]
The PTEN 3’UTR is a target of miR-486. [score:3]
Therefore, we concluded that the post-transfection effects of miR-486 mimics or a miR-486 inhibitor affected mammary epithelial cells more than fat cells. [score:3]
And we found that the glandular expression of miR-486 was higher in high milk quality cows than in low milk quality cows (P<0.01) and pregnant cows (P<0.01). [score:3]
0118284.g003 Fig 3A: qRT-PCR analysis of miR-486 expression in BMECs after transfection with miR-486 mimics or negative control (miR-NC). [score:3]
Expression of miR-486 in bovine mammary gland tissues with different milk qualities. [score:3]
E: Western blotting analysis of PTEN protein expression in BMECs after treatment with miR-486 mimics or negative control (miR-NC). [score:3]
However, decreasing the levels of miR-486 reduced the relative protein expression of AKT, p-AKT, MTOR, and p-MTOR (Fig. 4 D; P<0.0001, P<0.0001, P<0.01, respectively). [score:3]
However, the inhibition of miR-486 showed the opposite effect. [score:3]
We confirmed that miR-486 is expressed in both bovine mammary gland tissues and in mammary epithelial cells in vitro. [score:3]
Using a small RNA sequencing approach, we observed that the levels of miR-486 were higher in lactation gland tissue during the high-quality milk stage than in the low-quality milk and pregnancy stages and that the expression of miR-486 was almost unchanged from the low-quality lactation stage to the pregnancy stage. [score:3]
C: qRT-PCR analysis of PTEN expression in BMECs after treatment with miR-486 mimics or negative control (miR-NC). [score:3]
Changes in cell cycle distribution in BMECs due to miR-486 mimics and a miR-486 inhibitor. [score:3]
A: qRT-PCR analysis of miR-486 expression in BMECs after transfection with miR-486 mimics or negative control (miR-NC). [score:3]
Additionally, to determine if miR-486 expression was different between the high-milk quality and low-milk quality lactation periods we used a small RNA sequencing approach developed by our laboratory. [score:3]
Transient transfection of BMECs with miR-486 mimics/inhibitor, led to changes in miR-486 and PTEN. [score:3]
0118284.g005 Fig 5A: The CCK8 assay was performed at 48h after transfection of miR-486 mimics and miR-486 inhibitors; B: The percentage of EdU positive cells; C: EdU incorporation assays following transfected with miR-486 mimics, miR-486 inhibitors and their respective controls (miR-NC and Anti-NC) in BMECs for 48h. [score:3]
Additionally, the percentage of Edu -positive cells was lower in the miR-486 inhibitor group than in the negative control group (Anti-NC) (Fig. 5 B, P<0.05). [score:3]
The expression of miR-486 and the 5S internal control gene were quantified using real-time PCR quantification and the Hairpin-it miRNAs qPCR Quantitation Kit (GenePharma, Shanghai, China) according to the manufacturer’s protocol. [score:3]
The effects of the miR-486 mimics and inhibitor on cell proliferation in BMECs. [score:3]
Next, BMECs transfected with miR-486 mimics, inhibitor, or negative control were examined for changes in the cell cycle using flow cytometry analysis (Fig. 6). [score:3]
C: Analysis of the relative expression of miR-486 in bovine glandular tissue by qRT-PCR. [score:3]
The expression of miR-486 in different milk qualities bovine mammary glands. [score:3]
A: The CCK8 assay was performed at 48h after transfection of miR-486 mimics and miR-486 inhibitors; B: The percentage of EdU positive cells; C: EdU incorporation assays following transfected with miR-486 mimics, miR-486 inhibitors and their respective controls (miR-NC and Anti-NC) in BMECs for 48h. [score:3]
The indicated cells were transfected with 50 nmol miR-486 mimics, inhibitors, or the corresponding negative control constructs (miR-NC, Anti-NC) (GenePharma, Shanghai, China) using Lipofectamine 2000 (Invitrogen Life Technologies, Carlsbad, CA, USA) according to the manufacturer’s instructions, respectively. [score:3]
A: With the treatment of miR-486 mimics and negative control (miR-NC) in BMECs and stained with propidium iodide for flow cytometry; B: With the treatment of miR-486 inhibitors and negative control (Anti-NC) in BMECs and stained with propidium iodide for flow cytometry. [score:3]
The expression of miR-486 has been shown to affect various processes. [score:3]
Effect of miR-486 mimics/inhibitor on bovine mammary epithelial cell proliferation. [score:3]
Therefore, we propose that miR-486 is a novel regulator that stimulates the proliferation of BMECs. [score:2]
In this report, we show that the function of miR-486 is indispensable for regulating PTEN in bovine mammary epithelium. [score:2]
MiR-486 targets the PTEN gene. [score:2]
Furthermore, our studies showed that miR-486 regulated the cell cycle of BMECs. [score:2]
We found that overexpressing miR-486 increased the amount of mammary epithelial cell proliferation as determined by CCK-8 assays. [score:2]
Furthermore, miR-486 inhibitors caused the opposite effect compared to the negative control (Anti-NC), (Fig. 6 B, P<0.05). [score:2]
MiR-486 increases the expression of AKT and MTOR in bovine mammary epithelial cells. [score:2]
MiR-486 is conserved in mammals and is the sole miRNA with no known family members [14]. [score:1]
A: ISH showing the localization of miR-486 in the mammary gland. [score:1]
The 3′UTR of wild-type PTEN was linked to pGL3 Luciferase Reporter Vectors (Promega) and examined in HEK-293 cells that had been transfected with miR-486 mimics or a negative control. [score:1]
qRT-PCR reactions were performed in triplicate to detect miR-486. [score:1]
Therefore, we believe that miR-486 is a key biomarker in bovine mammary gland epithelial cells. [score:1]
And the black circle with feint black arrow indicates miR-486 negative probe in adipose tissue. [score:1]
Here, we present a study on the role played by miR-486 in the bovine mammary gland. [score:1]
