sort by

6 publications mentioning aae-mir-12

Open access articles that are associated with the species Aedes aegypti and mention the gene name mir-12. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 227
Other miRNAs from this paper: aae-mir-2940
This finding was further scrutinized by testing the logical prediction generated by the experiment that if indeed artificially inducing aae-miR-12 could mimic Wolbachia’s down-regulation of MCT1 and MCM6 genes, then conversely inhibiting aae-miR-12 in Wolbachia-infected cells should reverse the down-regulation of these genes. [score:9]
Upon transfection of Wolbachia-infected cells with the miRNA inhibitor of aae-miR-12, it was discovered that this treatment could in fact prevent Wolbachia from down -regulating MCT1 and MCM6, providing further evidence in support of the hypothesis that aae-miR-12 interacts with the respective predicted target sites in both of the target genes. [score:8]
In this study, the regulatory role of another differentially expressed mosquito miRNA, aae-miR-12, which is up-regulated by Wolbachia, is described. [score:7]
Aae-miR-12 Transfection Mimics the Effect of Wolbachia in Regards to MCM6 and MCT1 RegulationTo confirm that down-regulation of MCM6 and MCT1 in Wolbachia-infected Aag2 cells was a result of aae-miR-12 interaction with the target genes, additional experiments were conducted transfecting Aag2 uninfected cells with the synthetic aae-miR-12 mimic. [score:7]
Using bioinformatic techniques to predict possible targets and qRT-PCR to quantify the mRNA transcript levels of those targets across various treatments, we aimed to characterize the gene target(s) of aae-miR-12 which was found to be differentially expressed in A. aegypti mosquitoes infected with Wolbachia when the previous microarray data [11] were further analyzed. [score:7]
Further experimentation in insect cell lines concluded that this was a direct result of the up-regulation and subsequent interaction of aae-miR-12 with the targets. [score:7]
To confirm that down-regulation of MCM6 and MCT1 in Wolbachia-infected Aag2 cells was a result of aae-miR-12 interaction with the target genes, additional experiments were conducted transfecting Aag2 uninfected cells with the synthetic aae-miR-12 mimic. [score:6]
Subsequently, we proceeded to test the hypothesis that if indeed aae-miR-12 is responsible for the down-regulation of MCM6 and MCT1 then transfection of a synthetic aae-miR-12 inhibitor would rescue the mRNA transcript levels of these genes in Wolbachia-infected cells. [score:6]
In these cells, transfection with the synthetic aae-miR-12 inhibitor decisively up-regulated the MCM6 and MCT1 transcripts. [score:6]
Inhibition of aae-miR-12 Reduces the Wolbachia Density in Mosquito Cell LineGiven that Wolbachia infection regulates the expression of aae-miR-12 in mosquitoes, we hypothesised that this miRNA has a crucial role in mediating the presence of cellular proteins, which serve to further the bacterium’s ability to persist in the cells. [score:6]
To further confirm the specific interaction of aae-miR-12 with the targets, two mutant mimics of aae-miR-12, with point mutations in the regions where substantial sequence complementarity with the target exists (see Material & Methods for details), were used in similar but independent experiments. [score:6]
qRT-PCR results showed that whilst a control inhibitor with scrambled sequence had little effect on the number of detectable copies on the wsp gene in Wolbachia-infected cells, transfection of the aae-miR-12 inhibitor significantly reduced Wolbachia density. [score:5]
