sort by

16 publications mentioning sja-mir-71a

Open access articles that are associated with the species Schistosoma japonicum and mention the gene name mir-71a. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 137
By contrast, in the up-regulated genes of 23DSI, the predicted target genes of miR-1-miR-71-miR-7-miR-7-5p appeared to regulate the ribonucleoprotein complex assembly, cellular protein complex assembly, microtubule -based process, response to oxidative stress, multicellular organismal aging, respiratory electron transport chain, pyrimidine ribonucleoside triphosphate biosynthetic process, positive regulation of epithelial cell differentiation, positive regulation of cell proliferation, apoptosis, energy coupled proton transport, electron transport chain, ATP synthesis-coupled proton transport, anatomical structure formation involved in morphogenesis, ribonucleoprotein complex biogenesis, mitotic cell cycle, larval development, microtubule polymerisation or depolymerisation, female gamete generation, regulation of transcription from RNA polymerase II promoter, and imaginal disc development, among others (Table  2 and Additional file 6: Table S4). [score:12]
In 23 DSI, the high level of bantam and low levels of miR-1, miR-71, miR-7, and miR-7-5p possibly regulated and organised a specific gene expression profile for sexual maturation and egg production by inhibiting and strengthening specific gene expression and metabolic processes. [score:8]
In unpaired females (23SSI), bantam was notably not up-regulated, whereas miR-1, miR-71, miR-7, and miR-7-5p were significantly up-regulated. [score:7]
Furthermore, among all samples, bantam was distinctly up-regulated in 23 DSI, and miR-1, miR-71, miR-7-5p, and miR-7 were distinctly up-regulated in 23SSI. [score:7]
To analyse the effect of the differential expression of miRNAs on female development after pairing, we sequenced the libraries of 23DSI and 23SSI, predicted the target genes of miRNA-1-miRNA-71-miRNA-7-miR-7-5p (Additional file 3: Table S1) and bantam (Additional file 4: Table S2), and analysed the differential expression of these genes in 23DSI compared with 23SSI. [score:7]
We found that the target genes of miR-1-miR-71-miR-7-miR-7-5p, such as ribosomal protein genes (CAX72037.1, CAX71939.1, CAX78482.1, CAX77178.1, AAP06483.1, CAX77387.1, CAX72859.1, CAX70956.1, CAX71543.1, CAX83047.1, CAX70121.1) (Additional file 6: Table S4), thioredoxin peroxidase (CAX75860.1), tubulin (XP_002580033.1, CAX75788.1, CAX75500.1, CAX71989.1, CAX76110.1), ATP synthase- H + transporting (CAX75390.1, CAX76063.1), and cytochrome c oxidase (CAX74747.1, CAX76589.1), among others, were significantly up-regulated. [score:6]
Predicted target genes of miR-1-miR-71-miR-7-miR-7-5p in up-regulated genes in 23DSI. [score:6]
By contrast, in paired females (23DSI), the above mentioned miRNAs were not up-regulated, suggesting that the functions of the target genes of miR-1-miR-71-miR-7-miR-7-5p were required in paired females. [score:6]
Click here for file Predicted target genes of miR-1-miR-71-miR-7-miR-7-5p in up-regulated genes in 23DSI. [score:6]
Although miRNAs do not regulate all genes in organisms, evidence provided by miRNA analyses in the present study indicated that pairing likely limited the expression of non-essential genes through increasing the expression of bantam and specific genes by maintaining miR-1, miR-71, miR-7, and miR-7-5p at relatively low levels. [score:6]
revealed that in unpaired females, the highly-expressed miRNA-1, miRNA-71, miRNA-7, and miR-7-5p only inhibited the limited pathways, such as proteasome and ribosome assembly. [score:5]