B: The results of small RNA sequencing for miR-486 (fat negative). [score:1]
And the white circle with feint arrow indicates miR-486 negative probe in mammary gland tissue. [score:1]
The data above indicate that miR-486 is a negative modulator of the G1 to S transition. [score:1]
Thus, the data above suggest that miR-486 negatively affects PTEN. [score:1]
There are two predicted binding miR-486 regions of the 3′UTR of PTEN (Cow PTEN NM_000314). [score:1]
Moreover, the luciferase signal of the pGL3-control vector with miR-486 was similar to that obtained with the negative control as shown in Fig. 2. 10.1371/journal. [score:1]
Additionally, miR-486 stimulates cell proliferation and increases some crucial secretory elements, such as β-casein, lactose, and lipids. [score:1]
The percentage of Edu -positive cells was significantly higher in the miR-486 mimic -treated cells than in the negative control group (P<0.05). [score:1]
The role of miR-486 in the cell cycle is an ongoing area of study. [score:1]
In situ hybridization showed that miR-486 was found primarily in mammary gland tissue and not in adipose tissue. [score:1]
Moreover, the luciferase signal of the pGL3-control vector with miR-486 was similar to that obtained with the negative control as shown in Fig. 2. 10.1371/journal. [score:1]
And the black circle with solid black arrow indicates miR-486 positive probe in adipose tissue. [score:1]
And the white circle with solid white arrow indicates miR-486 positive probe in mammary gland tissue. [score:1]
Indeed, our study confirmed that levels of AKT, phosphorylated AKT, mTOR and phosphorylated mTOR change in response to PTEN and that PTEN levels appeared to depend on miR-486 levels. [score:1]
Edu incorporation experiments illustrated that miR-486 stimulated DNA proliferation by increasing the percentage of Edu -positive cells. [score:1]
Taken together, our findings indicate that miR-486 functions primarily in bovine mammary gland epithelium tissue and cells and promotes milk synthesis and secretion. [score:1]
HEK-293 cells were cultured in 24-well plates, and each plate was transfected with 80 ng of pGL3/PTEN vector or pGL3/PTEN/mut vector containing firefly luciferase and 4 ng of the pRL-TK vector (Promega Madison, WI, USA) containing 4 pmol miR-486 mimics or negative control. [score:1]
0118284.g001 Fig 1A: ISH showing the localization of miR-486 in the mammary gland. [score:1]
Our data suggest that the repression of PTEN by miR-486 is associated with lactation and in this way increases AKT and mTOR. [score:1]
[1 to 20 of 99 sentences]
2
[+] score: 25
On the contrary, miR-486 plays a pro-apoptotic tumor-suppressor role [63], and its high expression was associated with a good prognosis in gastric adenocarcinoma [64]; however, miR-486 over expression in dystrophin -deficient mice was also observed to reduce PTEN expression [65]. [score:9]
14/26s highly expressed in the HM fraction (let-7d-5p, miR-103a-3p, miR-142-3p, miR-17-5p, miR-18a-5p, miR-196a-5p, miR-20a-5p, miR-24-1-5p, miR-26a-5p, miR-301a-3p, miR-30b-5p, miR-34b-5p, miR-34c-5p, miR-378a-3p) and 7/14s highly expressed in the LM fraction (miR-10b-5p, miR-122-5p, miR-1-3p, miR-184, miR-486-5p, miR-7-5p, miR-99b-5p) were predicted to target 327 and 281 experimentally observed genes, respectively. [score:7]
Dysregulation of miR-17-5p, miR-26a-5p, miR-486-5p, miR-122-5p, miR-184 and miR-20a-5p was found to target three pathways (PTEN, PI3K/AKT and STAT). [score:4]
PTEN could be targeted by the simultaneous action of miR-17-5p, miR-26a-5p, miR-486-5p. [score:3]
Among these pathways, “PTEN Signaling” was regulated by miR-17-5p, miR-26a-5p and miR-486-5p, “PI3K/AKT Signaling” by 122-5p and miR-184 and “STAT3 Pathway” by miR-20a-5p (Fig.   4). [score:2]
[1 to 20 of 5 sentences]
3
[+] score: 25
The microarray results showed that the most upregulated expression changes were noticed for miR-139, miR-2469, and miR-486, while the highest downregulation was observed for miR-9, miR-29b, and miR-31 (Table  2). [score:9]
It is plausible that miR-139 supports the miR-486 -dependent inhibition of Foxo1 translation, thereby increasing the mTOR -mediated protein synthesis. [score:5]
The downregulation of miR-486 in normal myoblasts results in an impaired migration and myoblast fusion [37]. [score:4]
MiR-486 has been shown to influence myoblast differentiation by targeting Pax7 and promoting the IGF-1R/PI3K/AKT signaling pathway by repressing its negative regulators PTEN and FOXO1A [28, 35]. [score:3]
Finally, miR-486 was last of the myomiRs differing in expression between the HER/LIM and the HF cells (Table 2, Fig. 4). [score:3]
Among them were muscle-specific myomiRs miR-1, -133a, -206, and miR-486 and non-myomiRs such as miR-9-5p, -128, -139, -145, -503, and -660. [score:1]
[1 to 20 of 6 sentences]
4
[+] score: 21
The miR-486 targets genes that mainly regulate development of fibroblast cells (Table 1), which are the most common cells in the connective tissue in the gut. [score:5]
For example, in mid-jejunum, miR-486, miR-146b and miR-7 had divergent regulation from D7 to D21; in ileum, miR-211 revealed significant down-regulation from D7 to D21 by qRT-PCR, but there was no significant difference identified by sequencing. [score:5]
Similarly, temporally DE miRNAs, miR-146, miR-191, miR-33, miR-7, miR-99/100, miR-486, and miR-145 may target genes that accelerate gut tissue and immune system development. [score:4]
Most of temporal DE miRNAs showed the expression in agreement between miRNA-seq and qRT-PCR; however, three of them (miR-486, miR-146b, miR-7, and miR-211) revealed opposite trends between miRNA-seq and qRT-PCR in some comparison groups (Figure 8). [score:3]