qPCR analysis of DNA isolated from aag2- wMelPop-CLA cells mock -transfected, transfected with the control inhibitor or aae-miR-12 inhibitor. [score:5]
Equal numbers of aag2- wMelPop-CLA cells were mock -transfected, transfected with the synthetic aae-miR-12 inhibitor or the control inhibitor. [score:5]
The results indicated that as opposed to the mock and the control inhibitor treatments, aae-miR-12 inhibitor substantially reduced the density of Wolbachia in the host cells (Figure 7 ; p = 0.0049). [score:5]
Validation of aae-miR-12 interaction with MCT1 and MCM6 target genes using miRNA inhibitors. [score:5]
The aae-miR-12 inhibitor (reverse complement RNA oligo) and mimic (UGAGUAUUACAUCAGGUACUGGU) were synthesized by Genepharma along with control “scramble” inhibitor (UCUACUCUUUCUAGGAGGUUGUGA) and mimic (UUCUCCGAACGUGUCACGUTT). [score:5]
To test the interaction of aae-miR-12 with ORF target sites of both the MCT1 and MCM6 genes, both target sites were cloned downstream of a GFP reporter gene in the commercially available pIZ/V5 vector. [score:5]
Wolbachia Induces Suppression of MCM6 and MCT1 Genes in A. aegypti CellsGiven the knowledge that wMelPop-CLA infected mosquitoes showed significant induction of aae-miR-12 when compared to uninfected mosquitoes [11], we tested the hypothesis that this miRNA has a regulatory effect on A. aegypti target genes predicted using bioinformatics analysis, which in turn allows the bacterium to colonize its host more effectively. [score:5]
Our study has identified two target genes of aae-miR-12, a differentially expressed mosquito miRNA in Wolbachia-infected cells, and determined that the miRNA affects Wolbachia density in the host cells. [score:5]
0050049.g004 Figure 4Validation of aae-miR-12 interaction with MCT1 and MCM6 target genes using miRNA inhibitors. [score:5]
We derived the hypothesis that if indeed Wolbachia had a role to play in regulating cellular proteins through induction of aae-miR-12, then inhibiting this process would somehow have a detrimental effect on the ability of Wolbachia to persist in the host cell. [score:4]
In the case of MCT1 and MCM6, the difference was concurrent with the up-regulation of aae-miR-12 in Wolbachia-infected (+Wol) mosquitoes based on further analysis of the microarray data [11]. [score:4]
These targets, MCM6 and MCT1 genes, were functionally validated and demonstrated to be under the regulative control of aae-miR-12 both in vitro and in vivo. [score:4]
Bioinformatic approaches predicted a list of potential target genes and subsequent functional analyses confirmed that two of these, DNA replication licensing (MCM6) and monocarboxylate transporter (MCT1), are under the regulative control of aae-miR-12. [score:4]
Given that Wolbachia infection regulates the expression of aae-miR-12 in mosquitoes, we hypothesised that this miRNA has a crucial role in mediating the presence of cellular proteins, which serve to further the bacterium’s ability to persist in the cells. [score:4]
qRT-PCR analysis of RNA extracted from aag2- wMelPop-CLA cells mock -transfected, transfected with aae-miR-12 inhibitor and control inhibitor and analysed with specific primers to (A) MCM6 and (B) MCT1. [score:4]
These findings may lend themselves to the hypothesis that aae-miR-12 is interacting with target sites in both MCT1 and MCM6, but the fact that the nature of the interaction differs depending on the cellular circumstances highlights the detail that the precise method of transcript regulation is still elusive. [score:4]