For instance, in ribosome assembly, 15 of 49 detected genes in this metabolic process were predicted as the target genes of miR-1-miR-71-miR-7-miR-7-5p, whereas only 1 of 49 genes was the predicted target gene of bantam (Figure  3A). [score:5]
Out of the 50 genes, 33 were the predicted target genes of bantam (Figure  3B), whereas only 2 were predicted target genes of miR-1-miR-71-miR-7-miR-7-5p. [score:5]
The predicted target genes of bantam hardly participated in the proteasome, porphyrin metabolism, ribosome, whereas more predicted target genes of miR-1-miR-71-miR-7-miR-7-5p were involved in these process. [score:5]
For example, the higher expression of bantam was observed only in 23DSI, whereas higher expression of miR-1, miR-71, miR-7-5p, and miR-7 manifested only in 23SSI (Figure  1B). [score:5]
Differential expression of the predicted target genes of bantam and miRNA-1-miRNA-71-miRNA-7-5p- miR-7 between samples from 23 DSI and 23SSI. [score:5]
Moreover, few of the predicted target genes of miR-1-miR-71-miR-7-miR-7-5p participated in the peroxisome, RNA degradation, mRNA surveillance pathway, axon guidance, basal transcription factors, apoptosis, glycerophospholipid metabolism, insulin signalling pathway, lysosome, regulation of actin cytoskeleton, and endocytosis. [score:4]
B. miR-71, with respect to 23DSI, was significantly up-regulated in 23SSI (P < 0.05). [score:4]
However, none of the predicted target genes of miR-1-miR-71-miR-7-miR-7-5p are involved the citrate cycle, gastric acid secretion, glycolysis/gluconeogenesis, protein digestion and absorption, aminoacyl-tRNA biosynthesis, fatty acid biosynthesis, and the pentose phosphate pathway. [score:3]
Click here for file Predicted target genes of miR-1-miR-71-miR-7-miR-7-5p in Schistosoma japonicum. [score:3]
The transcriptomes of 23DSI and 23SSI revealed that the predicted target genes of miRNA-1, miRNA-71, miRNA-7, and miR-7-5p were associated with the ribonucleoprotein complex assembly and microtubule -based process. [score:3]
Predicted target genes of miR-1-miR-71-miR-7-miR-7-5p in Schistosoma japonicum. [score:3]
To confirm the differentially expressed miRNAs in 23DSI, 23SSI, 18DSI, and 18SSI, bantam, miRNA-1, and miR-71 were selected for quantitative RT–PCR analysis. [score:3]
Only several high-abundance miRNAs differentially expressed between 23DSI and 23 SSI, such as bantam, miR-1, miR-71, miR-7, and miR-7-5p. [score:3]
In particular, various ribosomal protein genes were regulated by miR-1-miR-71-miR-7-miR-7-5p. [score:2]
Thus, the change of the abundance of miR-71 in worms maybe plays a key role in female development. [score:2]
Furthermore, the low abundance of miR-1, miR-71, miR-7, and miR-7-5p in 23DSI compared with 23SSI was likely capable of promoting specific gene expression. [score:2]
These results suggested that miR-1, miR-71, miR-7, and miR-7-5p played an essential role in regulating ribosomal assembly. [score:2]
Similarly, higher amount of miR-71 (Figure  2B) and miR-1 (Figure  2C) were observed in 23SSI than in 23DSI. [score:1]
Interestingly, miR-71 was located on the female W chromosome, suggesting mir-71 be involved in female sex-specific functions [51]. [score:1]
[1 to 20 of 30 sentences]
2
[+] score: 42
Interestingly, both sja-miR-71 and sja-bantam showed maximum expression in cercaria (infective stage of the parasite) and their expression then dropped quickly to nadir levels in schistosomulum following penetration of the cercaria into its host. [score:5]
Analysis of sja-let-7, sja-miR-71 and sja-bantam expression by stem-loop RT-real time PCR revealed highly stage-specific expression patterns. [score:5]
Relation of S. japonicum miRNA expression to life cycle stageUsing the modified stem-loop RT-PCR method described above, we further endeavored to determine the timing of expression patterns of miRNA sja-let-7, sja-miR-71 and sja-bantam across the life span of S. japonicum. [score:5]
