sort by

25 publications mentioning ssc-mir-146a

Open access articles that are associated with the species Sus scrofa and mention the gene name mir-146a. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 295
These results further verified that miR-146a-5p targets the 3′UTR of IR mRNA, resulting in suppressed expression of IR protein expression. [score:9]
Western blot analysis showed that miR-146a-5p mimics suppressed IR protein expression significantly (Fig. 10A), while the inhibitor rescued IR expression (Fig. 10B). [score:9]
Similarly, inhibition of miR-146a-5p was achieved by transfecting cells with 100 pmol per well of 29-O methylated single-stranded miR-146a-5p antisense oligonucleotides (hereafter referred to as “inhibitor” GenePharma), The sequence of the miR-146a-5p inhibitor was 5′- AACCCAUGGAAUUCAGUUCUCA-3′, and that of the negative control for the inhibitor (iNC; GenePharma) was 5′-CAGUACUUUUGUGUAGUACAA-3′. [score:9]
Western blot results also showed that miR-146a-5p could inhibit the expression of IR protein, suggesting a regulatory role of miR-146a-5p on its target. [score:8]
Five upregulated (miR-146a-5p, miR-146b, miR-365-3p, miR-92a, and miR-181c) and five downregulated (miR-30b-3p, miR-214, miR-140-3p, miR-664-3p, and miR-1307) miRNAs from the microarray were selected randomly to conduct real-time PCR. [score:7]
TNF-α improves expression of miR-146a-5p (↓), and miR-1465p inhibits adipogenesis by targeting IR (⊥). [score:7]
Furthermore, this inhibitory effect was rescued by addition of the miR-146a-5p inhibitor (IR siRNA + inhibitor group). [score:7]
Pauley K. M., Satoh M., Chan A., Bubb M., Reeves W., and Chan E. 2008 Upregulated miR-146a expression in peripheral blood mononuclear cells from rheumatoid arthritis patients. [score:6]
miR-146a-5p downregulates IRS-1 tyrosine phosphorylated protein expression. [score:6]
Suzuki Y., Kim H. W., Ashraf M., and Haider H. K. 2010 Diazoxide potentiates mesenchymal stem cell survival via NF-κB -dependent miR-146a expression by targeting Fas. [score:5]
To further confirm the direct regulation of miR-146a-5p on IR, we transfected IR siRNA/siRNA control and miR-146a-5p inhibitor/iNC into preadipocytes and induced them to mature status. [score:5]
We focused our study on miR-146a-5p and found that it inhibited adipogenesis through targeting IR. [score:5]
Target prediction identified IR, an essential factor in the insulin signaling pathway, as one of the potential targets of miR-146a-5p. [score:5]
Li X., Ji Z., Li S., Sun Y-N., Liu J., Liu Y., Tian W., Zhou Y-T., and Shang X-M. 2015 miR-146a-5p antagonized AGEs- and P. g-LPS -induced ABCA1 and ABCG1 dysregulation in macrophages via IRAK-1 downregulation. [score:5]
The results showed that miR-146a-5p mimics inhibited the tyrosine phosphorylation of IRS-1, while the miR-146a-5p inhibitor rescued this trend (Fig. 12). [score:5]
Fig. 10. miR-146a-5p suppresses IR protein expression. [score:5]
To explore whether miR-146a-5p could affect the IR protein expression level, we transfected preadipocytes with miR-146a-5p mimics, NC, inhibitor, or iNC and measured IR protein expression on day 8 postinduction. [score:5]
We further conducted KEGG pathway analysis on predicted targets of miR-146a-5p individually because it was expressed quite highly after TNF-α treatment. [score:5]
Therefore, we speculated that miR-146a-5p targeting of IR would impact the TNF-α-stimulated inhibition of adipogenesis. [score:5]
In MSCs, diazoxide was shown to potentiate cell survival via NFκB -dependent miR-146a expression by targeting Fas (62). [score:5]
Taganov K. D., Boldin M. P., Chang K. J., and Baltimore D. 2006 NF-kappa B -dependent induction of microRNA miR-146, an inhibitor targeted to signaling proteins of innate immune responses. [score:5]
miR-146a-5p suppresses IR protein expression. [score:5]
Cho et al. (61) discovered that overexpression of miR-146a could inhibit basal and TNF-α- and TLR ligand -induced osteogenic differentiation. [score:5]
Perng et al. (64) found that miRNA-146a expression could positively regulate TNF-α -induced interleukin-8 production in MSCs and differentiated lung epithelial-like cells. [score:4]
Thus, we transfected miR-146a-5p mimics/NC/inhibitor/iNC into preadipocytes and induced the cells to mature status (see Materials and Methods) when the expression of IRS-1 tyrosine phosphorylated protein was assayed by Western blot. [score:4]
We transfected adipocytes with miR-146a-5p mimics, and tyrosine phosphorylation of IRS-1 was determined to be downregulated by Western blot. [score:4]
Matysiak M., Fortak-Michalska M., Szymanska B., Orlowski W., Jurewicz A., and Selmaj K. 2013 MicroRNA-146a negatively regulates the immunoregulatory activity of bone marrow stem cells by targeting prostaglandin E2 synthase-2. J. Immunol. [score:4]