The A. aegypti MCM6, Exoculease and MCT1 were predicted to be the best targets of aae-miR-12 with significant sequence complementarities. [score:3]
Based on the prior knowledge that one of these miRNAs, aae-miR-12, is differentially expressed in mosquitoes infected with Wolbachia, we aimed to determine any significance of this mediation. [score:3]
Validation of aae-miR-12 interaction with MCT1 and MCM6 target genes using miRNA mimics. [score:3]
0050049.g007 Figure 7Inhibition of aae-miR-12 affects Wolbachia density. [score:3]
These candidates were then analysed with the RNAHybrid and RNA22target prediction software to confirm their potential interaction with aae-miR-12 as well as all possible binding sites for the miRNA. [score:3]
Given the knowledge that wMelPop-CLA infected mosquitoes showed significant induction of aae-miR-12 when compared to uninfected mosquitoes [11], we tested the hypothesis that this miRNA has a regulatory effect on A. aegypti target genes predicted using bioinformatics analysis, which in turn allows the bacterium to colonize its host more effectively. [score:3]
0050049.g001 Figure 1The A. aegypti MCM6, Exoculease and MCT1 were predicted to be the best targets of aae-miR-12 with significant sequence complementarities. [score:3]
0050049.g002 Figure 2qRT-PCR analysis of predicated target genes of aae-miR-12 in aag2- wMelPop-CLA and uninfected Aag2 cells. [score:3]
qRT-PCR analysis of predicated target genes of aae-miR-12 in aag2- wMelPop-CLA and uninfected Aag2 cells. [score:3]
Surprisingly, when GFP was used as a reporter gene in the pIZ vector, downstream of which target sites for both MCT1 and MCM6 genes, respectively, were cloned and then transfected into Sf9 cells, the synthetic aae-miR-12 mimic had the effect of significantly increasing GFP transcript levels rather than decreasing them. [score:3]
0050049.g003 Figure 3Validation of aae-miR-12 interaction with MCT1 and MCM6 target genes using miRNA mimics. [score:3]
The A. aegypti genome was screened for potential targets bearing homology to aae-miR-12 using NCBI BLAST. [score:3]
Inhibition of aae-miR-12 Reduces the Wolbachia Density in Mosquito Cell Line. [score:3]
Confirmation of the interaction of aae-miR-12 with the predicted targets was first attempted through the use of a synthetic aae-miR-12 mature miRNA mimic in cells not infected with Wolbachia to see if aae-miR-12 alone could mimic Wolbachia’s effect on MCT1 and MCM6 genes. [score:3]
Inhibition and Mimic of aae-miR-12 in Mosquito Cell Line. [score:3]
Aae-miR-12 Positively Interacts with MCM6 and MCT1 Target Sites in Sf9 Cells. [score:3]
Bioinformatics Predicts MCM6, MCT1 and Exonuclease as Targets for aae-miR-12. [score:3]
Inhibition of aae-miR-12 affects Wolbachia density. [score:3]
Predicted targets of aae-miR-12. [score:3]
Aae-miR-12 Transfection Mimics the Effect of Wolbachia in Regards to MCM6 and MCT1 Regulation. [score:2]
Fragments approximately 250 bp long from both MCM6 and MCT1 containing the target sequences of aae-miR-12 were amplified from total A. aegypti RNA using primers that were designed to amplify these fragments with specific restriction sites XbaI and SacII (New England Biosciences) for cloning into the pIZ vector. [score:2]
In addition, results suggested that aae-miR-12 is essential for Wolbachia replication/maintenance in the host cells. [score:1]