Importantly, the expression of sja-miR-71 and sja-bantam peaked in cercaria and then decreased quickly to their lowest levels in schistosomulum, following host infection. [score:3]
Using the modified stem-loop RT-PCR method described above, we further endeavored to determine the timing of expression patterns of miRNA sja-let-7, sja-miR-71 and sja-bantam across the life span of S. japonicum. [score:3]
Expression of sja-miR-71 and sja-bantam were 1000-fold and 500-fold higher in cercaria than that in schistosomulum, respectively. [score:3]
In particular, sja-miR-71 and sja-bantam expression reach their peaks in the cercaria stage and then drop quickly to the nadirs in the schistosomulum stage, following penetration of cercaria into a mammalian host. [score:3]
Expression of sja-let-7, sja-miR-71 and sja-bantam were analyzed in six stages of the life cycle, i. e. egg, miracidium, sporocyst, cercaria, schistosomulum, and adult worm, by a modified stem-loop reverse transcribed polymerase chain reaction (RT-PCR) method developed in our laboratory. [score:3]
Figure S8 The amplification plot of sja-let-7, sja-mir-71, sja-bantam and alpha tubulin. [score:1]
5, 6, 7 and 8 were the amplification plot of sja-let-7, sja-mir-71, alpha tubulin and sja-bantam, respectively, using the no-RT control. [score:1]
In this study, we firstly identified five authentic miRNAs in S. japonicum by constructing and screening parasite cDNA library of size-fractionated RNAs: sja-let-7, sja-miR-71, sja-bantam, sja-miR-125 and sja-miR-new1. [score:1]
Hence, herein we have tentatively designated the five novel miRNAs from S. japonicum as sja-let-7, sja-miR-71, sja-bantam, sja-miR-125 and sja-miR-new1, respectively. [score:1]
miRNA Sequence Size (nt) S. japonicum contig (LSBI, Shanghai) a S. mansoni shortgun reads (Sanger) b Clones c Δ G° [folding] (kcal/mol e) sja-let-7 GGAGGUAGUUCGUUGUGUGGU 21 CNUS0000067197: 5856–5876 shisto12670f07: 651–671 5 −30.8 sja-miR-71 UGAAAGACGAUGGUAGUGAGA 21CNUS0000007682(-) d: 3100–3120 shisto8708d10: 353–372 1 −34.5 sja-bantam UGAGAUCGCGAUUAAAGCUGGU 22 CNUS0000021739: 2223–2244shisto5226g02(-) d: 325–346 6 −22.9 sja-miR-125 UCCCUGAGACCCUUUGAUUGUC 22 CNUS0000024724:7691–7712 Smp_contig001766:3162–3183 2 −25.6 sja-miR-new1 UCCCUGAGACUGAUAAUUGCUC 22CCON0000000380 (-) d:353325–353346:15–36 shisto8125f02.p1k 4 −29.2 alocation of the miRNA sequence within the published chromosomal sequence of S. japonicum. [score:1]
Alignments with known miRNA sequences indicated that four of the five novel S. japonicum miRNAs belong to four different metazoan miRNA families, i. e. let-7, miR-71, bantam, and miR-125 (Figure 3, S3 and S4). [score:1]
Membranes were incubated with five different biotin-labeled probes (1: sja-let-7, 2: sja-miR-71, 3: sja-bantam, 4: sja-miR-125 and 5: sja-miR-new1). [score:1]
Alignments of the miRNAs with corresponding family members indicated that four of them belong to a metazoan miRNA family: let-7, miR-71, bantam and miR-125. [score:1]
The novel miRNAs were designated as sja-let-7, sja-miR-71, sja-bantam, sja-miR-125 and sja-miR-new1, respectively. [score:1]
Thus far, no studies concerning the function of miR-71 family miRNAs have been reported. [score:1]
1, 2, 3 and 4 were the amplification plot of sja-mir-71, sja-bantam, sja-let-7 and alpha tubulin, respectively, the RT product of cercaria RNAs. [score:1]
miRNA egg miracidium sporocyst cercaria schistosomulum male adult worm female adult worm sja-let-7 1.15±0.96 0.02±0.02 0.24±0.22 5.92±4.02 0.60±0.41 0.75±0.35 0.59±0.13 sja-mir-71 8.68±5.06 3.21±2.17 4.57±0.79 1257.92±565.47 0.91±0.34 1.93±1.41 1.65±0.36 sja-bantam 4.50±2.67 1.69±0. [score:1]
[1 to 20 of 20 sentences]
3
[+] score: 13
