sort by

15 publications mentioning sja-bantam

Open access articles that are associated with the species Schistosoma japonicum and mention the gene name bantam. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 139
Among the differentially expressed genes of 23DSI, we found that in the down-regulated genes of 23DSI, many predicted targets of bantam regulated protein metabolic process, mitotic spindle organisation, embryo development, glucose catabolic process, RNA metabolic process, apoptosis, hexose metabolic process, gene expression, mRNA transport, nematode larval development, multicellular organismal aging, development of primary sexual characteristics, translation, regulation of transcription, signalling, membrane lipid metabolic process, and the glucose metabolic process, among others (Table  1 and Additional file 5: Table S3). [score:15]
In 23 DSI, the high level of bantam and low levels of miR-1, miR-71, miR-7, and miR-7-5p possibly regulated and organised a specific gene expression profile for sexual maturation and egg production by inhibiting and strengthening specific gene expression and metabolic processes. [score:8]
To analyse the effect of the differential expression of miRNAs on female development after pairing, we sequenced the libraries of 23DSI and 23SSI, predicted the target genes of miRNA-1-miRNA-71-miRNA-7-miR-7-5p (Additional file 3: Table S1) and bantam (Additional file 4: Table S2), and analysed the differential expression of these genes in 23DSI compared with 23SSI. [score:7]
In unpaired females (23SSI), bantam was notably not up-regulated, whereas miR-1, miR-71, miR-7, and miR-7-5p were significantly up-regulated. [score:7]
Furthermore, among all samples, bantam was distinctly up-regulated in 23 DSI, and miR-1, miR-71, miR-7-5p, and miR-7 were distinctly up-regulated in 23SSI. [score:7]
After pairing, the up-regulation of bantam was potentially capable of inhibiting a wide range of genes or biological processes. [score:6]
Click here for file Predicted target genes of bantam in down-regulated genes in 23DSI. [score:6]
In 23DSI, the up-regulation of bantam likely inhibited a large number of genes or pathways involved within a wide range of biological functions, including glycometabolism, lipid metabolism, nucleic acid metabolism, protein digestion and utilisation, and other biological processes. [score:6]
Although miRNAs do not regulate all genes in organisms, evidence provided by miRNA analyses in the present study indicated that pairing likely limited the expression of non-essential genes through increasing the expression of bantam and specific genes by maintaining miR-1, miR-71, miR-7, and miR-7-5p at relatively low levels. [score:6]
Predicted target genes of bantam in down-regulated genes in 23DSI. [score:6]
For example, the higher expression of bantam was observed only in 23DSI, whereas higher expression of miR-1, miR-71, miR-7-5p, and miR-7 manifested only in 23SSI (Figure  1B). [score:5]
For instance, in ribosome assembly, 15 of 49 detected genes in this metabolic process were predicted as the target genes of miR-1-miR-71-miR-7-miR-7-5p, whereas only 1 of 49 genes was the predicted target gene of bantam (Figure  3A). [score:5]
The predicted target genes of bantam hardly participated in the proteasome, porphyrin metabolism, ribosome, whereas more predicted target genes of miR-1-miR-71-miR-7-miR-7-5p were involved in these process. [score:5]
Meanwhile, in paired mature females, highly-expressed bantam inhibited more biological pathways, such as the citrate cycle, glycolysis, fatty acid biosynthesis and RNA degradation. [score:5]
Out of the 50 genes, 33 were the predicted target genes of bantam (Figure  3B), whereas only 2 were predicted target genes of miR-1-miR-71-miR-7-miR-7-5p. [score:5]