The reduced transcript levels in Aag2 cells transfected with aae-miR-12 mimics were consistent with those of the aag2- wMelPop-CLA cells (Figure 2 ). [score:1]
These were subsequently co -transfected into Sf9 cells (derived from Spodoptera frugiperda) together with a control mimic or aae-miR-12 mimic. [score:1]
We also demonstrated that aae-miR-12 is critical in the persistence of Wolbachia in the host cell. [score:1]
qRT-PCR analysis of RNA extracted from Sf9 cells co -transfected with either (A) pIZ-GFP- MCM6 (pIZ/MCM6) or (B) pIZ-GFP- MCT1 (pIZ/MCT1) constructs and control mimic (C -mimic) or aae-miR-12 mimic. [score:1]
This suggests that aae-miR-12 plays a critical role in modifying the cellular environment of the endosymbiont’s host in order to increase that environment’s habitability for Wolbachia by changing the levels of MCM6 and MCT1 proteins within the cell. [score:1]
Aag2 cells that were transfected with the synthetic aae-miR-12 mimic showed significantly reduced transcript levels for both the MCM6 and MCT1 genes 72 h post-transfection (Figure 3A, C ; p = 0.000224, p = 0.001255). [score:1]
NCBI BLAST searches were utilized to generate a list of homologies between the aae-miR-12 and genes within the A. aegypti genome. [score:1]
In order to test this hypothesis, we transfected Aag2 cells infected with Wolbachia with aae-miR-12 inhibitors and measured the effect this had on Wolbachia density using the wsp gene as an indicator. [score:1]
0050049.g006 Figure 6qRT-PCR analysis of RNA extracted from Sf9 cells co -transfected with either (A) pIZ-GFP- MCM6 (pIZ/MCM6) or (B) pIZ-GFP- MCT1 (pIZ/MCT1) constructs and control mimic (C -mimic) or aae-miR-12 mimic. [score:1]
In addition, further functional analyses demonstrated the crucial role aae-miR-12 plays in Wolbachia’s fitness in the mosquito cell line tested. [score:1]
It was determined that whilst very little difference could be observed in the levels of GFP reporter transcripts between the mock and the control mimic treatments (p>0.05), there were significantly higher levels of GFP transcripts in those cells transfected with the aae-miR-12 mimic (Figure 6 ; p = 0.003, p = 0.006). [score:1]
In conclusion, we have demonstrated the importance of the cellular miRNA aae-miR-12 in Wolbachia colonization of A. aegypti Aag2 cells. [score:1]
[1 to 20 of 62 sentences]
2
[+] score: 18
Deep sequencing data revealed that in the nucleus of mosquito cells infected with Wolbachia, the expression of miR-1, miR-10 and miR263a-3p was suppressed and 11 other miRNAs were induced; miR-9a, miR-12-3p, miR-124, miR-125-5p, miR-282-5p, miR-308-5p, miR-932-3p, miR-965, miR-988-5p, miR-1000 and miR-1175-5p (Figure 8A). [score:5]
Finally, Osei-Amo et al (2012) found that the up-regulation of aae-miR-12 in infected cells with Wolbachia affects the transcript levels of DNA replication licensing (MCM6) and monocarboxylate transporter (MCT1) genes. [score:4]
If we consider miRNA reads of the nucleus and the cytoplasm together, we identified a total of 83 miRNAs from which miR-210 and miR-932-5p were suppressed by the presence of Wolbachia and 12 were induced; miR-9a, miR-12-3p, miR-33, miR-79-3p, miR-124, miR-219, miR-286b, miR-308-5p, miR-932-3p, miR-965, miR-988-5p and miR-1000 (Figure 8C). [score:3]
In the cytoplasm, miR-11-5p, miR-92a-5p, miR-210, miR-932-5p and miR-1175-5p were suppressed and 14 miRNAs were induced; miR-1, miR-9a, miR-12-3p, miR-33, miR-34-3p, miR-79-3p, miR-124, miR-219, miR-252-5p, miR-286b, miR308-5p, miR-1000, miR-1889-3p and miR-1890 (Figure 8B). [score:3]