Other miRNAs from this paper: sja-let-7, sja-mir-1, sja-mir-36, sja-mir-71b
Strong biased expression patterns of certain miRNA family members were observed, of which, the expression of sja-miR-71, sja-miR-71-5p, and sja-miR-36-3p were prominent in this pathologically-related stage. [score:5]
Combining the TPM value of miRNAs (Table S3) and Northern blot analysis (Figure 4), we found that members of the sja-miR-71 family were the most highly expressed ones in the egg stage, implying that these miRNAs may play important regulatory functions during this stage. [score:4]
Sja-miR-71, sja-miR-71-5p, and sja-miR-36-3p were suggested to play important roles in embryo development. [score:2]
A similar phenomenon was also observed in other species, such as Clonorchis sinesis, in which members from the miR-71 family accounted for one third of the reads in the adult stage [37]. [score:1]
Of the miRNAs identified, sja-miR-71b-5p, sja-miR-71, sja-miR-1, sja-miR-36-3p, and sja-124-3p were the most abundant members at the egg stage (Figure 3A). [score:1]
[1 to 20 of 5 sentences]
4
[+] score: 13
For example, the miR-71a cluster of S. japonicum contains miRNA sequences that have been associated with the suppression of apoptosis [57]– [59] in both Drosophila and silkworms. [score:3]
The expression of sja-miR-2a and sja-miR-2b were found to be 31% and 26% of sja-miR-71a. [score:3]
Based on the above criterion, 7 miRNAs were tentatively assigned to two clusters: miR-71a and miR-71b with 347 and 420 bp sequence ranges, respectively. [score:1]
This example is based upon a 74 nucleotide sequence which includes sja-miR-71a (location: CAC|CCON0000000053.1|:242744:242817). [score:1]
Membranes were incubated with biotin-labeled probes complementary to candidate miRNA sequences (sja-miR-1a, sja-miR-1b, sja-miR-7, sja-miR-71b, sja-miR-71a, sja-miR-87, sja-miR-124, sja-miR-281, sja-miR-2b, sja-miR-2a, sja-miR-307, sja-miR-31, sja-miR-133, sja-miR-310, sja-miR-8, sja-miR-10, sja-miR-36, sja-miR-61, sja-miR-277, sja-miR-219, sja-miR-190, sja-miR-candidate-03). [score:1]
It also merit mention that the genomic arrangement of miRNAs, including miR-71a, the miR-2 family and sja-miR-novel-12 (miR-13), is conserved in S. mediterranea and S. mansoni. [score:1]
Interestingly, the nucleotide sequences and organization of cluster miR-71a contains four miRNAs which are likewise clustered within the S. japonicum, S. mansoni, and S. mediterranea genomes (Figure 3), The conserved association of the four genes in cluster miR-71a may indicate that they have interrelated functional roles in these organisms [40]. [score:1]
Cluster miR-71a contains 4 stem-loop structures encoding miR-71a, miR-2a, miR-2b, and a schistosome-specific miRNA (sja-miR-novel-12) that shares the seed sequence of the miR-13 family which has been extensively studied in other organisms. [score:1]
edu/) indicate that three conserved miRNA genes(sja-miR-71a, sja-miR-2a, sja-miR-2b) and one miRNA gene(sja-miR-novel-12), first reported here, are clustered together within approximately 350 base pair of each other. [score:1]
[1 to 20 of 9 sentences]
5
[+] score: 12
The number of targets for mir-71a and mir-71b identified here was similar to that of a previous study of S. mansoni miRNAs [11], but overall, the number and identity of targets were discordant with results from the present study. [score:5]
Moreover, the four novel miRNAs transcribed principally in male adults, including one miRNA (sha-miR-new_46) encoded on the same scaffold as the mir-71/mir-2 cluster (KL250488.1) with a CPM more than 20-times higher than that in the library derived from adult female worms, suggest male-specific roles for these miRNAs in gene regulation. [score:2]