Temporally DE miRNAs in small intestine (miR-146, miR-191, miR-33, miR-7, miR-99/100, miR-486, miR-145, and miR-211) were predicted to be related to gut epithelial cells development, immune cells development, inflammatory response, and other functions (Table 1). [score:3]
A total of 13 regional and temporal DE miRNAs (regional DE miRNAs: miR-192, miR-194, miR-205, miR-31, and miR-196; temporal DE miRNAs: miR-146b, miR-191, miR-99a, miR-145, miR-211, miR-486, miR-33, miR-7, and miR-196b) that identified from miRNA-seq were selected for validation using stem-loop qRT-PCR. [score:1]
[1 to 20 of 6 sentences]
5
[+] score: 20
According to the results of TargetScan analysis, totally 2743 bovine genes were predicted as the targets of c-miRNAs significantly down-regulated by grazing (miR-19b, miR-148a, miR-150, miR-221, miR-223 miR-320a, miR-361, and miR-486). [score:8]
The difference in miR-486 expression between human studies and this bovine study would be due to difference between species or exercise mode. [score:3]
Of these c-miRNAs, circulation levels of miR-19b, miR-148a, miR-150, miR-221, miR-223, miR-320a, miR-361, and miR-486 were significantly down-regulated in the grazing cattle compared to housed cattle, whereas the miR-451 level was higher in the grazing than in the housed cattle. [score:3]
Circulating miR-486 level decreases in response to both acute and chronic exercise in young men, and the changing ratio of miR-486 showed a negative correlation with VO [2 max] [30]. [score:1]
It is noticeable that the circulation level of miR-486, a muscle-enriched miRNA, was much higher in the housed cattle at 1 mo than in the grazing cattle. [score:1]
A single bout of exhaustive cycling or rowing training for 90 days elevated plasma miR-20a, miR-21, miR-146a, miR-221, and miR-222 levels [29], whereas a single bout of cycling exercise at 70% VO [2 max] for 60 min decreased the circulating level of miR-486 immediately after the exercise [30]. [score:1]
In the present study, among the 231 exosomal miRNAs detected in the cattle plasma, muscle-enriched miR-486 and a trace of miR133b were detected, but miR-1, miR-133a, miR-206, miR-208b, and miR-499 were not detected. [score:1]
The results of qRT-PCR normalized with the let-7g level showed that the levels of miR-19b, miR-148a, miR-150, miR-221, and miR-361, and miR-486 in the grazing cattle were lower than those in the housed cattle at 1 mo of grazing (P = 0.013, 0.014, 0.093, 0.011, 0.041, and 0.023, respectively) (Fig 6A). [score:1]
Muscle-specific miRNAs such as miR-1, miR-133a, miR-206, miR-208b, and miR-499 were not significantly detected in the plasma exosomes across all samples (i. e., grazing and housed during experiment) except for miR-486 (0.18%) and a trace of miR-133b (< 0.001%). [score:1]
[1 to 20 of 9 sentences]
6
[+] score: 20
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-mir-21, hsa-mir-26a-1, hsa-mir-27a, hsa-mir-28, hsa-mir-30a, hsa-mir-96, hsa-mir-98, hsa-mir-99a, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-196a-1, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-30d, hsa-mir-34a, hsa-mir-196a-2, hsa-mir-199a-2, hsa-mir-23b, hsa-mir-27b, hsa-mir-125b-1, hsa-mir-143, hsa-mir-145, hsa-mir-152, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-194-1, hsa-mir-194-2, hsa-mir-200a, hsa-mir-99b, hsa-mir-26a-2, hsa-mir-378a, hsa-mir-342, hsa-mir-148b, hsa-mir-338, hsa-mir-335, hsa-mir-196b, hsa-mir-484, hsa-mir-486-1, hsa-mir-1271, hsa-mir-378d-2, bta-mir-26a-2, bta-mir-103-1, bta-mir-148a, bta-mir-21, bta-mir-27a, bta-mir-30d, bta-mir-484, bta-mir-99a, bta-mir-125a, bta-mir-125b-1, bta-mir-145, bta-mir-199a-1, bta-mir-27b, bta-mir-98, bta-mir-148b, bta-mir-200a, bta-mir-30a, bta-let-7a-1, bta-mir-342, bta-mir-23b, bta-let-7a-2, bta-let-7a-3, bta-mir-103-2, bta-mir-125b-2, bta-mir-34a, bta-mir-99b, hsa-mir-885, hsa-mir-103b-1, hsa-mir-103b-2, bta-mir-143, bta-mir-152, bta-mir-16a, bta-mir-194-2, bta-mir-196a-2, bta-mir-196a-1, bta-mir-196b, bta-mir-199a-2, bta-mir-26a-1, bta-mir-28, bta-mir-335, bta-mir-338, bta-mir-378-1, bta-mir-885, bta-mir-96, bta-mir-1271, bta-mir-2299, bta-mir-199c, bta-mir-1388, bta-mir-194-1, bta-mir-378-2, hsa-mir-378b, bta-mir-3431, hsa-mir-378c, hsa-mir-4286, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, bta-mir-4286-1, bta-mir-4286-2, hsa-mir-378j, bta-mir-378b, bta-mir-378c, hsa-mir-486-2, bta-mir-378d, bta-mir-194b, bta-mir-194b-2
When compared with the control period (day-14), we identified a total of 22 DE miRNAs at day+28 including 10 up-regulated (bta-miR-199c, miR-199a-3p, miR-98, miR-378, miR-21-5p, miR-148b, miR-34a, miR-152, miR-16a, and miR-28) and 12 down-regulated (bta-miR-200a, miR-145, miR-99a-5p, miR-125b, miR-99b, miR-125a, miR-96, miR-484, miR-1388-5p, miR-342, miR-486 and miR-1271) (Table  2). [score:6]
Additionally, only the expression of bta-miR-486 was significantly affected at day+7 (7 days following onset of treatment) as compared to the control period (day-14), showing a 2.84 fold down-regulation. [score:5]
Among the DE miRNAs, bta-miR-1271 was the most affected showing a 2.26 fold down-regulation followed by bta-miR-486 with a 1.75 fold decrease. [score:4]
Except for bta-miR-1271 and miR-486, the majority of the DE miRNAs showed subtle changes in fold gene expression. [score:3]
bta-miR-486 was also found to be differentially expressed at day + 7 as compared to day-14 in safflower treatment For cows supplemented with safflower oil, there was also a high correlation (R [2] ≥ 0.964) between libraries (Additional file 10b). [score:2]
[1 to 20 of 5 sentences]
7
[+] score: 17