Using a specific inhibitor (antagomirs) against aae-miR-12, Wolbachia’s dependence on this miRNA to guarantee its persistence within the host cell was demonstrated [12]. [score:3]
[1 to 20 of 5 sentences]
3
[+] score: 7
Furthermore, the Anopheles miR-304 and the D. melanogaster miR-304 are both in a conserved miRNA cluster and both are flanked by miR-12 and miR-283, thus lending additional support for the validity of Anopheles miR-304. [score:1]
They are let-7, miR-281, miR-34, miR-12, and miR-306. [score:1]
Four of the six Anopheline miRNAs (miR-12, miR-375, miR-2a, and miR-76) have conserved sequences in Ae. [score:1]
The miRNA gene cluster contains miR-12, -283, and -304. [score:1]
gambiae and D. melanogaster, miR-304 is closely flanked by miR-12 and miR-283 while miR-306 is in a different cluster with miR-9b and miR-79 (Figure 3). [score:1]
Interestingly, miR-304 is closely flanked by miR-12 and miR-283 while miR-306 is in a different cluster with miR-9b and miR-79 (Figure 3). [score:1]
The miR-12, -304, -283 cluster occurs within a conserved gene of unknown function, while the miR-9b, -79, -306 cluster occurs within an ortholog of a gene coding for a Drosophila serine-threonine kinase group protein. [score:1]
[1 to 20 of 7 sentences]
4
[+] score: 4
recognition sites Mean MFE (Kcal/Mol) Recognition site start position on lincRNA_1317 miR-278-5p 5 -22.40 307, 749, 1112, 1260, 1491 miR-252-3p 4 -21.15 162, 629, 1560, 3946 miR-11-5p 3 -21.67 2248, 2286, 3328 miR-1890 3 -21.17 1489, 2712, 3602 miR-263a-3p 3 -21.47 2208, 2545, 3336 miR-33 3 -24.90 1545, 1810, 2669 miR-34-5p 3 -25.03 1020, 1232, 1379 miR-9b 3 -24.03 2034, 2891, 3603 let-7 2 -22.20 2747, 2817 miR-1 2 -22.80 1165, 2528 miR-1175-3p 2 -20.65 1489, 3274 miR-12-5p 2 -25.60 632, 1575 miR-1889-3p 2 -20.80 1268, 3988 miR-1891 2 -21.10 162, 2349 miR-282-5p 2 -25.70 1232, 1297 miR-2944b-3p 2 -22.05 1255, 3797 miR-2945-5p 2 -23.00 770, 1209 miR-31 2 -25.70 819, 871 miR-375 2 -22.25 66, 3293 miR-92b-5p 2 -23.05 1042, 3788 miR-9a 2 -20.65 170, 3500We also used LncTar algorithm to predict any direct interaction between lincRNA_1317 and DENV-2 genome. [score:2]
recognition sites Mean MFE (Kcal/Mol) Recognition site start position on lincRNA_1317 miR-278-5p 5 -22.40 307, 749, 1112, 1260, 1491 miR-252-3p 4 -21.15 162, 629, 1560, 3946 miR-11-5p 3 -21.67 2248, 2286, 3328 miR-1890 3 -21.17 1489, 2712, 3602 miR-263a-3p 3 -21.47 2208, 2545, 3336 miR-33 3 -24.90 1545, 1810, 2669 miR-34-5p 3 -25.03 1020, 1232, 1379 miR-9b 3 -24.03 2034, 2891, 3603 let-7 2 -22.20 2747, 2817 miR-1 2 -22.80 1165, 2528 miR-1175-3p 2 -20.65 1489, 3274 miR-12-5p 2 -25.60 632, 1575 miR-1889-3p 2 -20.80 1268, 3988 miR-1891 2 -21.10 162, 2349 miR-282-5p 2 -25.70 1232, 1297 miR-2944b-3p 2 -22.05 1255, 3797 miR-2945-5p 2 -23.00 770, 1209 miR-31 2 -25.70 819, 871 miR-375 2 -22.25 66, 3293 miR-92b-5p 2 -23.05 1042, 3788 miR-9a 2 -20.65 170, 3500 We also used LncTar algorithm to predict any direct interaction between lincRNA_1317 and DENV-2 genome. [score:2]
[1 to 20 of 2 sentences]
5
[+] score: 2
In some miRNAs such as miR-1, miR-11, miR-12 and miR-999 (miRNAs with probability index of 100%) the canonical sequences were the dominant isomiR in all situations (Fig. 7C). [score:1]
The 5p to 3p ratio was decreased by DENV infection for miR-34, miR-988, miR-12, miR-iab-4, and miR-932 (Fig. 6). [score:1]
[1 to 20 of 2 sentences]
6
[+] score: 1
The second cluster includes miR-12 and miR-283, which flank either miR-304 in D. melanogaster or miR-1889 in An. [score:1]
[1 to 20 of 1 sentences]