In female worms, the most highly transcribed miRNAs were sha-mir-71a (3.6% of mapped sRNA reads), sha-mir-1 (2.0%), sha-mir-71b (0.7%), sha-mir-125b (0.7%) and sha-bantam (0.3%) (S1 Table). [score:1]
Notably, among the female-biased transcripts were the three miRNAs, sha-mir-71b, sha-mir-2b and sha-mir-2c (encoded in a cluster on scaffold KL251164.1), whereas the related miRNAs sha-mir-71a and sha-mir-2a (encoded in a cluster on scaffold KL250488.1) did not show sex-biased transcription. [score:1]
The most highly transcribed miRNAs in male worms were sha-mir-1 (5.9% of mapped sRNA reads), sha-mir-71a (5.8%), sha-mir-125b (1.6%), sha-mir-7a (1.0%) and sha-let-7 (0.6%). [score:1]
The majority (n = 38; 82.6%) of miRNAs predicted to bind 3’-UTR elements were associated with more than one gene; these miRNAs included sha-miR-450_RF00708 (104 genes), sha-miR-71a (53 genes), sha-miR-71b (43 genes), sha-miR-new_38 (39 genes) and sha-miR-new_36 (37 genes). [score:1]
These results are consistent with reports of a mir-71/mir-2 cluster duplication in S. mansoni [10, 11] and S. japonicum [14, 34] on the female-sex (W) chromosome and on one autosome (chromosome 5), and further support roles in sex-specific traits, sexual differentiation, pairing of adult worms and reproductive processes in schistosomes. [score:1]
[1 to 20 of 7 sentences]
6
[+] score: 11
Although the expression of sja-miR-71 and sja-bantam dropped quickly in S. japonicum lung-stage schistosomulum, we observed a strong hybridization signal for both miRNAs in S. mansoni (Figure 1) [37]. [score:3]
We observed 2 miRNAs (mir-2 and mir-71) expressed in both life cycle stages tested, 7 in adult worms only (mir-4, mir-6, mir-9, mir-32, mir-125, mir-3, mir-5) and 5 in schistosomula only (mir-20, mir-18, mir-22, mir-26, Bantam). [score:3]
We also analyzed in S. mansoni the expression of the five novel miRNAs recently identified in S. japonicum (sja-let-7, sja-miR-71, sja-bantam, sja-miR-125 and sja-miR-new1) [37]. [score:3]
Forty-two sequences had at least one match with mature miRNAs from different metazoan miRNA families, such as miR-832, miR-71, miR-297, and let-7 (Table 1). [score:1]
miR-71, miR-125 and Bantam are the miRNAs identified in S. mansoni homolog to miRNAs of S. japonicum [38]. [score:1]
[1 to 20 of 5 sentences]
7
[+] score: 11
Interestingly, these five highly expressed miRNAs, miR-71b, miR-2a, miRNA-2e-5p, miRNA-2e-3p and miR-2f, were clustered in tandem at the same genomic locus (CNUS0000011792.1) (Figure 4A), whilst other miR-71 and miR-2 family members, miR-71a, miR-2d, miR-2b, and miR-2c, were clustered at another genomic locus (CNUS0000007682.1) in an inverted orientation (Figure 4B). [score:3]
In addition, both miR-71 and some miR-2 family members in tandem are found to be clustered in a reversal direction mo del on two genomic loci, and two pairs of novel S. japonicum miRNAs were derived from sense and antisense DNA strands at the same genomic loci. [score:2]
In addition to known S. japonicum miRNAs, sja-let-7, sja-miR-71a, sja-miR-125 and sja-bantam [17], the remaining 172 miRNAs were first recognized in S. japonicum. [score:1]
According to the published criteria for distinguishing bilaterian miRNAs from other types of small RNAs [4], [28], [29], a bioinformatics pipeline (Figure 1) was performed and identified 176 S. japonicum miRNAs, including four known S. japonicum miRNAs, sja-let-7, sja-miR-71a, sja-miR-125 and sja-bantam [17]. [score:1]
Moreover, schistosomes also share some known miRNAs, such as bantam, miR-36, miR-60, miR-2 and miR-71 with Arthropoda and/or Nematoda animals. [score:1]
Here only two miRNA clusters identified by this study exhibited the similar genomic structure and components consisting of miR-71 and miR-2 family members. [score:1]