In marrow-derived MSCs, miR-146a was shown to play a critical role in the control of the immunoregulatory potential of bone tissue by targeting prostaglandin E [2] synthase (ptges-2) (36). [score:4]
Upregulation of miR-146a-5p was achieved by transfecting cells with 100 pmol per well of synthetic RNA duplex (mimics; GenePharma, Guangzhou, China) and NC (GenePharma) according to the manufacturer’s protocol. [score:4]
miR-146a-5p and miR-146b showed the highest upregulation levels of 10.24-fold and 13.62-fold, respectively, in the TNF-α group. [score:4]
Perng D. W., Yang D. M., Hsiao Y. H., Lo T., Lee O. K. S., Wu M. T., Wu Y. C., and Lee Y. C. 2012 miRNA-146a expression positively regulates tumor necrosis factor-alpha -induced interleukin-8 production in mesenchymal stem cells and differentiated lung epithelial-like cells. [score:4]
Li H., Xie S., Liu M., Chen Z., Liu X., Wang L., Li D., and Zhou Y. 2014 The clinical significance of downregulation of mir-124–3p, mir-146a-5p, mir-155–5p and mir-335–5p in gastric cancer tumorigenesis. [score:4]
miR-146a-5p mimics/NC/inhibitor/iNC were transfected into preadipocytes, and cells were collected on day 8 postinduction. [score:3]
Fig. 5. Conserved analysis of miR-146a-5p and its target gene across species. [score:3]
Similar to the results of, miR-146a-5p mimics significantly reduced the amount of TG (Fig. 8B), and this effect was also rescued by transfection of the inhibitor (Fig. 8B). [score:3]
Use of the pmirGLO dual-luciferase reporter vectors initially indicated that miR-146a-5p targets the 3′-UTR of the IR mRNA. [score:3]
Preadipocytes were transfected with miR-146a-5p mimics/NC/inhibitor/iNC. [score:3]
A: Formation of lipid droplets in cells transfected with miR-146a-5p mimics (a), NC (b), inhibitor (c), and iNC (d) was observed by staining with Oil Red O. Scale bars, 100 μm. [score:3]
Western blot and gray-scale scanning analyses of IR after transfection of miR-146a-5p mimics/NC/inhibitor/iNC (* P < 0.05, ** P < 0.01, n = 4). [score:3]
After transfection and day 8 postinduction with miR-146a-5p mimics and inhibitor, the expression levels of miR-146a-5p were measured by a quantitative PCR (qPCR) -based method. [score:3]
After transfection and day 8 postinduction with miR-146a-5p mimics and inhibitor, the expression levels of miR-146a-5p were measured by a qPCR -based method. [score:3]
miR-146a-5p inhibits adipogenesis. [score:3]
miR-146a-5p mimics also obviously decreased lipid droplets in porcine adipocytes (Fig. 8A-a) when compared with the NC group (Fig. 8A-b), and this regulation was rescued by the miR-146a-5p inhibitor (Fig. 8A-c). [score:3]
Expression levels of miR-146a-5p and miR-146b were the most drastically changed at 10.24-fold and 13.62-fold, respectively, by TNF-α treatment of adipocytes. [score:3]
Fig. 7. The endogenous miR-146a-5p levels with transfection of miRNA mimics or inhibitor. [score:3]
Together, these results further verified the miR-146a-5p targeting of IR. [score:3]
miRNA mimics and inhibitor significantly increased and decreased miR-146a-5p levels compare with NC and iNC control, respectively, in adipocytes. [score:3]
miR-146a-5p was predicted to target IR, which is a crucial factor in the insulin signaling pathway. [score:3]
Because miR-146a-5p was increased dramatically after TNF-α treatment, we presumed that this miRNA could also inhibit adipogenesis of porcine preadipocytes. [score:3]
To verify IR, a crucial factor in the insulin signaling pathway, as a target of miR-146a-5p, we constructed three pmirGLO dual-luciferase reporter vectors: pmirGLO (wild-type 3′-UTR of IR mRNA with seed sequence), pmirGLO-Mut (3′-UTR of IR mRNA with seed sequence muted), and pmirGLO-Del (3′-UTR of IR mRNA with seed sequence deleted). [score:3]
Thus, miR-146a-5p was chosen for subsequent analysis with the assumption that it plays an essential role during the process of TNF-α-stimulated inhibition of adipogenesis. [score:3]
Because the signal value of miR-146a-5p was higher than that of miR-146, we assumed that miR-146a-5p would be expressed at a higher level than that of miR-146b in adipocytes. [score:3]
Individual GO analysis and KEGG analysis of miR-146a-5p were also conducted based on the potential targets of miR-146a-5p. [score:3]
Li Y., VandenBoom T. G., Wang Z., Kong D., Ali S., Philip P. A., and Sarkar F. H. 2010 miR-146a suppresses invasion of pancreatic cancer cells. [score:3]
The results showed miRNA mimics and inhibitor significantly increased and decreased miR-146a-5p levels compare with NC and iNC control, respectively, in adipocytes (Fig. 7). [score:3]
In vascular smooth muscle cells, miR-146a targets Kruppel-like factor 4(KLF4) 3′-UTR and has an important role in promoting cell proliferation (63). [score:3]