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-27a, hsa-mir-31, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-16-2, hsa-mir-192, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-181a-2, hsa-mir-205, hsa-mir-181a-1, hsa-mir-214, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-146a, hsa-mir-184, hsa-mir-186, hsa-mir-193a, hsa-mir-194-1, hsa-mir-155, hsa-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-219a-2, hsa-mir-99b, hsa-mir-26a-2, hsa-mir-365a, hsa-mir-365b, hsa-mir-374a, hsa-mir-148b, hsa-mir-423, hsa-mir-486-1, hsa-mir-499a, hsa-mir-532, hsa-mir-590, bta-mir-26a-2, bta-let-7f-2, bta-mir-103-1, bta-mir-148a, bta-mir-16b, bta-mir-21, bta-mir-221, bta-mir-222, bta-mir-27a, bta-mir-499, bta-mir-125b-1, bta-mir-181a-2, bta-mir-205, bta-mir-27b, bta-mir-30b, bta-mir-31, bta-mir-193a, bta-let-7d, bta-mir-148b, bta-mir-186, bta-mir-191, bta-mir-192, bta-mir-200a, bta-mir-214, bta-mir-22, bta-mir-23a, bta-mir-29c, bta-mir-423, bta-let-7g, bta-mir-24-2, bta-let-7a-1, bta-mir-532, bta-let-7f-1, bta-mir-30c, bta-let-7i, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-125b-2, bta-mir-365-1, bta-mir-374a, bta-mir-99b, hsa-mir-374b, hsa-mir-664a, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-1915, bta-mir-146a, bta-mir-155, bta-mir-16a, bta-mir-184, bta-mir-24-1, bta-mir-194-2, bta-mir-219-1, bta-mir-223, bta-mir-26a-1, bta-mir-365-2, bta-mir-374b, bta-mir-763, bta-mir-9-1, bta-mir-9-2, bta-mir-181a-1, bta-mir-2284i, bta-mir-2284s, bta-mir-2284l, bta-mir-2284j, bta-mir-2284t, bta-mir-2284d, bta-mir-2284n, bta-mir-2284g, bta-mir-2339, bta-mir-2284p, bta-mir-2284u, bta-mir-2284f, bta-mir-2284a, bta-mir-2284k, bta-mir-2284c, bta-mir-2284v, bta-mir-2284q, bta-mir-2284m, bta-mir-2284b, bta-mir-2284r, bta-mir-2284h, bta-mir-2284o, bta-mir-664a, bta-mir-2284e, bta-mir-1388, bta-mir-194-1, bta-mir-193a-2, bta-mir-2284w, bta-mir-2284x, bta-mir-148c, hsa-mir-374c, hsa-mir-219b, hsa-mir-499b, hsa-mir-664b, bta-mir-2284y-1, bta-mir-2284y-2, bta-mir-2284y-3, bta-mir-2284y-4, bta-mir-2284y-5, bta-mir-2284y-6, bta-mir-2284y-7, bta-mir-2284z-1, bta-mir-2284aa-1, bta-mir-2284z-3, bta-mir-2284aa-2, bta-mir-2284aa-3, bta-mir-2284z-4, bta-mir-2284z-5, bta-mir-2284z-6, bta-mir-2284z-7, bta-mir-2284aa-4, bta-mir-2284z-2, hsa-mir-486-2, hsa-mir-6516, bta-mir-2284ab, bta-mir-664b, bta-mir-6516, bta-mir-219-2, bta-mir-2284ac, bta-mir-219b, bta-mir-374c, bta-mir-148d
The expression of bta-miR-21-3p, miR-365-3p, miR-193a-3p, miR-423-5p and miR-486 in challenged cells was further confirmed by qPCR. [score:3]
Five differentially expressed miRNAs (bta-miR-184, miR-24-3p, miR-148, miR-486 and let-7a-5p) were unique to E. coli while four (bta-miR-2339, miR-499, miR-23a and miR-99b) were unique to S. aureus. [score:3]
Similarly, different expression patterns of bta-miR-21-3p for E. coli at 24 h and S. aureus at 12 h, miR-486 for E. coli at 48 h and miR-423-5p for S. aureus at 12 h between the two methods were also observed. [score:3]
Furthermore, the differential expression pattern of five miRNAs (bta-miR184, miR-24-3p, miR-148, miR-486 and bta-let-7a-5p) were unique to E. coli while four (bta-miR-2339, miR-499, miR-23a and miR-99b) were unique to S. aureus. [score:3]
Five differentially expressed miRNAs (bta-miR-193a-3p, miR-423-5p, miR-21-3p, miR-365-3p and miR-486) were validated by quantitative RT-PCR using TaqMan [®] miRNA Assays following manufacturer’s recommendations (Applied Biosystems, Foster City, CA, USA). [score:2]
Further evidence of the immune capacity of miR-21 was from the study of Narducci et al. [39] who provided in vitro evidence for involvement of miR-21, miR-214 and miR-486 in cell survival in Sézary syndrome in humans. [score:1]
24306105:+ bta-miR-486′-5pbta-mir-486′ 27.848cccgguacugagcugacccgag224ucggggcagcucaguacaggac2227:36261849.. [score:1]
Interestingly, our study shows that a different set of five miRNAs (miR-184, miR-24-3p, miR-148, miR-486 and let-7a-5p) were unique to E. coli bacteria while another set of four (miR-2339, miR-499, miR-23a and miR-99b) were unique to S. aureus bacteria. [score:1]
[1 to 20 of 8 sentences]
8
[+] score: 11
The expression levels of bta-miR-27a-5p, bta-miR-486, bta-miR-450b, bta-miR-424-5p and bta-miR-34a were significantly higher in bulls than in steers, and the bta-miR-204 expression level was lower in bulls (Fig.   4A), which is consistent with the results of RT-qPCR and Solexa sequencing. [score:5]
Previous studies reported that miR-486 regulates lipid metabolism through the PI3K-Akt-signaling pathway by targeting the phosphorylation of Akt and tensin homolog and FoxO1 38, 41, 42. [score:4]
In this study, bta-miR-27a-5p was expressed in high abundance, followed by bta-miR-486, bta-miR-450b, bta-miR-424-5p and bta-miR-34a in the BL library compared to the SL library. [score:2]
[1 to 20 of 3 sentences]
9
[+] score: 11
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-27a, hsa-mir-31, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-101-1, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-16-2, hsa-mir-192, hsa-mir-199a-1, hsa-mir-30c-2, hsa-mir-199a-2, hsa-mir-223, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-125b-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-140, hsa-mir-141, hsa-mir-152, hsa-mir-191, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-149, hsa-mir-150, hsa-mir-320a, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-101-2, hsa-mir-99b, hsa-mir-26a-2, hsa-mir-379, hsa-mir-423, hsa-mir-451a, hsa-mir-486-1, hsa-mir-496, hsa-mir-520a, hsa-mir-525, hsa-mir-518b, hsa-mir-516b-2, hsa-mir-516b-1, hsa-mir-516a-1, hsa-mir-516a-2, hsa-mir-92b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, bta-mir-26a-2, bta-let-7f-2, bta-mir-101-2, bta-mir-103-1, bta-mir-16b, bta-mir-20a, bta-mir-21, bta-mir-27a, bta-mir-320a-2, bta-mir-125a, bta-mir-125b-1, bta-mir-199a-1, bta-mir-31, bta-mir-140, bta-mir-92a-2, bta-let-7d, bta-mir-132, bta-mir-191, bta-mir-192, bta-mir-22, bta-mir-23a, bta-mir-29c, bta-mir-423, bta-let-7g, bta-mir-24-2, bta-let-7a-1, bta-mir-150, bta-let-7f-1, bta-mir-30c, bta-let-7i, bta-mir-23b, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-125b-2, bta-mir-99b, hsa-mir-1249, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, bta-mir-101-1, bta-mir-133a-2, bta-mir-133a-1, bta-mir-141, bta-mir-152, bta-mir-16a, bta-mir-24-1, bta-mir-199a-2, bta-mir-223, bta-mir-26a-1, bta-mir-379, bta-mir-451, bta-mir-496, bta-mir-92a-1, bta-mir-92b, bta-mir-1249, bta-mir-320b, bta-mir-320a-1, hsa-mir-320e, hsa-mir-23c, hsa-mir-451b, bta-mir-149, hsa-mir-486-2