Differential expression of the predicted target genes of bantam and miRNA-1-miRNA-71-miRNA-7-5p- miR-7 between samples from 23 DSI and 23SSI. [score:5]
Only the amount of bantam in 23DSI was up-regulated far more than that in 18 DSI, 18SSI, or 23 SSI. [score:4]
Conversely, the predicted target genes of bantam were related to the embryo development, development of primary sexual characteristics and regulation of transcription. [score:4]
However, the up-regulation of bantam in 23DSI was associated not only with pairing but also likely played an essential role in female sexual maturation. [score:4]
We found that the target genes of bantam were involved in wi dely different metabolic processes, such as in peroxisome, RNA degradation, mRNA surveillance pathway, axon guidance, basal transcription factors, apoptosis, glycerophospholipid metabolism, insulin signalling pathway, lysosome, regulation of actin cytoskeleton, citrate cycle, gastric acid secretion, glycolysis/gluconeogenesis, protein digestion and absorption, aminoacyl-tRNA biosynthesis, and fatty acid biosynthesis. [score:4]
To confirm the differentially expressed miRNAs in 23DSI, 23SSI, 18DSI, and 18SSI, bantam, miRNA-1, and miR-71 were selected for quantitative RT–PCR analysis. [score:3]
Click here for file Predicted target genes of bantam in Schistosoma japonicum. [score:3]
Predicted target genes of bantam in Schistosoma japonicum. [score:3]
Only several high-abundance miRNAs differentially expressed between 23DSI and 23 SSI, such as bantam, miR-1, miR-71, miR-7, and miR-7-5p. [score:3]
A. Bantam, with respect to 23SSI, was significantly up-regulated in 23DSI (P < 0.01). [score:3]
By contrast, more predicted target genes of bantam were involved in these processes. [score:3]
The results of the RT-PCR showed that bantam was more abundant in 23DSI than in 23SSI, 18DSI, and 18SSI (Figure  2A). [score:1]
[1 to 20 of 27 sentences]
2
[+] score: 124
As shown in Fig 3, transfection of bantam and miR-31 miRNA mimics resulted in a reduction of luciferase activity compared to transfection with scrambled miRNA mimics, indicating that these miRNAs can down-regulate the expression of the corresponding schistosome mRNA target regions in a heterologous system. [score:7]
As shown in Fig 4A, in vivo suppression of bantam resulted in an increase in all three putative target mRNAs (GenBank accession numbers: AY815078, AY223092.1, and FN323394.1) including a target that was independently verified in our mammalian cell assays (S9 Table). [score:6]
qRT-PCR analyses of the expression of miR-31 (A) or bantam miRNA (B) in female schistosomes treated with miRNA inhibitor. [score:5]
Furthermore, using antisense RNA to inhibit miRNAs, we demonstrated that bantam miRNA plays a regulatory role in ovary development and oocyte maturation. [score:5]
miR-1b, miR-61 and miR-281 were highly expressed in males whereas miR-8447, miR-2f, mir-8437, miR-31, bantam, miR-2c, miR-2d, miR-71b, miR-36b and miR-755 were highly expressed in females. [score:5]
From these data, we conclude that bantam and miR-31 are involved in the regulation of target genes that are instrumental in ovary development and oocyte maturation. [score:5]
We also demonstrated that schistosome smad1 (a target gene of bantam) and Frizz7 (a target gene of miR-31) are predominantly localized in the ovary of S. japonicum, consistent with their localization in S. mansoni [88– 90]. [score:5]
To determine whether these miRNAs could repress mRNA targets in vivo in schistosomes, we introduced bantam and miR-31 antisense miRNAs by electroporation into in vitro cultured adult female schistosomes and determined if their target mRNA levels changed using qRT-PCR. [score:5]