Jazdzewski K., Murray E. L., Franssila K., Jarzab B., Schoenberg D. R., and de la Chapelle A. 2008 Common SNP in pre-miR-146a decreases mature miR expression and predisposes to papillary thyroid carcinoma. [score:3]
Thus, IR was confirmed preliminarily as the target of miR-146a-5p. [score:3]
Our study provided the first evidence of miR-146a-5p targeting IR. [score:3]
The fact that miR-146a-5p exhibited a higher signal value indicated that it generally was expressed at a higher average degree than miR-146b in normal porcine adipocytes. [score:3]
Fig. 8. miR-146a-5p inhibits adipogenesis. [score:3]
We initially found that miR-146a-5p suppressed adipogenesis via the Oil Red O assay and. [score:2]
The subsequent IR siRNA assay further confirmed that miR-146a-5p specifically targets IR. [score:2]
Verification of miR-146a-5p targeting 3′-UTR of IR mRNA by luciferase reporter assay. [score:2]
Thus, it is believed that miR-146a-5p regulation in pigs will be an important animal mo del for the study of diabetes in humans and a theoretical basis for research in adipogenesis in humans in the future. [score:2]
Western blot analysis of tyrosine phosphorylation of IRS-1. Preadipocytes were transfected with miR-146a-5p mimics/NC/inhibitor/iNC, and tyrosine phosphorylation of IRS-1 was assayed on induction day 8 after treating with 100 nM insulin for 1 h at 37°C. [score:2]
miR-146a has been reported to be involved in papillary thyroid carcinoma (56), rheumatoid arthritis (57), pancreatic cancer (58), inflammatory reaction (59), and innate immune responses (60). [score:1]
However, no evidence of the function of miR-146a-5p in adipogenesis in primary adipocytes has been presented until now. [score:1]
Interestingly, miR-146a-5p was found to be highly conserved among pigs, humans, mice, and rats (Fig. 5A). [score:1]
Preadipocytes were transfected with miR-146a-5p inhibitor/iNC and IR siRNA/siRNA control, and IR protein was assayed on induction day 8. Panels with different letters were considered statistically significant (P < 0.05, n = 3). [score:1]
A: Mature sequences of miR-146a-5p in the pig, human, mouse, and rat genomes. [score:1]
Our finding is the first to explain the role that miR-146a-5p potentially plays in the process of adipogenesis. [score:1]
These results suggest that miR-146-5p participates in TNF-α -induced insulin resistance and the insulin signaling pathway. [score:1]
The 3′-UTR of IR contains the highly conserved binding sites of miR-146a-5p, and the sequence containing the binding sites (84 bp) is as follows: 5 ’-CTCGAGCTCA­CTCCCAAGTTCTCTTACTAGGCA­GGGTCCACAACTAGCCTCCAGTC ACATTTTCCTTTGGGCATGAGCTCTAGA-3′. [score:1]
The 3′-UTR of IR contains the highly conserved binding sites of miR-146a-5p, and the sequence containing the binding sites (84 bp) is as follows: 5 ’-CTCGAGCTCA­CTCCCAAGTTCTCTTACTAGGCA­GGGTCCACAACTAGCCTCCAGTCACATTTTCCTTTGGGCATGAGCTCTAGA-3′. [score:1]
As far as we know, hsa-miR-146a-5p (human miR-146a-5p) exactly shares the sequence 5′-UGAGAACUGAAUUCCAU­G­G­G­UU-3′ with ssc-miR-146a-5p and mmu-miR-146a-5p. [score:1]
CHO cells were transfected with each of the constructed plasmids, together with miR-146a-5p mimics/NC (* P < 0.05, n = 8). [score:1]
miR-146a-5p was predicted to participate in 21 pathways (supplemental Table S5). [score:1]
Therefore, miR-146a-5p was chosen for further analysis in this study. [score:1]
B: Binding site of IR mRNA 3′-UTR and miR-146a-5p seed region. [score:1]
CHO cells were then cotransfected with miR-146a-5p mimics/NC and pmiGLO/pmirGLO-Mut/pmirGLO-Del. [score:1]
Sequences of the miR-146a-5p mimics were 5′-UGAGAACUGAAUUCCAUGGGUU-3′ (48) and 5′-CCCAUGGAAUUCAGUUCUCAUU-3′ (antisense), and those of the NC were 5′-UUCUCCGAACGUGUCACGUTT-3′ (48) and 5′-ACGUGAC­A­CGUUCGGGAATT-3′ (antisense). [score:1]
Meanwhile, a plasmid containing the mutant IR 3′-UTR, pmirGLO-Mut, was generated by mutating the core sequence of the miR-146a-5p binding sites through DNA synthesis (Sangon Biotech Co. [score:1]
Bhaumik D., Scott G. K., Schokrpur S., Patil C. K., Orjalo A. V., Rodier F., Lithgow G. J., and Campisi J. 2009 MicroRNAs miR-146a/b negatively modulate the senescence -associated inflammatory mediators IL-6 and IL-8. Aging. [score:1]
miR-146a-5p also reduced the tyrosine phosphorylation of IRS-1, indicating that this miRNA participates in the insulin signaling pathway (Fig. 13). [score:1]
Moreover, 3′-UTR of human IR mRNA contains the same sequence of our verified ssc-miR-146a-5p binding site (AGTTCTC) (Fig. 5). [score:1]
At 60–70% confluency, cells were transfected with 3 pmol miR-146a-5p mimics/NC and 100 ng pmirGLO/pmirGLO-Mut/pmirGLO-Del. [score:1]
Sun S-g., Zheng B., Han M., Fang X-m., Li H-x., Miao S-b., Su M., Han Y., Shi H-j., and Wen J-k. 2011 miR-146a and Krüppel-like factor 4 form a feedback loop to participate in vascular smooth muscle cell proliferation. [score:1]
