sort by

7 publications mentioning aae-mir-989

Open access articles that are associated with the species Aedes aegypti and mention the gene name mir-989. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 42
In C. quinquefasciatus infected with WNV, miR-989 was down-regulated 2.8 fold, and in A. gambiae it was up-regulated 4 times in the midgut and down-regulated to almost half in the rest of the body [29], [42]. [score:10]
In the nucleus, miR-989 and miR-306-5p were down-regulated and miR-2765 and Bantam-5p were up-regulated. [score:7]
Changes in the cytoplasm were more pronounced, bantam-5p, miR-8-3p, miR-263a-5p, miR-989, miR-1889-5p and miR-92a-3p were down-regulated and dropped from the list of the most abundant miRNAs, while the other six miRNAs were up-regulated; miR-14, miR-71-3p, miR-100, miR-11-3p, miR-125-5p and miR-306-5p (Table 1). [score:7]
miR-989 was among the highly expressed miRNAs and was down-regulated in the nucleus and the cytoplasm in Wolbachia-infected cells (Table 1). [score:6]
In Anopheles gambiae, four miRNAs miR-34, miR-1174, miR-1175, and miR-989 changed their expression levels during Plasmodium infection [42]. [score:3]
In Culex quinquefasciatus, two miRNAs were detected to change expression levels during the infection with the West Nile Virus (WNV) flavivirus, miR-989 and miR-92 [29]. [score:3]
The expression of miR-989 was found to be restricted to the ovaries in Anopheles stephensi and Ae. [score:3]
aegypti and Wolbachia, miR-989 was also highly impacted after infection. [score:1]
Deep sequencing results from this study are in agreement with those found in mosquitoes and similar results were found for those miRNA changing levels, i. e. miR-2941, miR-970, miR-989 and miR-210; however, other miRNAs such as miR-2940 or miR-309 showed differences probably due to the nature of the cell line type that we used for our deep sequencing. [score:1]
Notably, miR-989 was affected in both infections with different parasites and different mosquito species as hosts. [score:1]
[1 to 20 of 10 sentences]
2
[+] score: 14
Especially for miR-989, which is highly expressed in the female mosquitoes, but shows almost no detected expression in male mosquitoes, indicating that miR-989 may be involved in the physiological activity of female mosquito adults. [score:5]
Especially for miR-989, which has only 2 read counts in the male adult but 1,324 read counts in the female adult, the expression level in females is more than 300 times that in males. [score:3]
As described above, the expression count of miR-989 in female adults is signally abundant than that in male adult by sequencing, and miR-989 was only detected in the female adults, there was no signal in embryo, larvae, pupa and male stages by northern blot. [score:3]
Li et al. (2009) also found that miR-989 has only 2 read counts in the embryo stage, but has 33 read counts in the sugar fed midgut of female adults, indicating that miR-989 may be involved in the physiological activity of female mosquitoes [13]. [score:1]
The results of miR-1000, −184, −2943 and miR-989 with mirVana miRNA isolation kit are similar to the patterns with trizol isolation (Additional file 4: Figure S2). [score:1]
Probe sequences were as follow, aan-miR-184: CCCTTATCAGTTCTCCGTCCA; aan-miR-989: GTACCACTACGTCACATCACA; aan-miR-998: GAGCTGAATCTCATG GTGCTA; aan-miR-2943: TTTGCCTGCAAGTGCCTACTTAA; aan-miR-1000: ACTG CTGTGTCAGGCAATAT. [score:1]
[1 to 20 of 6 sentences]
3
[+] score: 8
albopictus and DENV2 infection specifically in the midgut tissue, three miRNAs (miR-2941, miR-989, miR-2943) were differentially expressed [29], the first two also with change in abundance upon ZIKV infection in this study. [score:3]
albopictus DENV2-infected mosquitoes, overlapping differentially abundant miRNAs with ZIKV-infected mosquitoes from this study are miR-2940-3p (depleted in DENV, but enriched in ZIKV), miR-263a-5p (depleted in both), miR-308-5p (enriched in both), miR-989 (depleted in DENV, but enriched in ZIKV), and miR-2941 (depleted in both) [27]. [score:1]
These include, miR-308-5p, miR-263a-5p, miR-305-5p, miR-989, miR-2941, miR-286b, miR-2946. [score:1]
Furthermore, miR-989 was found to be depleted in Culex quinquefasciatus mosquitoes by 2.8-fold when infected with WNV [30]; although this miRNA was enriched by about 1.8-fold at 2 and 14 dpi with ZIKV in the present study. [score:1]
Some miRNAs such as aae-miR263a-5p, aae-miR-286, aae-miR-305-5p, aae-miR308-5p, aae-miR-989 and aae-miR-980-3p can potentially bind to more than one place in the viral genome. [score:1]
The abundance of a few miRNAs was altered in more than one time point after ZIKV infection including, aae-miR-309a, aae-miR-308, aae-miR-286b, aae-miR-2941 and aae-miR-989. [score:1]
[1 to 20 of 6 sentences]
4
[+] score: 7
However, we have shown that miR-x2 (miR-989) is predominantly expressed in ovaries in both An. [score:3]
Winter and colleagues state that miR-989 (miR-x2) is expressed only in midguts of An. [score:3]
gambiae miR-996 and miR-989, respectively [42] and homologs of these two miRNAs are found in the expanded list of Drosophila miRNAs [40, 41]. [score:1]
[1 to 20 of 3 sentences]
5
[+] score: 3
As shown in the last two columns of Table 2, except for miR-989 and miR-281*, all miRNAs showed an increase after blood feeding. [score:1]
Thus, the northern results are largely consistent with the data shown in Table 1. We have previously analyzed the level of miR-989 in the midgut before and after blood feeding [27]. [score:1]
The signal was too weak to confirm or rule out reduction of miR-989 after blood feeding. [score:1]
[1 to 20 of 3 sentences]
6
[+] score: 2
The 3′ multiple nucleotide extension (3MNE) class of isomiRs displayed statistically significant induction in response to DENV infection in miR-285-3p, miR-989-3p and miR-10-5p (Fig. 2A). [score:1]
Significant changes in the read counts of the 3′ single nucleotide extension (3SNE) class of isomiRs with respect to DENV infection were also observed for miR-989-3p, miR-306-3p, miR-34-5p, and miR-2b-3p (Fig. 2B). [score:1]
[1 to 20 of 2 sentences]
7
[+] score: 1
Bantam was the most abundant miRNA overall and in the adult carcasses, mir-996 was the most abundant miRNA in embryos, and mir-989 was the most abundant miRNA in the ovaries. [score:1]
[1 to 20 of 1 sentences]