The co-localization of the miRNAs and their target mRNAs, at least for bantam miRNA and miR-31, suggest their coordinated involvement in the regulation of ovarian development. [score:5]
We also observed that bantam miRNA suppression leads to a significant increase in mRNA levels of three other identified targets, including a serine-arginine repressor (Accession No. [score:5]
These results suggest that bantam and miR-31 and their target mRNAs play important roles in the development of the structure and architecture of the ovary and in oocyte differentiation. [score:4]
In addition, suppression of female enriched miRNAs such as miR-31 and bantam led to morphological changes in the ovaries of female schistosomes. [score:3]
Transfection of miR-2 (A), Let-7a (B), bantam (C), miR-8 (D and E), miR-31 (F), miR-1989 (G), and miR-3479 mimics (H) into HEK293T or Hela cells led to a significant reduction of luciferase activity from co -transfected plasmids containing their corresponding target regions. [score:3]
Z-Stack of optical sections from S. japonicum ovary treated with scrambled bantam miRNA inhibitor. [score:3]
Movie showing a Z-stack series of the ovary treated with a scrambled bantam miRNA inhibitor. [score:3]
To test whether miR-31 and bantam miRNA suppression would lead to any morphological changes in female schistosomes, 24–28 day-old female worms were cultured in vitro for four days following electroporation of antisense miR-31 or bantam into worms. [score:3]
These findings strongly imply that female enriched miRNAs such as bantam and miR-31 may be key regulators in S. japonicum ovarian development. [score:3]
Z-Stack of optical sections from S. japonicum ovary treated with bantam miRNA inhibitor. [score:3]
Movie showing a Z-stack series of the ovary treated with a bantam miRNA inhibitor. [score:3]
Quantitation of ovary changes due to miR-31 (C) and bantam miRNA suppression (D). [score:3]
By examining the ratio of the total area of ovary to the area occupied by oocytes, miR-31/bantam inhibitor resulted in a significant reduction of parenchymal cells and oocytes in the ovary of female schistosomes (Fig 6C and 6D). [score:3]
We next demonstrated that the target mRNAs of bantam (Smad1) or miR-31 (Frizz7) are also primarily localized in ovary of female schistosomes (S6 Fig and S10 Table). [score:3]
1005423.g003 Fig 3Transfection of miR-2 (A), Let-7a (B), bantam (C), miR-8 (D and E), miR-31 (F), miR-1989 (G), and miR-3479 mimics (H) into HEK293T or Hela cells led to a significant reduction of luciferase activity from co -transfected plasmids containing their corresponding target regions. [score:3]
S9 FigZ-Stack of optical sections from S. japonicum ovary treated with bantam miRNA inhibitor. [score:3]
1005423.g006 Fig 6 Effect of miR-31 (A) or bantam (B) suppression on female ovary architecture and morphology. [score:3]
S10 FigZ-Stack of optical sections from S. japonicum ovary treated with scrambled bantam miRNA inhibitor. [score:3]
Several sex-enriched miRNAs were also previously identified as differentially expressed including sja-miR-7, sja-miR-61, and sja-miR-219 in male worms and sja-bantam in female worms [45, 50]. [score:3]
Suppression of female enriched miRNAs bantam and miR-31 results in morphological alternation of ovaries in female schistosomes. [score:3]
Four female enriched miRNAs (miR-31, bantam, miR-1989 and miR-2c) were shown to be predominantly expressed in the region of ovary (Fig 5A and 5B). [score:3]
We identified several target genes of miR-219 and bantam miRNA using an in combination with bioinformatic analyses. [score:3]
Furthermore, RNA levels of miR-31 and bantam determined by qRT-PCR were also significantly reduced in target/antisense RNA -treated worms compared to control worms (S12 Fig). [score:2]