Similarly, a plasmid containing the deleted IR 3′-UTR, pmirGLO-Del, was generated by deleting the core sequence of miR-146a-5p binding sites through DNA synthesis, and the sequence was as follows: 5′-CTCGAGCTCACTCCCATTACTAGGCAGGGTCCACA­A­C­TAGCCTCCAGTCACATTTTCCTTTGGGCATGAGCTCTAGA-3′. [score:1]
The 3′-UTR of IR mRNA contains a binding site that perfectly matched the seed region of miR-146a-5p (Fig. 5B). [score:1]
[1 to 20 of 90 sentences]
2
[+] score: 90
As shown in Figure 6, qualitative qPCR validated that ssc-miR-146a-5p, ssc-miR-221-5p and ssc-miR-148b-3p were significantly upregulated by LPS, and ssc-miR-215 and ssc-miR-192 were downregulated. [score:7]
Figure 7LPS upregulates the expression of miR-146a-5p and miR-221-5p in C2C12 myotubes. [score:6]
However, LPS induced the expressions of IRAK1 and TRAF6 at 12 h (Figure S1), suggesting miR-146a might be involved in inflammatory muscle catabolism by regulating other target genes. [score:6]
miR-146a has been shown both in vitro and in vivo to directly target interleukin-1 receptor -associated kinase 1 (IRAK1) and tumor necrosis factor (TNF) receptor -associated factor 6 (TRAF6), suggesting it can control cytokine and TLR signaling through a negative feedback regulatory loop [39, 40, 41]. [score:5]
Taganov K. D. Boldin M. P. Chang K. J. Baltimore D. NF-κB -dependent induction of microRNA miR-146, an inhibitor targeted to signaling proteins of innate immune responses Proc. [score:5]
Hou J. Wang P. Lin L. Liu X. Ma F. An H. Wang Z. Cao X. MicroRNA-146a feedback inhibits RIG-I -dependent Type I IFN production in macrophages by targeting TRAF6, IRAK1, and IRAK2 J. Immunol. [score:4]
Experiments with THP-1 macrophages demonstrated that induction of endotoxin tolerance required miR-146a upregulation and that transfection of exogenous miR-146a was sufficient to induce tolerance, even in the absence of LPS priming [42]. [score:4]
After normalization of the raw reads we found that four miRNAs (ssc-miR-146a-5p, ssc-miR-221-5p, ssc-miR-9860-5p and ssc-miR-148b-3p) were significantly upregulated in the LPS-challenged samples with a p-value cutoff of 0.05. [score:4]
Our results are consistent with previous studies that LPS induced the expression of miR-146a in piglet skeletal muscle and C2C12 myotubes in response to TLR4 signaling. [score:3]
RT-qPCR was performed to determine the time -dependent effects of LPS on the expression of TNF-α, IL-1β, MAFbx, MuRF1, miR-146a-5p and miR-221-5p. [score:3]
We speculated that LPS -induced miR-146a-5p might act as a negative regulator of inflammatory muscle catabolism through negative feedback regulation of TLR signaling. [score:3]
Importantly, miR-146a-5p and miR-221-5p displayed significant differential expression in LPS -injected pig skeletal muscle and LPS -treated C2C12 myotubes, suggesting the two miRNAs might be involved in acute inflammation processes in skeletal muscle. [score:3]
Many studies have demonstrated that miRNA expression profiles are subject to change in different cells when stimulated by LPS via TLR-signaling pathways, including miR-146a, miR-155, miR-132, miR-15a/16, miR-27a and miR-532-5p [19, 20, 21, 22, 23]. [score:3]
Therefore, further studies have to be carried out in vitro to identify miR-146a potential function and its target genes in inflammatory muscle catabolism process. [score:3]
Interestingly, LPS treatment rapidly stimulated miR-146a-5p expression by approximately 11-fold at 3 h, which peaked in 24 h at approximately 147-fold (Figure 7). [score:3]
LPS Induces miR-146a-5p and miR-221-5p Expression in C2C12 Myotubes. [score:3]
Differential expressions of five selected miRNAs (ssc-miR-146a-5p, ssc-miR-221-5p, ssc-miR-148b-3p, ssc-miR-215 and ssc-miR-192) were validated by quantitative polymerase chain reaction (qPCR). [score:3]
Of note, injection of LPS resulted in significantly enhanced expression of ssc-miR-146a-5p and ssc-miR-221-5p. [score:3]
Conversely, inhibition of miR-146a diminished the effects of LPS tolerance [43]. [score:3]
Nahid M. A. Satoh M. Chan E. K. Mechanistic role of microRNA-146a in endotoxin -induced differential cross-regulation of TLR signaling J. Immunol. [score:2]
Jiang S. Y. Xue D. Xie Y. F. Zhu D. W. Dong Y. Y. Wei C. C. Deng J. Y. The negative feedback regulation of microRNA-146a in human periodontal ligament cells after Porphyromonas gingivalis lipopolysaccharide stimulation Inflamm. [score:2]
Further investigations should focus on the potential function of miR-146a-5p and miR-221-5p during inflammatory muscle catabolism, including identification of targets and knock-out experiments at the cellular level. [score:2]
0 h. Accumulating evidence collectively informs us that miR-146a is a key regulator of the innate immune response [38]. [score:2]