Out of the most abundant miRNAs in bovine plasma, miR-486 and miR-92a are reportedly expressed primarily in erythrocytes, and miR-191 is expressed primarily in platelets [31, 35]. [score:5]
We detected a total of 208 miRNAs in bovine plasma (based on mean Cq < 35 across all sample pools; Fig.   4a), the most abundant of which (Fig.   4b) corresponded to miRNAs reportedly expressed at high levels in blood cells including erythrocytes (miR-451, miR-486, miR-16), leukocytes (miR-150, miR-27a, miR-23a) and thrombocytes (miR-223, miR-20a, miR-24), and which are putatively released into the plasma through apoptosis, lysis or active secretion [36– 38]. [score:3]
Common miRNAs identified across studies include miR-486, miR-92a, miR-192 and miR-423-5p. [score:1]
b Expression level of the 20 most abundant miRNAs in bovine plasma (calculated as 2 [^(40-Ct)]) Comparing the 20 most abundant miRNAs in each of the PCR array and sequencing datasets, only 6 miRNAs (miR-486, miR-22-3p, miR-191, miR-92a, miR-140 and miR-451) were common. [score:1]
b Expression level of the 20 most abundant miRNAs in bovine plasma (calculated as 2 [^(40-Ct)])Comparing the 20 most abundant miRNAs in each of the PCR array and sequencing datasets, only 6 miRNAs (miR-486, miR-22-3p, miR-191, miR-92a, miR-140 and miR-451) were common. [score:1]
[1 to 20 of 5 sentences]
10
[+] score: 10
Hitachi et [43] reported that the expression level of miR-486 in skeletal muscle was significantly increased, and showed that, miR-486, which is a positive regulator of the IGF-1/Akt pathway, is involved in myostatin signaling in myostatin knockout mice. [score:5]
We have identified several miRNAs that are up-regulated in MSTN [-/-] pigs, and these miRNAs have previously been shown to be involved in myoblast development, including the well-known miR-1, miR-206 [13, 15], and miR-486 [26] (Figure 1A). [score:5]
[1 to 20 of 2 sentences]
11
[+] score: 7
Among the 10 most abundant miRNAs in plasma (Fig 1C), miR-486 (the most abundant) and miR-92a are reportedly expressed primarily in red blood cells [37], whereas miR-191 is highly expressed in platelets [38]. [score:5]
Four of the 10 most abundant miRNAs (miR-486, miR-92a, miR-192 and miR-423-5p) were also identified as highly abundant in bovine plasma in another study using Illumina technology [39]. [score:1]
Out of the 20 most abundant miRNAs in each of the sequencing and PCR array datasets, only six (miR-451, miR-486, miR-22-3p, miR-92a, miR-191 and miR-140) were common to both datasets (20% overlap). [score:1]
[1 to 20 of 3 sentences]
12
[+] score: 7
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-21, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-99a, mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-99a, mmu-mir-140, mmu-mir-10b, mmu-mir-181a-2, mmu-mir-24-1, mmu-mir-191, hsa-mir-192, hsa-mir-148a, hsa-mir-30d, mmu-mir-122, hsa-mir-10b, hsa-mir-181a-2, hsa-mir-181a-1, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-122, hsa-mir-140, hsa-mir-191, hsa-mir-320a, mmu-mir-30d, mmu-mir-148a, mmu-mir-192, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-21a, mmu-mir-22, mmu-mir-24-2, mmu-mir-26a-1, mmu-mir-92a-2, mmu-mir-25, mmu-mir-181a-1, mmu-mir-26a-2, mmu-mir-92a-1, hsa-mir-26a-2, hsa-mir-423, hsa-mir-451a, mmu-mir-451a, hsa-mir-486-1, mmu-mir-486a, mmu-mir-423, bta-mir-26a-2, bta-let-7f-2, bta-mir-148a, bta-mir-21, bta-mir-30d, bta-mir-320a-2, bta-mir-99a, bta-mir-181a-2, bta-mir-27b, bta-mir-140, bta-mir-92a-2, bta-let-7d, bta-mir-191, bta-mir-192, bta-mir-22, bta-mir-423, bta-let-7g, bta-mir-10b, bta-mir-24-2, bta-let-7a-1, bta-let-7f-1, bta-mir-122, bta-let-7i, bta-mir-25, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, hsa-mir-1246, bta-mir-24-1, bta-mir-26a-1, bta-mir-451, bta-mir-92a-1, bta-mir-181a-1, bta-mir-320a-1, mmu-mir-486b, hsa-mir-451b, bta-mir-1246, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-mir-451b, mmu-let-7k, hsa-mir-486-2
Several microRNAs had similar expression when comparing results from the present study with those of There were nine microRNAs (bta-miR-10b, bta-miR-423-3p, bta-miR-99a-5p, bta-miR-181a, bta-miR-423-5p, bta-miR-148a, bta-miR-26a, bta-miR-192, and bta-miR-486), that were upregulated in earlier stages of life in both studies. [score:6]
Bta-miR-486 had the fewest counts during fall, 2013, and the highest in spring, 2014 (P = 0.0347), while bta-miR-122 had the lowest in summer, 2013, and the highest in spring, 2014 (P = 0.0143). [score:1]
[1 to 20 of 2 sentences]
13
[+] score: 6
Variant expression followed two main patterns as seen in other studies [40] those miRNAs with a strong predominant isomiR, such as bta-miR-191 and bta-miR-103; and those miRNAs where there is no predominant isomiR, such as bta-miR-486 and bta-miR-320a. [score:3]
Interestingly, it has been reported that the IlluminaTruSeq Small RNA Sample Preparation Kit enriches hsa-miR-486 in human plasma libraries yields 50-fold more RNA than other library preparation methods [50], suggesting that some quantitative biases are likely to be apparent within our data. [score:1]
The top 10 miRNAs accounted for 86% of the total, and miR-486 was the most abundant miRNA across all samples. [score:1]
In order of decreasing abundance, the top five were miR-486, miR-423-5p, miR-92a, miR-22-3p and miR-191. [score:1]
[1 to 20 of 4 sentences]
14
[+] score: 5
Myostatin signaling regulates Akt activity via the regulation of miR-486 expression. [score:5]
[1 to 20 of 1 sentences]
15
[+] score: 3