Moreover, studies in Drosophila [81] indicated that bantam was an effector of several signaling pathways such as Hippo [82, 83], Notch [84], Dpp [85], and epidermal growth factor receptor (EGFR) [86] during fly development. [score:2]
miR-31 and bantam are predominantly present in the ovaries of female schistosomes (Fig 5), suggesting that these miRNAs may play an important role in ovary development. [score:2]
Hela or HEK293T cells were transfected with these recombinant plasmids, control plasmids (pGL3), and the corresponding 2`-O-methyl and phosphorothioate miRNA mimics representing bantam, miR-8, miR-31, miR-1989, miR-3479, or control mimics (scrambled or mismatched seeding region of these miRNA) (S8 Table). [score:1]
To further corroborate these results, we selected two of the female enriched miRNAs, bantam and miR-31, and used in situ hybridization to demonstrate that they predominantly localize to the ovary (Fig 5C and S10 Table). [score:1]
In S. japonicum, Cai et al demonstrated miR-7-5p, miR-61, miR-219-5p, miR-125a, miR-125b, miR-124-3p, and miR-1 were dominant in males, while bantam, miR-71b-5p, miR-3479-5p and miR-Novel-23-5p were predominantly found in the female parasites [45]. [score:1]
We demonstrated in a previous study that S. japonicum bantam can be detected in the circulation of the definitive host [87], suggesting that bantam might be a secretory miRNA that has the potential to act as a signaling molecule for other schistosomes or even host cells [56]. [score:1]
[1 to 20 of 37 sentences]
3
[+] score: 65
Removing one copy of the endogenous bantam gene in drosophila has been shown to enhance, and conversely overexpression of bantam has been shown to suppress, the level of hid -induced apoptosis in the eye [27]. [score:5]
Relation of S. japonicum miRNA expression to life cycle stageUsing the modified stem-loop RT-PCR method described above, we further endeavored to determine the timing of expression patterns of miRNA sja-let-7, sja-miR-71 and sja-bantam across the life span of S. japonicum. [score:5]
Analysis of sja-let-7, sja-miR-71 and sja-bantam expression by stem-loop RT-real time PCR revealed highly stage-specific expression patterns. [score:5]
Interestingly, both sja-miR-71 and sja-bantam showed maximum expression in cercaria (infective stage of the parasite) and their expression then dropped quickly to nadir levels in schistosomulum following penetration of the cercaria into its host. [score:5]
Recent studies have revealed that bantam overexpression mitigates neurodegeneration induced by the pathogenic polyglutamine protein Ataxin-3, which is involved in the human disease spinocerebellar ataxia type 3 (SCA3) [28]. [score:5]
Bantam miRNAs are known regulators of both proliferation and apoptosis, and target the proapoptotic gene hid [27]. [score:4]
In particular, sja-miR-71 and sja-bantam expression reach their peaks in the cercaria stage and then drop quickly to the nadirs in the schistosomulum stage, following penetration of cercaria into a mammalian host. [score:3]
Reduced growth rate observed in the third instar wing disc of drosophila expressing mutant bantam genes could be due to reduced rates of cell proliferation or increased apoptosis, or both. [score:3]
Importantly, the expression of sja-miR-71 and sja-bantam peaked in cercaria and then decreased quickly to their lowest levels in schistosomulum, following host infection. [score:3]
Expression of sja-miR-71 and sja-bantam were 1000-fold and 500-fold higher in cercaria than that in schistosomulum, respectively. [score:3]
Based on these studies, we would expect sja-bantam to take part in developmental processes throughout the lifespan of S. japonicum by regulating cell proliferation and apoptosis. [score:3]