Lu Y. Cao L. Jiang B. C. Yang T. Gao Y. J. MicroRNA-146a-5p attenuates neuropathic pain via suppressing TRAF6 signaling in the spinal cord Brain Behav. [score:2]
0 h. Accumulating evidence collectively informs us that miR-146a is a key regulator of the innate immune response [38]. [score:2]
miR-146a was previously found to be transcriptionally induced by NF-κB in response to activation of innate immune signaling in monocytes [21]. [score:1]
Saba R. Sorensen D. L. Booth S. A. MicroRNA-146a: A dominant, negative regulator of the innate immune response Front. [score:1]
Studies have also revealed a role for miR-146a in endotoxin -induced tolerance. [score:1]
Nahid M. A. Pauley K. M. Satoh M. Chan E. K. miR-146a is critical for endotoxin -induced tolerance: Implication in innate immunity J. Biol. [score:1]
[1 to 20 of 29 sentences]
3
[+] score: 77
Thus it is possible that this down-regulation of HAS3 is, in part, due to the up-regulation of miR-146a in PRRSV-infected cells. [score:7]
In the present study miR-146a was differentially expressed at both 12 hpi and 24 hpi and displayed dramatic up-regulation at 24 hpi in PRRSV-infected PAMs (Figure 1). [score:6]
Based on the roles of miR-146a in the regulation of immune responsive genes and its up-regulation in PRRSV-infected PAMs, it is likely that miR-146a mediated gene regulation is an important aspect of the host response to a PRRSV infection. [score:6]
Three miRNAs, miR-24, miR-146a, and miR-147 were selected for target gene validation based on their expression profiles, predicted regulated pathways and/or their known involvement in immunity. [score:6]
As miR-146a expression is significantly higher in PRRSV infected PAMs compared to mock infected cells, C1QTNF3 expression would therefore be expected to be lower in PRRSV infected cells. [score:4]
The miRNA miR-146a was up-regulated at both 12 hpi and 24 hpi infection in PRRSV-infected macrophages. [score:4]
Seven of the predicted ssc-miR-146a regulated genes (C1QTNF3, C9, CD47, MAFB, HZ3, PSMD5, and EDRF1) out of the nine selected for validation were able to significantly reduce Renilla luciferase expression (Figure 3). [score:4]
RCAS-infected DF1 cells expressing either miR-146a or a scrambled control (SC) were transfected with psiCHECK2 constructs in which the predicted miR-146a binding sites along with their flanking regions were cloned into the 3′UTR of the Renllia luciferase gene. [score:3]
Validation of predicted ssc-miR-146a target genes. [score:3]
Computationally predicted porcine miR-146a target sites selected for validation. [score:3]
0082054.g003 Figure 3Validation of predicted ssc-miR-146a target genes. [score:3]
Of the differentially expressed miRNAs six (miR-30a-3p, miR-132, miR-27b*, miR-29b, miR-146a and miR-9-2) were altered at more than one time point in PRRSV-infected macrophages (Figure 1). [score:3]
Therefore, the potential targeting of HAS3 by miR-146a may impact PRRSV infectivity. [score:3]
To validate predicted porcine binding sites for miR-146a an RCAS virus expressing the ssc-miR-146a hairpin was generated using the Gateway system (Life Technologies). [score:3]
A total of forty cellular miRNAs were differentially expressed in PRRSV infected macrophages, six of which (miR-30a-3p, miR-132, miR-27b*, miR-29b, miR-146a and miR-9-2) were altered at more than one time point (Figure 1). [score:3]
The expression of miR-146a is induced in monocytes and other immune cells upon exposure to pathogens. [score:3]
Hyaluronan synthase 3 (HAS3), a regulator of hyaluronan synthesis, possesses two potential binding sites for miR-146a in its 3′ UTR (Table 3). [score:2]
Binding site prediction and validation identified additional genes regulated by miR-146a, including C1QTNF3 and MAFB (Table 3 and Figure 3). [score:2]
MiR-146a has previously been shown to regulate a diverse group of genes including immune response modulators such as, TRAF6, IRAK1, IRAK2, IL-8 and RANTES (reviewed by [22]). [score:1]
DF1 cells were infected with either RCAS- ssc-miR-147, RCAS- ssc-miR-24, RCAS- ssc-miR146a or RCAS- SC (M. O. I. of 1) and maintained in a 96-well plate in RPMI 1640 with 1% heat-inactivated FBS, L-glutamine, penicillin (100 U/ml), streptomycin (100 µg/ml), and fungizone (4 µg/ml), at 37°C with 5% CO [2]. [score:1]
Both C1QTNF3 and MAFB contain two putative miR-146a binding sites within their 3′UTRs (Table 3). [score:1]
Tumor necrosis factor related protein 3 (C1QTNF3) is predicted to contain two miR-146a binding sites in its 3′UTR. [score:1]
[a]This construct contains two miR-146a binding sites. [score:1]
MAFB, v-maf musculoaponeurotic fibrosarcoma oncogene homolog B (avian), is also predicted to contain two potential miR-146a binding sites within its 3′UTR (Table 3) and luciferase validation suggests that these sites are functional (Figure 3). [score:1]
