sort by

8 publications mentioning sma-let-7

Open access articles that are associated with the species Schistosoma mansoni and mention the gene name let-7. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 8
We also analyzed in S. mansoni the expression of the five novel miRNAs recently identified in S. japonicum (sja-let-7, sja-miR-71, sja-bantam, sja-miR-125 and sja-miR-new1) [37]. [score:3]
The other 2 candidates detected in S. japonicum (new-1 and let-7) may be expressed in other life cycle stages or in undetectable amounts in S. mansoni in the life cycle stages tested. [score:3]
Forty-two sequences had at least one match with mature miRNAs from different metazoan miRNA families, such as miR-832, miR-71, miR-297, and let-7 (Table 1). [score:1]
In vivo experiments indicate a crucial role in cell proliferation and cell death processes for some miRNAs, including lin-4 and let-7 in C. elegans; bantam and mir-14 in Drosophila; and mir-23 in humans [10]. [score:1]
[1 to 20 of 4 sentences]
2
[+] score: 6
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-21, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-9-2, mmu-mir-151, mmu-mir-10b, hsa-mir-192, mmu-mir-194-1, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-122, hsa-mir-10a, hsa-mir-10b, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-210, hsa-mir-214, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-122, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-194-1, mmu-mir-192, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-21a, mmu-mir-10a, mmu-mir-210, mmu-mir-214, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-9-1, mmu-mir-9-3, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-365a, mmu-mir-365-1, hsa-mir-365b, hsa-mir-151a, gga-let-7i, gga-let-7a-3, gga-let-7b, gga-let-7c, gga-mir-16-1, gga-mir-194, gga-mir-10b, gga-mir-199-2, gga-mir-16-2, gga-let-7g, gga-let-7d, gga-let-7f, gga-let-7a-1, gga-mir-199-1, gga-let-7a-2, gga-let-7j, gga-let-7k, gga-mir-122-1, gga-mir-122-2, gga-mir-9-2, mmu-mir-365-2, gga-mir-9-1, gga-mir-365-1, gga-mir-365-2, hsa-mir-151b, mmu-mir-744, gga-mir-21, hsa-mir-744, gga-mir-199b, gga-mir-122b, gga-mir-10a, gga-mir-16c, gga-mir-214, sma-mir-71a, sma-bantam, sma-mir-10, sma-mir-2a, sma-mir-3479, sma-mir-71b, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-let-7k, gga-mir-365b, sma-mir-8437, sma-mir-2162, gga-mir-9-3, gga-mir-210a, gga-mir-9-4, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3, gga-mir-9b-1, gga-mir-10c, gga-mir-210b, gga-let-7l-1, gga-let-7l-2, gga-mir-122b-1, gga-mir-9b-2, gga-mir-122b-2
Interestingly, Xue et al. (2008) showed that three of the miRNAs that we find in serum (sja-bantam, sja-miR-71 and sja-let-7) are expressed during all the stages of parasite development but are enriched in the cercariae, suggesting that they may be important during the initial stages of schistosome infection [65]. [score:4]
The other 2 miRNAs, sma-miR-10-5p and sma-let-7-3p, were excluded from analysis because they are highly similar to homologous mouse miRNAs that are present at >100 fold higher read frequencies (Table S3). [score:1]
22875816:+ 3sma-let-7-3p 3 CAUACAACCGACUGGCUUUCC S_mansoni. [score:1]
[1 to 20 of 3 sentences]
3
[+] score: 4
The miRNAs bantam and let-7 are conserved miRNAs found in 27 other organisms with miRNAs deposited in the miRBase database, while the let-7 was found distributed in a larger range of 67 other organisms, including invertebrates and vertebrates. [score:1]
Blue: the largest family members of miR-2. Two conserved miRNAs named as bantam and let-7 were found in both S. japonicum and S. mansoni miRNAs. [score:1]
Blue: the largest family members of miR-2. Two conserved miRNAs named as bantam and let-7 were found in both S. japonicum and S. mansoni miRNAs. [score:1]
However, among the 13 known miRNAs only bantam and let-7 were found from both S. japonicum and S. mansoni. [score:1]
[1 to 20 of 4 sentences]
4
[+] score: 2
Indeed, most recently five miRNAs were found by direct cloning in S. japonicum that are also conserved in S. mansoni [55]: let-7, mir-71, bantam, mir-125, and a single schistosome-specific microRNA. [score:2]
[1 to 20 of 1 sentences]
5
[+] score: 2
One of the sequences, let-7, is also found in our datasets but we do not confidently assign this to nematode origin given its conservation in the mammalian host. [score:1]
Of note, miR-92 and let-7 were detected in some of the libraries however the mature miRNAs are perfectly conserved between nematodes and mammals. [score:1]
[1 to 20 of 2 sentences]
6
[+] score: 2
Other miRNAs from this paper: sma-mir-124a, sma-mir-124b
Subsequent larval development from L3 to L4 is controlled in part by miRNAs of the let-7 family [35]. [score:2]
[1 to 20 of 1 sentences]
7
[+] score: 1
Indeed, only two of the reported 211 microRNAs were confirmed in our analyses (mir-71a and let-7). [score:1]
[1 to 20 of 1 sentences]
8
[+] score: 1
The most highly transcribed miRNAs in male worms were sha-mir-1 (5.9% of mapped sRNA reads), sha-mir-71a (5.8%), sha-mir-125b (1.6%), sha-mir-7a (1.0%) and sha-let-7 (0.6%). [score:1]
[1 to 20 of 1 sentences]