Expression of sja-let-7, sja-miR-71 and sja-bantam were analyzed in six stages of the life cycle, i. e. egg, miracidium, sporocyst, cercaria, schistosomulum, and adult worm, by a modified stem-loop reverse transcribed polymerase chain reaction (RT-PCR) method developed in our laboratory. [score:3]
Using the modified stem-loop RT-PCR method described above, we further endeavored to determine the timing of expression patterns of miRNA sja-let-7, sja-miR-71 and sja-bantam across the life span of S. japonicum. [score:3]
Figure S8 The amplification plot of sja-let-7, sja-mir-71, sja-bantam and alpha tubulin. [score:1]
5, 6, 7 and 8 were the amplification plot of sja-let-7, sja-mir-71, alpha tubulin and sja-bantam, respectively, using the no-RT control. [score:1]
Figure S1 Predicted stem-loop structures for the mir-bantam and mir-125 precursors of S. japonicum and S. mansoni using Vienna RNAfold method. [score:1]
Alignments with known miRNA sequences indicated that four of the five novel S. japonicum miRNAs belong to four different metazoan miRNA families, i. e. let-7, miR-71, bantam, and miR-125 (Figure 3, S3 and S4). [score:1]
1, 2, 3 and 4 were the amplification plot of sja-mir-71, sja-bantam, sja-let-7 and alpha tubulin, respectively, the RT product of cercaria RNAs. [score:1]
miRNA egg miracidium sporocyst cercaria schistosomulum male adult worm female adult worm sja-let-7 1.15±0.96 0.02±0.02 0.24±0.22 5.92±4.02 0.60±0.41 0.75±0.35 0.59±0.13 sja-mir-71 8.68±5.06 3.21±2.17 4.57±0.79 1257.92±565.47 0.91±0.34 1.93±1.41 1.65±0.36 sja-bantam 4.50±2.67 1.69±0. [score:1]
Hence, herein we have tentatively designated the five novel miRNAs from S. japonicum as sja-let-7, sja-miR-71, sja-bantam, sja-miR-125 and sja-miR-new1, respectively. [score:1]
The bugle in the secondary structure of bantam precursor from S. mansoni was disappeared while the bugle from S. japonicum genome remains. [score:1]
Mir-bantam and mir-125 precursor from S. japonicum showed large bulges in their secondary structure predicted by Mfold RNA-fold software. [score:1]
The novel miRNAs were designated as sja-let-7, sja-miR-71, sja-bantam, sja-miR-125 and sja-miR-new1, respectively. [score:1]
However, when using Vienna RNAfold method for structure prediction, mir-125 precursor showed acceptable bulges in their secondary structure while the bugles of bantam precursor remained (see figure S1). [score:1]
In this study, we firstly identified five authentic miRNAs in S. japonicum by constructing and screening parasite cDNA library of size-fractionated RNAs: sja-let-7, sja-miR-71, sja-bantam, sja-miR-125 and sja-miR-new1. [score:1]
miRNA Sequence Size (nt) S. japonicum contig (LSBI, Shanghai) a S. mansoni shortgun reads (Sanger) b Clones c Δ G° [folding] (kcal/mol e) sja-let-7 GGAGGUAGUUCGUUGUGUGGU 21 CNUS0000067197: 5856–5876 shisto12670f07: 651–671 5 −30.8 sja-miR-71 UGAAAGACGAUGGUAGUGAGA 21CNUS0000007682(-) d: 3100–3120 shisto8708d10: 353–372 1 −34.5 sja-bantam UGAGAUCGCGAUUAAAGCUGGU 22 CNUS0000021739: 2223–2244shisto5226g02(-) d: 325–346 6 −22.9 sja-miR-125 UCCCUGAGACCCUUUGAUUGUC 22 CNUS0000024724:7691–7712 Smp_contig001766:3162–3183 2 −25.6 sja-miR-new1 UCCCUGAGACUGAUAAUUGCUC 22CCON0000000380 (-) d:353325–353346:15–36 shisto8125f02.p1k 4 −29.2 alocation of the miRNA sequence within the published chromosomal sequence of S. japonicum. [score:1]
Alignments of the miRNAs with corresponding family members indicated that four of them belong to a metazoan miRNA family: let-7, miR-71, bantam and miR-125. [score:1]
Membranes were incubated with five different biotin-labeled probes (1: sja-let-7, 2: sja-miR-71, 3: sja-bantam, 4: sja-miR-125 and 5: sja-miR-new1). [score:1]
[1 to 20 of 28 sentences]
4
[+] score: 39
Other miRNAs from this paper: sja-mir-10