[b]This construct contains one miR-146a binding site. [score:1]
Among these six miRNA, miR-30a-3p, miR-132, miR-27b*, miR-29b, miR-146a and miR-9-2, were altered at more than one time point. [score:1]
[c]This construct contains two miR-146a binding sites. [score:1]
[1 to 20 of 27 sentences]
4
[+] score: 28
Nearly all up-regulated microRNAs in lung tissue from infected pigs target IL-6R and/or IL6ST, in addition miR-144 and miR-146a 5p targets mRNA coding for IL-6. IL-6 was found to be highly up-regulated in the same animals [24] 14–18 h after experimental infection. [score:11]
In contrary, the RNAseq results show up-regulation of miR-146a-5p placing it within 20 most regulated microRNAs in necrotic sample. [score:5]
The following five miRNAs (miR-21, miR-143-3p, miR-146a-5p, miR-223, miR-664-5p), target over ten different protein coding genes. [score:3]
The miR-148a similarly to miR-146a-5p was found to target mRNA encoding IRAK1. [score:3]
Literature reports a number of microRNAs, mainly miR-21, miR-155, miR-146a, miR-223 to be important regulators of the protein coding genes involved in the above mentioned pathways [60], [61], [63]. [score:2]
For example, miR-146a/b and miR-155 have been induced by TLR4 -mediated sensing of bacterial lipopolysaccharide (LPS) [16], [17]. [score:1]
It has been shown that the nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB), a central transcription factor for a wide range of innate immune factors including several cytokines, interacts with the promoter region of miR-146a [16]. [score:1]
Of the miRNAs investigated in the present study, miR15a, miR21, miR126, miR142-5p, miR144-5p, miR146a-5p, miR148a, miR152, miR155, miR192, miR-223, miR-45 and miR-d5 are 5'-miRNAs hence only the mature miRNAs of these targets were detected. [score:1]
The ncRNAs chosen for RT-qPCR validation were: miR-15a, miR-21, miR-126, miR-142-5p, miR-143-3p, miR-144*, miR-146a-5p, miR-148a, miR-155, miR-223, miR-451, miR-664-5p, miR-d5 and SNORD15. [score:1]
[1 to 20 of 9 sentences]
5
[+] score: 18
For example, ssc-miR-21 was significantly up-regulated (log2fold change (logFC) = 1.31, FDR < 1E-6, Fig. 1B), and ssc-miR-146a was significantly down-regulated (logFC = −0.91, FDR < 1E-5, Fig. 1B) at 2 dpi. [score:7]
This study identified differential expression of several miRNAs previously linked to immune response including miR-21, miR-146a and miR-125a 13, and reported several miRNAs not previously linked to immune response to Salmonella infection, such as miR-214, miR-30e-3p and miR-331. [score:3]
Further, miR-18a, miR-24, miR-146a, miR-148a and miR-214 were predicted to target the apoptosis pathway (Table 3). [score:3]
For example, miR-24, miR-146a, miR-155 and miR-214 were predicted to be involved in regulation of the Toll-like receptor (TLR) signaling pathway (Table 3). [score:2]
It has been shown that miR-146a and miR-155 are involved in the TLR signaling pathway and play important roles in innate immune response 13. [score:1]
Several miRNA hub nodes were identified including miR-146a, miR-155, miR-214 and miR-331-3p (Fig. 3). [score:1]
Several miRNAs previously reported to be involved in immune response such as miR-21, miR-125a, miR-99b, miR-146a and let-7 families were identified. [score:1]
[1 to 20 of 7 sentences]
6
[+] score: 16
miR-146a-5p inhibits adipogenesis by suppressing insulin resistance protein expression in primary porcine adipocytes [45]. [score:7]
Importantly, miR-146a-5p was one of the central molecules, which could target the SBSPON gene and repress its expression in the network. [score:5]
miR-143 and miR-146a were the hub molecules in network 1, while miR-143 and miR-146a-5p were upregulated in the livers of the H group. [score:4]
[1 to 20 of 3 sentences]
7
[+] score: 14
MiRNA name Target gene in MAPK signaling pathway MiR-10b BDNF MiR-211 SOS1 MiR-143 CACNA1E, FGF1, MAPK7, MAP3K7, PDGFRA, KRAS MiR-30a RAP1B, RASA1, RAPGEF2, TAOK1, CACNB2, CASP3, CACNA1C, IL1A, MAP2K4, MAP3K1, MAP3K12, MAP3K2, MAP3K5, NF1, PPP3CA, PPP3CB, RPS6KA2, CRKL MiR-146a TRAF6 To gain an insight into the molecular functions of genes in biological processes, we annotated the genes targeted by differentially expressed miRNAs using GO categories (Table S5). [score:7]
MiRNA name Target gene in MAPK signaling pathway MiR-10b BDNF MiR-211 SOS1 MiR-143 CACNA1E, FGF1, MAPK7, MAP3K7, PDGFRA, KRAS MiR-30a RAP1B, RASA1, RAPGEF2, TAOK1, CACNB2, CASP3, CACNA1C, IL1A, MAP2K4, MAP3K1, MAP3K12, MAP3K2, MAP3K5, NF1, PPP3CA, PPP3CB, RPS6KA2, CRKL MiR-146a TRAF6 To gain an insight into the molecular functions of genes in biological processes, we annotated the genes targeted by differentially expressed miRNAs using GO categories (Table S5). [score:7]
[1 to 20 of 2 sentences]
8
[+] score: 13