MiR-486, miR-92a, miR-16, miR-144, and miR-451 have been commonly applied as erythrocyte markers for human and mice [40, 41], and they were all expressed in our bovine sera and exosomes dataset with high proportion. [score:3]
[1 to 20 of 1 sentences]
16
[+] score: 3
Analyses of our dataset from fresh sera showed significant differences in the two most abundant miRNAs, bta-miR-486 and bta-miR-423-5p. [score:1]
In order of decreasing abundance, the top five were miR-486, miR-423-5p, miR-92a, miR-22-3p and miR-191. [score:1]
The over representation of bta-miR-486 in the fresh samples is the cause of this and raises the issue of correct normalisation procedures for miRNA [60]. [score:1]
[1 to 20 of 3 sentences]
17
[+] score: 3
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-21, hsa-mir-23a, hsa-mir-30a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-196a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-196a-2, hsa-mir-210, hsa-mir-181a-1, hsa-mir-218-1, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-30b, hsa-mir-128-1, hsa-mir-145, hsa-mir-191, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-30c-1, hsa-mir-99b, hsa-mir-296, hsa-mir-30e, hsa-mir-361, hsa-mir-337, hsa-mir-148b, hsa-mir-196b, hsa-mir-425, hsa-mir-20b, hsa-mir-486-1, hsa-mir-488, hsa-mir-181d, hsa-mir-498, hsa-mir-519c, hsa-mir-520a, hsa-mir-526b, hsa-mir-520d, hsa-mir-506, hsa-mir-92b, hsa-mir-608, hsa-mir-617, hsa-mir-625, hsa-mir-641, hsa-mir-1264, hsa-mir-1271, bta-let-7f-2, bta-mir-103-1, bta-mir-148a, bta-mir-21, bta-mir-30d, bta-mir-128-1, bta-mir-145, bta-mir-181a-2, bta-mir-30b, bta-mir-181b-2, bta-mir-20b, bta-mir-30e, bta-mir-92a-2, bta-let-7d, bta-mir-148b, bta-mir-181c, bta-mir-191, bta-mir-210, bta-mir-23a, bta-mir-361, bta-mir-425, bta-let-7g, bta-mir-30a, bta-let-7a-1, bta-let-7f-1, bta-mir-30c, bta-let-7i, bta-mir-23b, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-99b, hsa-mir-890, hsa-mir-888, hsa-mir-889, hsa-mir-938, hsa-mir-1184-1, hsa-mir-1203, hsa-mir-1204, hsa-mir-1265, hsa-mir-103b-1, hsa-mir-103b-2, bta-mir-128-2, bta-mir-181d, bta-mir-196a-2, bta-mir-196a-1, bta-mir-196b, bta-mir-218-1, bta-mir-296, bta-mir-30f, bta-mir-488, bta-mir-92a-1, bta-mir-92b, bta-mir-1271, bta-mir-181a-1, bta-mir-181b-1, bta-mir-148c, hsa-mir-1184-2, hsa-mir-1184-3, hsa-mir-486-2, bta-mir-1264, bta-mir-148d
Other report [29] also showed that bovine mammary epithelial cells challenged with Staphylococcus aureus (S. aureus) or Escherichia coli (E. coli) resulted in dysregulation of 17 miRNAs of which five miRNAs including miR-148, miR-486 and let-7a-5p were unique to E. coli while four miRNAs including miR-23a and miR-99b were unique to S. aureus. [score:2]
Similarly, in the current study, miR-148b, miR-486-5p, miR-23b, miR-99b and members of the let-7 families were altered in animals affected by subclinical endometritis. [score:1]
[1 to 20 of 2 sentences]
18
[+] score: 3
gov, version 2.2.29, human genomic plus transcript database) revealed high query coverages (bta-miR-486: 46%, bta-miR-21: 100%, bta-miR-22 100%, bta-miR-25 100%, bta-miR-92: 95%) and therefore high similarity of bta-miRNAs aligned to human transcripts. [score:1]
The second (miR-486) and third (miR-92a) most abundant human miRNAs are found in the top 10 list of sequenced bovine miRNAs (Table S3). [score:1]
Comparing these results with our data collected by small RNA-Seq of bovine plasma samples, five out of ten miRNAs (miR-486, miR-21, miR-22, miR-25 and miR-92) were as well present in our top 20 list of most abundant miRNAs, either for the analyzed miRNA profile through mapping to hsa and bta miRBase entries (Table S3). [score:1]
[1 to 20 of 3 sentences]
19
[+] score: 3
In sirloin and heart, several muscle-specific miRNAs (myomiRs) were observed: including miR-1, essential for the development and homeostasis of smooth and skeletal muscle [27, 28], miR-378a-3p, involved in exercise -induced muscle hypertrophy [29], and miR-486-5p, which is also modulated by exercise and helps regulate the differentiation of myoblasts [30]. [score:3]
[1 to 20 of 1 sentences]
20
[+] score: 3
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-21, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-99a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-16-2, hsa-mir-192, hsa-mir-148a, hsa-mir-10b, hsa-mir-181a-2, hsa-mir-181a-1, hsa-mir-215, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-mir-15b, hsa-mir-27b, hsa-mir-125b-1, hsa-mir-141, hsa-mir-143, hsa-mir-152, hsa-mir-125b-2, hsa-mir-126, hsa-mir-146a, hsa-mir-184, hsa-mir-200c, hsa-mir-155, hsa-mir-29c, hsa-mir-200a, hsa-mir-99b, hsa-mir-296, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-378a, hsa-mir-342, hsa-mir-148b, hsa-mir-451a, ssc-mir-125b-2, ssc-mir-148a, ssc-mir-15b, ssc-mir-184, ssc-mir-224, ssc-mir-23a, ssc-mir-24-1, ssc-mir-26a, ssc-mir-29b-1, ssc-let-7f-1, ssc-mir-103-1, ssc-mir-21, ssc-mir-29c, hsa-mir-486-1, hsa-mir-499a, hsa-mir-671, hsa-mir-378d-2, bta-mir-26a-2, bta-mir-29a, bta-let-7f-2, bta-mir-103-1, bta-mir-148a, bta-mir-16b, bta-mir-21, bta-mir-499, bta-mir-99a, bta-mir-125b-1, bta-mir-126, bta-mir-181a-2, bta-mir-27b, bta-mir-31, bta-mir-15b, bta-mir-215, bta-mir-30e, bta-mir-148b, bta-mir-192, bta-mir-200a, bta-mir-200c, bta-mir-23a, bta-mir-29b-2, bta-mir-29c, bta-mir-10b, bta-mir-24-2, bta-mir-30a, bta-mir-200b, bta-let-7a-1, bta-mir-342, bta-let-7f-1, bta-let-7a-2, bta-let-7a-3, bta-mir-103-2, bta-mir-125b-2, bta-mir-15a, bta-mir-99b, hsa-mir-664a, ssc-mir-99b, hsa-mir-103b-1, hsa-mir-103b-2, ssc-mir-15a, ssc-mir-16-2, ssc-mir-16-1, bta-mir-141, bta-mir-143, bta-mir-146a, bta-mir-152, bta-mir-155, bta-mir-16a, bta-mir-184, bta-mir-24-1, bta-mir-223, bta-mir-224, bta-mir-26a-1, bta-mir-296, bta-mir-29d, bta-mir-378-1, bta-mir-451, bta-mir-671, bta-mir-29e, bta-mir-29b-1, bta-mir-181a-1, ssc-mir-181a-1, ssc-mir-215, ssc-mir-30a, bta-mir-2318, bta-mir-2339