qRT-PCR analysis of the expression of potential target mRNAs of S. japonicum EVs associated miRNA in miceTo determine potential regulatory roles of the cargo miRNA of S. japonicum EVs in host cells, we performed bioinformatics analyses to predict the target mRNAs for a specific S. japonicum associated miRNA, Bantam miRNA. [score:8]
In Drosophila, Bantam miRNA has been shown to target a tumor-suppress pathway, leading to cellular growth and the suppression of cellular death 45. [score:7]
To determine the potential function of Schistosoma-specific miRNAs in host cells, we used miRanda, TargetScan, and RNAhybrid to predict the mouse target mRNAs of Bantam. [score:5]
In support of this, we determined the mRNA expression of three potential target genes (Gins4, Tysnd1, and Utp3) of schistosome Bantam miRNA in mice. [score:5]
To determine potential regulatory roles of the cargo miRNA of S. japonicum EVs in host cells, we performed bioinformatics analyses to predict the target mRNAs for a specific S. japonicum associated miRNA, Bantam miRNA. [score:4]
qRT-PCR analyses of the expression of mouse cDNAs that are potentially regulated by S. japonicum EV associated Bantam miRNA. [score:4]
Three murine genes (Gins4, Tysnd1, and Utp3) were shown to be potential targets of Bantam miRNA in mice (Fig. 7a). [score:3]
We found that 15 known S. japonicum miRNAs (cut-off reads >100) were present in S. japonicum EVs libraries (Table 2 and Supplementary Dataset 3), including two miRNAs (Bantam and miR-10) identified in the plasma of S. japonicum infected hosts in our previous study 24. [score:1]
Consequently, we hypothesized that schistosome-specific miRNAs, such as Bantam, may be involved in the hepatic pathogenesis of schistosomiasis. [score:1]
Further analyses demonstrated that S. japonicum EV associated miRNAs (Bantam and miR-10) were significantly detected in the RNA isolated form cells treated with labeled S. japonicum EVs (Fig. 6b), indicating that the miRNA cargo of S. japonicum EVs can transfer to recipient cells. [score:1]
[1 to 20 of 10 sentences]
5
[+] score: 21
In Drosophila, bantam miRNA has been shown to target a tumor-suppress pathway, promoting cellular growth and suppressing cellular apoptosis [47]. [score:7]
Several lines of evidence have shown that highly conserved miR-71 and bantam are packaged in parasite-derived EVs, including from H. polygyrus, B. malayi and S. mansoni, suggesting that conserved miR-71- and bantam-secretion systems might exist in helminths [24, 27, 30]. [score:1]
Moreover, egg EVs associated miRNAs (i. e. Sja-miR-71b and Sja-bantam) were detectable in the primary hepatocytes of mice infected S. japonicum. [score:1]
More importantly, we found that the parasite-specific miR-71b and bantam were present in the primary hepatocytes of S. japonicum infected mice after numerous eggs deposited in the liver. [score:1]
Then, stem-loop qRT-PCR was performed to verify the presence of Sja-bantam and Sja-miR-71b in the RNA isolated from schistosomal egg EVs (Fig.   2d). [score:1]
Interestingly, bantam and miR-10 were significantly enriched in the libraries of EVs derived from schistosomal adult worms, whereas miR-3479-3p did not appear in those EV libraries [33]. [score:1]
b, c The PCR products of Sja-miR-71b (68 bp) and Sja-bantam (67 bp). [score:1]
Fig. 4qRT-PCR analysis of the Sja-miR-71b and Sja-bantam level in primary hepatocytes of infected mice. [score:1]
qRT-PCR analysis of the treated cells demonstrated that schistosomal egg EVs associated miRNAs (bantam and miR-71b) were detectable in Hepa1-6 cells after 20 h of incubation with parasite EVs (Fig.   3b). [score:1]
We found 13 known S. japonicum miRNAs (reads >100) present in the schistosomal egg EV libraries (Table  2 and Additional file 2: Table S1), including three miRNAs (miR-10, bantam and miR-3479-3p) that were present in the plasma of S. japonicum infected host rabbits in a previous study [39]. [score:1]