Strikingly, we did observe that TLR4 and TNF (targets of and miR-146a-5p and miR-203a-3p, respectively) were significantly down-regulated in leukocytes at 14d pi. [score:6]
Here we show that ssc-miR-146a-5p is significantly up-regulated in circulating leukocytes only at 14d pi; the human homolog of this miRNA has been found to target important components of TLR signaling, such as TLR2, TLR4, NFKB1, IRAK1, TRAF6, and IL8. [score:6]
However, the highest number of significantly regulated miRNAs compared to before challenge was found at 14d pi, at which time point the infection had completely cleared (ssc-miR-15a, ssc-miR-29b, ssc-miR-29a, hsa-miR-449a, ssc-miR-186, ssc-miR-22-5p, ssc-miR-28-5p, hsa-miR-203a-3p, ssc-miR-146a-5p, hsa-miR-150-5p, ssc-miR-23b, hsa-miR-223-3p, hsa-miR-23a-3p, hsa-miR-16-5p). [score:1]
[1 to 20 of 3 sentences]
9
[+] score: 12
Other miRNAs from this paper: hsa-mir-146a
An in vitro study using human dendritic cells showed that LGG significantly down-regulated p38 expression and negatively regulated NF-kB through down-regulatory effect on miR-146a expression [47]. [score:12]
[1 to 20 of 1 sentences]
10
[+] score: 12
More recently, EBV and VSV have been shown both to significantly upregulate the expression of miRNA-146a and to act as a miRNA-146a -mediated negative regulator of tumor necrosis factor receptor -associated factor 6 (TRAF6), and interleukin-1 receptor -associated kinase-1 (IRAK1), key elements of the host immune and inflammatory response [40]. [score:7]
Epstein-Barr Virus-Encoded Latent Membrane Protein 1 (LMP1) Induces the Expression of the Cellular MicroRNA miR-146a. [score:3]
These findings suggest that miR-146a/b may function as novel negative regulators that help to fine-tune the immune response [41– 43]. [score:2]
[1 to 20 of 3 sentences]
11
[+] score: 11
Other miRNAs from this paper: ssc-mir-122, ssc-mir-125b-2, ssc-mir-181b-2, ssc-mir-20a, ssc-mir-23a, ssc-mir-26a, ssc-mir-29b-1, ssc-mir-181c, ssc-mir-214, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-103-1, ssc-mir-107, ssc-mir-21, ssc-mir-29c, ssc-mir-30c-2, bta-mir-26a-2, bta-mir-29a, bta-let-7f-2, bta-mir-103-1, bta-mir-20a, bta-mir-21, bta-mir-26b, bta-mir-30d, bta-mir-499, bta-mir-99a, bta-mir-125b-1, bta-mir-126, bta-mir-181a-2, bta-mir-199a-1, bta-mir-30b, bta-mir-107, bta-mir-10a, bta-mir-127, bta-mir-142, bta-mir-181b-2, bta-mir-30e, bta-mir-92a-2, bta-let-7d, bta-mir-132, bta-mir-138-2, bta-mir-17, bta-mir-181c, bta-mir-192, bta-mir-199b, bta-mir-200a, bta-mir-200c, bta-mir-214, bta-mir-23a, bta-mir-29b-2, bta-mir-29c, bta-mir-455, bta-let-7g, bta-mir-10b, bta-mir-30a, bta-mir-200b, bta-let-7a-1, bta-let-7f-1, bta-mir-122, bta-mir-30c, bta-let-7i, bta-mir-25, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-125b-2, bta-mir-99b, ssc-mir-99b, ssc-mir-17, ssc-mir-30b, ssc-mir-199b, bta-mir-1-2, bta-mir-1-1, bta-mir-129-1, bta-mir-129-2, bta-mir-133a-2, bta-mir-133a-1, bta-mir-133b, bta-mir-135b, bta-mir-138-1, bta-mir-143, bta-mir-144, bta-mir-146b, bta-mir-146a, bta-mir-181d, bta-mir-190a, bta-mir-199a-2, bta-mir-202, bta-mir-206, bta-mir-211, bta-mir-212, bta-mir-223, bta-mir-26a-1, bta-mir-29d, bta-mir-30f, bta-mir-338, bta-mir-33a, bta-mir-33b, bta-mir-375, bta-mir-429, bta-mir-451, bta-mir-92a-1, bta-mir-92b, bta-mir-29e, bta-mir-29b-1, bta-mir-181a-1, bta-mir-181b-1, ssc-mir-133a-1, ssc-mir-1, ssc-mir-146b, ssc-mir-181a-1, ssc-mir-30a, bta-mir-199c, ssc-mir-206, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-133b, ssc-mir-29a, ssc-mir-30d, ssc-mir-30e, ssc-mir-199a-2, ssc-mir-499, ssc-mir-143, ssc-mir-10a, ssc-mir-10b, ssc-mir-103-2, ssc-mir-181a-2, ssc-mir-181b-1, ssc-mir-181d, ssc-mir-99a, ssc-mir-92a-2, ssc-mir-92a-1, ssc-mir-92b, ssc-mir-192, ssc-mir-142, ssc-mir-127, ssc-mir-202, ssc-mir-129a, ssc-mir-455, ssc-mir-125b-1, ssc-mir-338, ssc-mir-133a-2, bta-mir-26c, ssc-mir-30c-1, ssc-mir-126, ssc-mir-199a-1, ssc-mir-451, ssc-let-7a-2, ssc-mir-129b, ssc-mir-429, ssc-let-7d, ssc-let-7f-2, ssc-mir-29b-2, ssc-mir-132, ssc-mir-138, ssc-mir-144, ssc-mir-190a, ssc-mir-212, bta-mir-133c, ssc-mir-26b, ssc-mir-200b, ssc-mir-223, ssc-mir-375, ssc-mir-33b
Furthermore, Qiang et al. (2017b) found three miRNAs (miR-310, miR-92, and miR-127) that were upregulated and four (miR-92d, miR-375, miR-146, and miR-694) that were downregulated by comparing a control group of Nile tilapia with a group infected with Streptococcus iniae. [score:7]
They recorded changes in the expression levels of eight miRNAs (miR-1a, miR-181a, miR-133a, miR-214, miR-133b, miR-206, miR-146, and miR-26a) shown to be involved in a strong resumption of myogenesis (Zhu et al., 2014). [score:3]
Seven miRNAs (miR-126-3p, miR-101a, miR-451, miR-22a, miR-146, miR-142a-5p, and miR-192) were found to have optimal stability and should be individually prioritized according to the stage and tissue of interest. [score:1]