More interestingly, other miR-71 and miR-2 family members, miR-71a, miR-2d, miR-2b, and miR-2c, were clustered at another genomic locus (CNUS0000007682.1) in an inverted orientation. [score:1]
It should be pointed out that the cluster of miR-2 family members were found in silkworm (Bombyx mori), however, the combination of both miR-2 and miR-71 in the same clusters was not identified in other bilaterian animals. [score:1]
[1 to 20 of 8 sentences]
8
[+] score: 10
In general, more miRNAs were expressed at stages other than the egg, except Sja-mir-2b and Sja-mir-71, which were constantly expressed during all stages with less than 10-fold variations (Fig. 5c). [score:5]
However, the homolog to mir-71, Sja-mir-71, was predominantly expressed in male parasites. [score:3]
Mir-71 was previously found to be expressed in the Drosophila embryo, and it was implicated in controlling cell differentiation[26]. [score:2]
[1 to 20 of 3 sentences]
9
[+] score: 7
Other miRNAs from this paper: sja-let-7, sja-mir-1, sja-mir-71b, sja-mir-124
Xue et al. cloned the miRNA-71a cluster in adult worm and analyzed their expression level across the lifespan of S. japonicum [24, 28]. [score:3]
Subsequently, the same group demonstrated that miRNA-71a cluster and miRNA-71b cluster were expressed in schistosomulum, using deep sequencing and northern blotting. [score:3]
The miRNA-71 family is a conserved microRNA cluster in both S. japonicum and S. mansoni. [score:1]
[1 to 20 of 3 sentences]
10
[+] score: 4
Moreover, it has been shown that five miRNAs (miR-71, miR-71b, miR-1, miR-36, and miR-124) are the most abundant in the egg stage of S. japonicum [34], implying that these miRNAs play important roles in embryo development. [score:2]
Several lines of evidence have shown that highly conserved miR-71 and bantam are packaged in parasite-derived EVs, including from H. polygyrus, B. malayi and S. mansoni, suggesting that conserved miR-71- and bantam-secretion systems might exist in helminths [24, 27, 30]. [score:1]
Although the role of miR-71 secreted by parasites remains unclear, it has been proposed to be involved in host-pathogen interactions [24, 30]. [score:1]
[1 to 20 of 3 sentences]
11
[+] score: 3
Individually, sja-let-7, sja-miR-1 sja-miR-7-5p, sja-miR-3479-5p sja-miR-190-5p, sja-miR-71 and sja-miR-71b-5p have the most putative sites within the sex-biased expressed genes (Fig 5C) of which sja-let-7, sja-miR-1 sja-miR-7-5p are male-biased miRNAs, while sja-miR-71b-5p is female-biased [26]. [score:3]
[1 to 20 of 1 sentences]
12
[+] score: 3
The most highly expressed miRNAs in the parasite, such as sja-miR-71, sja-miR-71b-5p and sja-miR-1 [50], are undetectable in the serum/plasma of animal hosts infected with schistosomes [18, 22]. [score:3]
[1 to 20 of 1 sentences]
13
[+] score: 2
Indeed, most recently five miRNAs were found by direct cloning in S. japonicum that are also conserved in S. mansoni [55]: let-7, mir-71, bantam, mir-125, and a single schistosome-specific microRNA. [score:2]
[1 to 20 of 1 sentences]
14
[+] score: 1
Furthermore, the 8 conserved miRNAs were identified as originating from 6 miRNA families, namely miR-124, miR-2 (miR-2b, miR-2e), bantam, miR-10, let-7 and miR-71 (miR-71, miR-71b). [score:1]
[1 to 20 of 1 sentences]
15
[+] score: 1
Considering the critical role that eggs play in the pathogenesis of schistosomiasis, miRNAs in schistosome eggs have also been analyzed and several miRNAs (sja-miR-71b-5p, sja-miR-71, sja-miR-1, sja-miR-36-3p, and sja-124-3p) were shown to be the most abundant in the egg stage [44]. [score:1]
[1 to 20 of 1 sentences]
16
[+] score: 1
Besides the miR-2 family, another two miRNAs, miR-71 and miR-71b-5p, were also found from one family, which is located on two different scaffolds named as SJC_S000054 and SJC_S000102. [score:1]
[1 to 20 of 1 sentences]