, bta-mir-2430, bta-mir-664a, bta-mir-378-2, ssc-let-7a-1, ssc-mir-378-1, ssc-mir-29a, ssc-mir-30e, ssc-mir-499, ssc-mir-143, ssc-mir-10b, ssc-mir-486-1, ssc-mir-152, ssc-mir-103-2, ssc-mir-181a-2, ssc-mir-27b, ssc-mir-24-2, ssc-mir-99a, ssc-mir-148b, ssc-mir-664, ssc-mir-192, ssc-mir-342, ssc-mir-125b-1, oar-mir-21, oar-mir-29a, oar-mir-125b, oar-mir-181a-1, hsa-mir-378b, hsa-mir-378c, ssc-mir-296, ssc-mir-155, ssc-mir-146a, bta-mir-148c, ssc-mir-126, ssc-mir-378-2, ssc-mir-451, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-451b, hsa-mir-499b, ssc-let-7a-2, ssc-mir-486-2, hsa-mir-664b, hsa-mir-378j, ssc-let-7f-2, ssc-mir-29b-2, ssc-mir-31, ssc-mir-671, bta-mir-378b, bta-mir-378c, hsa-mir-486-2, oar-let-7a, oar-let-7f, oar-mir-103, oar-mir-10b, oar-mir-143, oar-mir-148a, oar-mir-152, oar-mir-16b, oar-mir-181a-2, oar-mir-200a, oar-mir-200b, oar-mir-200c, oar-mir-23a, oar-mir-26a, oar-mir-29b-1, oar-mir-30a, oar-mir-99a, bta-mir-664b, chi-let-7a, chi-let-7f, chi-mir-103, chi-mir-10b, chi-mir-125b, chi-mir-126, chi-mir-141, chi-mir-143, chi-mir-146a, chi-mir-148a, chi-mir-148b, chi-mir-155, chi-mir-15a, chi-mir-15b, chi-mir-16a, chi-mir-16b, chi-mir-184, chi-mir-192, chi-mir-200a, chi-mir-200b, chi-mir-200c, chi-mir-215, chi-mir-21, chi-mir-223, chi-mir-224, chi-mir-2318, chi-mir-23a, chi-mir-24, chi-mir-26a, chi-mir-27b, chi-mir-296, chi-mir-29a, chi-mir-29b, chi-mir-29c, chi-mir-30a, chi-mir-30e, chi-mir-342, chi-mir-378, chi-mir-451, chi-mir-499, chi-mir-671, chi-mir-99a, chi-mir-99b, bta-mir-378d, ssc-mir-378b, oar-mir-29b-2, ssc-mir-141, ssc-mir-200b, ssc-mir-223, bta-mir-148d
Similarly, Jin et al. (2014a) demonstrated a differential expression of nine miRNAs (bta-miR-184, miR-24-3p, miR-148, miR-486, and let-7a-5p, miR-2339, miR-499, miR-23a, and miR-99b) upon challenge of MACT-cells (bovine mammary epithelia cell line) with heat inactivated E. coli and S. aureus bacteria. [score:3]
[1 to 20 of 1 sentences]
21
[+] score: 2
MiR-486 has also been shown to induce myoblast differentiation by down -regulating Paired-box-containing 7 (Pax7) [11], while MiR-27b regulates Paired-box-containing 3 (Pax3) protein levels and ensures myogenic differentiation [12]. [score:2]
[1 to 20 of 1 sentences]
22
[+] score: 2
Our previous studies revealed that skeletal muscle-specific miRNAs, namely miR-1, miR-133a/b, miR-206, miR-208a/b, miR-496, and miR-499, were abundant in the muscles of JB cattle [4], whereas none of them was detected in the plasma profiles except for a modest miR-486 content [24]. [score:1]
We also conducted qPCR of miRNAs that are enriched in muscle or plasma (miR-21-5p, miR-30d-5p, miR-103, miR-206, miR-208b, miR-451, miR-486, miR-499, miR-2412, and miR-2478), some of which are abundant in bovine skeletal muscles [4]. [score:1]
[1 to 20 of 2 sentences]
23
[+] score: 2
Other miRNAs from this paper: bta-mir-29a, bta-let-7f-2, bta-mir-103-1, bta-mir-151, bta-mir-30d, bta-mir-320a-2, bta-mir-126, bta-mir-181a-2, bta-mir-27b, bta-mir-30b, bta-mir-31, bta-mir-34b, bta-mir-107, bta-mir-15b, bta-mir-181b-2, bta-mir-30e, bta-let-7d, bta-mir-124a-1, bta-mir-138-2, bta-mir-181c, bta-mir-214, bta-mir-455, bta-mir-93, bta-let-7g, bta-mir-10b, bta-mir-30a, bta-let-7a-1, bta-mir-487b, bta-let-7f-1, bta-mir-122, bta-mir-30c, bta-let-7i, bta-mir-25, bta-mir-34c, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-15a, bta-mir-34a, bta-mir-1-2, bta-mir-1-1, bta-mir-105b, bta-mir-124a-2, bta-mir-124b, bta-mir-133a-2, bta-mir-133a-1, bta-mir-133b, bta-mir-138-1, bta-mir-152, bta-mir-181d, bta-mir-196a-2, bta-mir-196a-1, bta-mir-206, bta-mir-30f, bta-mir-409a, bta-mir-432, bta-mir-495, bta-mir-543, bta-mir-9-1, bta-mir-9-2, bta-mir-1185, bta-mir-1271, bta-mir-181a-1, bta-mir-181b-1, bta-mir-2284i, bta-mir-2284s, bta-mir-2284l, bta-mir-2284j, bta-mir-2284t, bta-mir-2284d, bta-mir-2284n, bta-mir-2284g, bta-mir-2284p, bta-mir-2284u, bta-mir-2363-1, bta-mir-2363-2, bta-mir-2284f, bta-mir-2284a, bta-mir-2284k, bta-mir-2284c, bta-mir-2384, bta-mir-2284v, bta-mir-2284q, bta-mir-2404-1, bta-mir-2284m, bta-mir-2284b, bta-mir-320b, bta-mir-2424, bta-mir-2284r, bta-mir-2284h, bta-mir-2404-2, bta-mir-2284o, bta-mir-2284e, bta-mir-320a-1, bta-mir-424, bta-mir-2284w, bta-mir-2284x, bta-mir-409b, bta-mir-2284y-1, bta-mir-2284y-2, bta-mir-2284y-3, bta-mir-2284y-4, bta-mir-2284y-5, bta-mir-2284y-6, bta-mir-2284y-7, bta-mir-2284z-1, bta-mir-2284aa-1, bta-mir-2284z-3, bta-mir-2284aa-2, bta-mir-2284aa-3, bta-mir-2284z-4, bta-mir-2284z-5, bta-mir-2284z-6, bta-mir-2284z-7, bta-mir-2284aa-4, bta-mir-2284z-2, bta-mir-133c, bta-mir-2284ab, bta-mir-2284ac
MiR-486 has also been shown to induce myoblast differentiation by down -regulating Pax7 [13], while MiR-27b regulates Pax3 protein levels and ensures myogenic differentiation [14]. [score:2]
[1 to 20 of 1 sentences]
24
[+] score: 1
Other miRNAs from this paper: hsa-let-7f-1, hsa-let-7f-2, hsa-mir-20a, hsa-mir-21, hsa-mir-26a-1, hsa-mir-34a, hsa-mir-182, hsa-mir-210, hsa-mir-215, hsa-mir-221, hsa-mir-1-2, hsa-mir-15b, hsa-mir-122, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-141, hsa-mir-144, hsa-mir-127, hsa-mir-1-1, hsa-mir-34b, hsa-mir-34c, hsa-mir-26a-2, hsa-mir-375, hsa-mir-133b, hsa-mir-20b, hsa-mir-429, hsa-mir-451a, hsa-mir-486-1, hsa-mir-802, bta-mir-26a-2, bta-let-7f-2, bta-mir-16b, bta-mir-20a, bta-mir-21, bta-mir-221, bta-mir-34b, bta-mir-127, bta-mir-15b, bta-mir-20b, bta-mir-215, bta-mir-210, bta-let-7f-1, bta-mir-122, bta-mir-34c, bta-mir-34a, bta-mir-1-2, bta-mir-1-1, bta-mir-133a-2, bta-mir-133a-1, bta-mir-133b, bta-mir-141, bta-mir-144, bta-mir-16a, bta-mir-182, bta-mir-26a-1, bta-mir-375, bta-mir-429, bta-mir-451, bta-mir-2285a, bta-mir-2285d, bta-mir-2285b-1, bta-mir-2376, bta-mir-2285c, bta-mir-1388, bta-mir-3431, hsa-mir-451b, bta-mir-2285e-1, bta-mir-2285e-2, bta-mir-2285f-1, bta-mir-2285f-2, bta-mir-2285g-1, bta-