b Relative level of parasite-derived miRNAs (i. e. bantam and miR-71b) in murine liver cells 20 h post-incubation with 10 μg  S. japonicum egg EVs following PBS washing. [score:1]
a qRT-PCR analysis of two of the miRNAs that are associated with S. japonicum egg EVs (i. e. Sja-miR-71b and Sja-bantam) in primary hepatocytes of infected mice at 49 dpi and 80 dpi. [score:1]
d qRT-PCR validation of the abundance of Sja-bantam and Sja-miR-71b in the RNA isolated from S. japonicum egg EVs. [score:1]
In the present study, we observed that Sja-miR-71b and Sja-bantam are also incorporated into the EVs derived from schistosomal eggs and these miRNAs can be transferred to murine liver cells via EVs in vitro. [score:1]
Among the 13 known Sja-miRNAs identified in the egg EVs, Sja-bantam, Sja-miR-10 and Sja-miR-3479-3p were all previously detected in serum obtained from rabbits infected with S. japonicum [39]. [score:1]
[1 to 20 of 15 sentences]
6
[+] score: 11
We observed 2 miRNAs (mir-2 and mir-71) expressed in both life cycle stages tested, 7 in adult worms only (mir-4, mir-6, mir-9, mir-32, mir-125, mir-3, mir-5) and 5 in schistosomula only (mir-20, mir-18, mir-22, mir-26, Bantam). [score:3]
We also analyzed in S. mansoni the expression of the five novel miRNAs recently identified in S. japonicum (sja-let-7, sja-miR-71, sja-bantam, sja-miR-125 and sja-miR-new1) [37]. [score:3]
Although the expression of sja-miR-71 and sja-bantam dropped quickly in S. japonicum lung-stage schistosomulum, we observed a strong hybridization signal for both miRNAs in S. mansoni (Figure 1) [37]. [score:3]
In vivo experiments indicate a crucial role in cell proliferation and cell death processes for some miRNAs, including lin-4 and let-7 in C. elegans; bantam and mir-14 in Drosophila; and mir-23 in humans [10]. [score:1]
miR-71, miR-125 and Bantam are the miRNAs identified in S. mansoni homolog to miRNAs of S. japonicum [38]. [score:1]
[1 to 20 of 5 sentences]
7
[+] score: 10
Here, we observed that the expression of a set of miRNAs including sja-bantam, sja-miR-1, sja-miR-124-3p, sja-miR-2a-3p, sja-miR-3492, and sja-miR-36-3p was substantially down-regulated in lung-stage schistosomula compared to cercariae (Table S6), suggesting that the target mRNAs of these miRNAs may encode proteins fulfilling important functions at this stage. [score:7]
The expression of a set of miRNAs, sja-miR-7-5p, sja-miR-61, sja-miR-219-5p, sja-miR-125a, sja-miR-125b, sja-miR-124-3p and sja-miR-1 were dominant in male worms, while sja-bantam, sja-miR-71b-5p, sja-miR-3479-5p, and sja-Novel-23-5p were predominantly found in the female parasites (Table S6 and S9). [score:3]
[1 to 20 of 2 sentences]
8
[+] score: 6
The result showed that some miRNA genes, including miRNA-2e-5p, miRNA-2e-3p, miR-71b, miR-2a, miR-2f, miR-124 and miR-31, tended to be enriched in immature worms, whereas miR-125, miR-8 and bantam exhibited a higher abundance in mature adults (Figure 3D), suggesting that different miRNAs could play a distinct role in different development stages. [score:2]
According to the published criteria for distinguishing bilaterian miRNAs from other types of small RNAs [4], [28], [29], a bioinformatics pipeline (Figure 1) was performed and identified 176 S. japonicum miRNAs, including four known S. japonicum miRNAs, sja-let-7, sja-miR-71a, sja-miR-125 and sja-bantam [17]. [score:1]
Some miRNA genes, including miRNA-2e-5p, miRNA-2e-3p, miR-71b, miR-2a, miR-2f, miR-124 and miR-31, seem to be preferentially enriched in immature worms, whereas miR-125, miR-8 and bantam exhibited a higher abundance in mature adults (Figure 3D). [score:1]
In addition to known S. japonicum miRNAs, sja-let-7, sja-miR-71a, sja-miR-125 and sja-bantam [17], the remaining 172 miRNAs were first recognized in S. japonicum. [score:1]