mir-2285h, bta-mir-2285i, bta-mir-2285j-1, bta-mir-2285j-2, bta-mir-2285k-1, bta-mir-2285l, bta-mir-6119, bta-mir-2285o-1, bta-mir-2285o-2, bta-mir-2285n-1, bta-mir-2285n-2, bta-mir-2285p, bta-mir-2285m-1, bta-mir-2285m-2, bta-mir-2285n-3, bta-mir-2285n-4, bta-mir-2285o-3, bta-mir-2285o-4, bta-mir-2285m-3, bta-mir-2285m-4, bta-mir-2285o-5, bta-mir-2285m-5, bta-mir-2285n-5, bta-mir-2285n-6, bta-mir-2285n-7, bta-mir-2285k-2, bta-mir-6529a, bta-mir-2285k-3, bta-mir-2285k-4, bta-mir-2285k-5, bta-mir-2285q, bta-mir-2285r, bta-mir-2285s, bta-mir-2285t, bta-mir-2285b-2, bta-mir-2285v, hsa-mir-486-2, bta-mir-2285g-2, bta-mir-2285g-3, bta-mir-2285af-1, bta-mir-2285af-2, bta-mir-2285y, bta-mir-2285w, bta-mir-2285x, bta-mir-6529b, bta-mir-133c, bta-mir-2285z, bta-mir-2285u, bta-mir-2285aa, bta-mir-2285ab, bta-mir-2285ac, bta-mir-2285ad, bta-mir-2285ae, bta-mir-2285ag, bta-mir-2285ah, bta-mir-2285ai, bta-mir-2285aj, bta-mir-2285ak, bta-mir-2285al, bta-mir-2285am, bta-mir-2285ar, bta-mir-2285as-1, bta-mir-2285as-2, bta-mir-2285as-3, bta-mir-2285at-1, bta-mir-2285at-2, bta-mir-2285at-3, bta-mir-2285at-4, bta-mir-2285au, bta-mir-2285av, bta-mir-2285aw, bta-mir-2285ax-1, bta-mir-2285ax-2, bta-mir-2285ax-3, bta-mir-2285ay, bta-mir-2285az, bta-mir-2285an, bta-mir-2285ao-1, bta-mir-2285ao-2, bta-mir-2285ap, bta-mir-2285ao-3, bta-mir-2285aq-1, bta-mir-2285aq-2, bta-mir-2285ba-1, bta-mir-2285ba-2, bta-mir-2285bb, bta-mir-2285bc, bta-mir-2285bd, bta-mir-2285be, bta-mir-2285bf-1, bta-mir-2285bf-2, bta-mir-2285bf-3, bta-mir-2285bg, bta-mir-2285bh, bta-mir-2285bi-1, bta-mir-2285bi-2, bta-mir-2285bj-1, bta-mir-2285bj-2, bta-mir-2285bk, bta-mir-2285bl, bta-mir-2285bm, bta-mir-2285bn, bta-mir-2285bo, bta-mir-2285bp, bta-mir-2285bq, bta-mir-2285br, bta-mir-2285bs, bta-mir-2285bt, bta-mir-2285bu-1, bta-mir-2285bu-2, bta-mir-2285bv, bta-mir-2285bw, bta-mir-2285bx, bta-mir-2285by, bta-mir-2285bz, bta-mir-2285ca, bta-mir-2285cb, bta-mir-2285cc, bta-mir-2285cd, bta-mir-2285ce, bta-mir-2285cf, bta-mir-2285cg, bta-mir-2285ch, bta-mir-2285ci, bta-mir-2285cj, bta-mir-2285ck, bta-mir-2285cl, bta-mir-2285cm, bta-mir-2285cn, bta-mir-2285co, bta-mir-2285cp, bta-mir-2285cq, bta-mir-2285cr-1, bta-mir-2285cr-2, bta-mir-2285cs, bta-mir-2285ct, bta-mir-2285cu, bta-mir-2285cv-1, bta-mir-2285cv-2, bta-mir-2285cw-1, bta-mir-2285cw-2, bta-mir-2285cx, bta-mir-2285cy, bta-mir-2285cz, bta-mir-2285da, bta-mir-2285db, bta-mir-2285dc, bta-mir-2285dd, bta-mir-2285de, bta-mir-2285df, bta-mir-2285dg, bta-mir-2285dh, bta-mir-2285di, bta-mir-2285dj, bta-mir-2285dk, bta-mir-2285dl-1, bta-mir-2285dl-2, bta-mir-2285dm, hsa-mir-6529
Moreover, miRNAs enriched in the bovine blood cell fraction included many previously reported to be blood cell-derived in humans, such as miR-144, miR-451, let-7f, miR-26a, miR-15b, miR-20a, miR-16a, miR-16b and miR-486 [18, 25, 37, 39– 41]. [score:1]
[1 to 20 of 1 sentences]
25
[+] score: 1
The dominant miRNA by any measure, representing 43–98% of all miRNAs in these specimens, was miR-486-5p, a miRNA known to be robustly expressed in red blood cells [34]. [score:1]
[1 to 20 of 1 sentences]
26
[+] score: 1
Bta-miR-184, miR-24-3p, miR-148, miR-486 and let-7a-5p were unique to E. coli, whereas bta-miR-2339, miR-499, miR-23a and miR-99b were specific to S. aureus in an in-vitro study with bovine mammary epithelial cells 32. [score:1]
[1 to 20 of 1 sentences]
27
[+] score: 1
Other miRNAs from this paper: bta-mir-29a, bta-let-7f-2, bta-mir-27a, bta-mir-320a-2, bta-mir-99a, bta-mir-125a, bta-mir-181a-2, bta-mir-27b, bta-mir-10a, bta-mir-139, bta-mir-140, bta-mir-181b-2, bta-mir-487a, bta-let-7d, bta-mir-124a-1, bta-mir-181c, bta-mir-29b-2, bta-mir-29c, bta-mir-423, bta-let-7g, bta-mir-10b, bta-let-7a-1, bta-mir-487b, bta-let-7f-1, bta-mir-122, bta-let-7i, bta-mir-25, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-195, bta-mir-34a, bta-mir-1-2, bta-mir-1-1, bta-mir-124a-2, bta-mir-124b, bta-mir-133a-2, bta-mir-133a-1, bta-mir-133b, bta-mir-154a, bta-mir-181d, bta-mir-184, bta-mir-206, bta-mir-29d, bta-mir-335, bta-mir-33a, bta-mir-33b, bta-mir-495, bta-mir-95, bta-mir-9-1, bta-mir-9-2, bta-mir-29e, bta-mir-29b-1, bta-mir-1271, bta-mir-1249, bta-mir-181a-1, bta-mir-181b-1, bta-mir-2284i, bta-mir-2286, bta-mir-2300a, bta-mir-2300b, bta-mir-2284s, bta-mir-2284l, bta-mir-2284j, bta-mir-2284t, bta-mir-2284d, bta-mir-2319a, bta-mir-2319b, bta-mir-2284n, bta-mir-2284g, bta-mir-2329-1, bta-mir-2329-2, bta-mir-2284p, bta-mir-2284u, bta-mir-2363-1, bta-mir-2363-2, bta-mir-2284f, bta-mir-2284a, bta-mir-2284k, bta-mir-2284c, bta-mir-2284v, bta-mir-2396, bta-mir-2285c, bta-mir-2284q, bta-mir-2404-1, bta-mir-2284m, bta-mir-2284b, bta-mir-320b, bta-mir-2284r, bta-mir-2443, bta-mir-2284h, bta-mir-2450c, bta-mir-2450b, bta-mir-2450a, bta-mir-2404-2, bta-mir-2284o, bta-mir-2484, bta-mir-2284e, bta-mir-320a-1, bta-mir-2887-1, bta-mir-2887-2, bta-mir-2284w, bta-mir-3431, bta-mir-2284x, bta-mir-3432a-1, bta-mir-3432a-2, bta-mir-574, bta-mir-2284y-1, bta-mir-2284y-2, bta-mir-2284y-3, bta-mir-154c, bta-mir-154b, bta-mir-2284y-4, bta-mir-2284y-5, bta-mir-2284y-6, bta-mir-6526-1, bta-mir-6526-2, bta-mir-503, bta-mir-2284y-7, bta-mir-6526-3, bta-mir-2284z-1, bta-mir-2284aa-1, bta-mir-2284z-3, bta-mir-2284aa-2, bta-mir-2284aa-3, bta-mir-2284z-4, bta-mir-2284z-5, bta-mir-2284z-6, bta-mir-2284z-7, bta-mir-6536-1, bta-mir-2284aa-4, bta-mir-6536-2, bta-mir-2284z-2, bta-mir-133c, bta-mir-2284ab, bta-mir-2284ac, bta-mir-3432b, bta-mir-2450d
The largest miRNA family identified was miR-2284, which consisted of 63 members, and miR-154, let-7, and miR-181/30 possessed 18, 12, and 6 members, respectively; other miRNA families, such as miR-122, miR-1249, miR-140, and miR-486, had only one member, whereas miR-1940, miR-2286, miR-3431, and miR-574 did not belong to any gene family (Additional file 8). [score:1]
[1 to 20 of 1 sentences]