Moreover, schistosomes also share some known miRNAs, such as bantam, miR-36, miR-60, miR-2 and miR-71 with Arthropoda and/or Nematoda animals. [score:1]
[1 to 20 of 5 sentences]
9
[+] score: 6
In contrast, few target sites have been predicted for sja-miR-125b and sja-bantam, two miRNAs abundantly expressed in male and female worms, respectively, indicating that they may regulate non-gender -associated genes. [score:6]
[1 to 20 of 1 sentences]
10
[+] score: 6
Three circulating S. mansoni-derived miRNAs, sma-miR-277, sma-miR-3479-3p and sma-bantam, have been shown to have potent diagnostic value in detecting S. mansoni infection [18], but in the current study, only two orthologs, sja-miR-277 and sja-miR-3479-3p, could be reliably detected in the sera of the two mouse strains infected with S. japonicum. [score:1]
Detection of parasite-derived miRNAs in the serum of C57BL/6 and BALB/c mice during S. japonicum infectionUsing a deep sequencing method, Cheng et al. identified the presence of five schistosome-specific miRNAs (sja-bantam, sja-miR-3479-3p, sja-miR-10-5p, sja-miR-3096 and sja-miR-8185) in the plasma of S. japonicum-infected rabbits. [score:1]
More recently, it was shown that S. mansoni-derived miRNAs (miR-277, miR-3479-3p and bantam) in serum could discriminate infected from uninfected individuals [18]. [score:1]
Three of these (sja-bantam, sja-miR-3479-3p, sja-miR-10-5p) were further detected in the plasma of S. japonicum-infected mice by stem-loop RT-PCR analysis [22]. [score:1]
Using a deep sequencing method, Cheng et al. identified the presence of five schistosome-specific miRNAs (sja-bantam, sja-miR-3479-3p, sja-miR-10-5p, sja-miR-3096 and sja-miR-8185) in the plasma of S. japonicum-infected rabbits. [score:1]
We thus carried out RT-qPCR analysis to determine the dynamic serum levels of five parasite-derived miRNAs (sja-bantam, sja-miR-3479-3p, sja-miR-3096, sja-miR-8185 and sja-miR-277) during S. japonicum infection. [score:1]
[1 to 20 of 6 sentences]
11
[+] score: 4
Blue: the largest family members of miR-2. Two conserved miRNAs named as bantam and let-7 were found in both S. japonicum and S. mansoni miRNAs. [score:1]
The miRNAs bantam and let-7 are conserved miRNAs found in 27 other organisms with miRNAs deposited in the miRBase database, while the let-7 was found distributed in a larger range of 67 other organisms, including invertebrates and vertebrates. [score:1]
Blue: the largest family members of miR-2. Two conserved miRNAs named as bantam and let-7 were found in both S. japonicum and S. mansoni miRNAs. [score:1]
However, among the 13 known miRNAs only bantam and let-7 were found from both S. japonicum and S. mansoni. [score:1]
[1 to 20 of 4 sentences]
12
[+] score: 2
Indeed, most recently five miRNAs were found by direct cloning in S. japonicum that are also conserved in S. mansoni [55]: let-7, mir-71, bantam, mir-125, and a single schistosome-specific microRNA. [score:2]
[1 to 20 of 1 sentences]
13
[+] score: 1
Furthermore, the 8 conserved miRNAs were identified as originating from 6 miRNA families, namely miR-124, miR-2 (miR-2b, miR-2e), bantam, miR-10, let-7 and miR-71 (miR-71, miR-71b). [score:1]
[1 to 20 of 1 sentences]
14
[+] score: 1
In female worms, the most highly transcribed miRNAs were sha-mir-71a (3.6% of mapped sRNA reads), sha-mir-1 (2.0%), sha-mir-71b (0.7%), sha-mir-125b (0.7%) and sha-bantam (0.3%) (S1 Table). [score:1]
[1 to 20 of 1 sentences]
15
[+] score: 1
In addition to the identification of the miRNA* strand, we were able to identify the loop sequences of a small number of pre-miRNAs hence accounting for all products of Dicer cleavage(let-7, bantam in Table S2). [score:1]
[1 to 20 of 1 sentences]