[1 to 20 of 3 sentences]
12
[+] score: 11
In primary porcine adipocytes, miR-146a-5p inhibited TNFα -induced adipogenesis by controlling insulin receptor (IR) expression [39]. [score:5]
Wu D. Xi Q. Y. Cheng X. Dong T. Zhu X. T. Shu G. Wang L. N. Jiang Q. Y. Zhang Y. L. miR-146a-5p inhibits TNF-α -induced adipogenesis via targeting insulin receptor in primary porcine adipocytesJ. [score:5]
miR-145-5p (miR-145), miR-146a-5p, miR-183, miR-196b-5p, and miR-224 were associated with adipogenesis in mammals. [score:1]
[1 to 20 of 3 sentences]
13
[+] score: 10
To determine whether miR-146-3p is dysregulated in diabetes, we first determined the effect of miR-146b-3p overexpression in PMA-differentiated U937 monocytes. [score:4]
In the current study, we demonstrate that ADA2 is one of the targets of miR-146-3p. [score:3]
Taken together, these results suggest that an inverse correlation between miR-146b-3p and inflammation occurs in diabetes and that reduction or dysregulation of miR-146-3p may contribute to diabetic complications. [score:2]
An aliquot of 10 [6] U937 cells were pelleted and resuspended in 100  μL electroporation buffer (VCA-1004) containing negative control (NC), miR-146-5p mimic, or miR-146b-3p mimic at a final concentration of 100 nM. [score:1]
[1 to 20 of 4 sentences]
14
[+] score: 10
Knockdown of TRAF6 and mutation of MYD88 showed that the induction of miR-146a and miR-146b by Salmonella Typhimurium infection was affected by disruption of the MYD88-TRAF6 pathway, which mediates the transduction of the TLR signals and cytokine responses [11]. [score:3]
The miR-146 family members are known as inflammation inducible miRNAs involved in the negative feedback regulation of toll-like receptor (TLR) signalling [9]. [score:2]
Previous studies found that miR-146 and miR-155 were co -induced in macrophage cells in response to microbial LPS [7– 9]. [score:1]
In addition to miR-146 and miR-155, the let-7, miR-15, miR-128 and miR-29a also have roles in Salmonella infection. [score:1]
In zebrafish, miR-146a and miR-146b were commonly induced by infection of embryos with Salmonella Typhimurium [11]. [score:1]
Analysis of host miRNA by high throughput sequencing confirmed the co-induction of miR-146 and miR-155 upon live microbial infection with wild type (WT) Salmonella Typhimurium strains [10]. [score:1]
In human monocytes, the miR-146 and miR-155 can respond to endotoxins and a variety of microbial components and pro-inflammatory cytokines [9]. [score:1]
[1 to 20 of 7 sentences]
15
[+] score: 9
In this study, the sequencing data confirmed the results of previous studies, and proved that in addition to immune cells, normal cells also abundantly expressed miR-146 and miR-155 when stimulated by viral antigens and are involved in the regulation of immunity. [score:4]
In particular, mature miR-146 and miR-155 were significantly upregulated in infected ST cells compared with the control group; the fold changes of miR-146 and miR-155 between the infected ST cells and the control group were 3.30 and 1.74, respectively. [score:3]
Previous research showed that miR-146 and miR-155 play a key regulatory role on host immune function. [score:2]
[1 to 20 of 3 sentences]
16
[+] score: 9
We also found that ssc-miR-146a-5p and ssc-miR-146b were expressed at higher level in HG-IEN samples, which accords with findings in humans that these are expressed at higher levels in colon tumours than adjacent normal tissue, and are involved in CRC invasion [21, 22]. [score:5]
Ten differentially expressed miRNAs were validated by qRT-PCR: ssc-let-7e, ssc-miR-98, ssc-miR-126-3p, ssc-miR-146a-5p, ssc-miR-146b, ssc-miR-155-5p, ssc-miR-181b, ssc-miR-183, ssc-miR-191 and ssc-miR-196a. [score:3]
In summary, we have detected several miRNAs (ssc-let-7e, ssc-miR-98, ssc-miR-126-3p, ssc-miR-146a-5p, ssc-miR-146b, ssc-miR-183 and ssc-miR-196a) associated with early-stage colorectal neoplasia in APC [1311] pigs. [score:1]
[1 to 20 of 3 sentences]
17
[+] score: 8
Eight DEMs, 4 down-regulated (miR-146a, miR-222, miR-574 and miR-652) and 4 up-regulated (miR-100, miR-133a, miR-216 and miR-582-5p), were randomly chosen for validation using RT-qPCR. [score:7]
Among the 8 DEMs detected by deep sequencing, 4 were proved significant (p<0.05) by qPCR, one had a tendency to be significant (p = 0.06), yet 3 (miR-146a, miR-574 and miR-100) were not confirmed significant (Table 2). [score:1]
[1 to 20 of 2 sentences]
18
[+] score: 7
For example, gga-miR-18, gga-miR-193a, gga-miR-193b, gga-miR-30b, gga-miR-146a, gga-miR-24, gga-miR-92, gga-miR-7b, gga-miR-7-1, and gga-miR-7-2 are up-regulated after avian influenza virus infection in previous studies whereas in our results these miRNAs are down-regulated on PID 4 33. [score:7]
[1 to 20 of 1 sentences]
19
[+] score: 7
Other miRNAs from this paper: ssc-mir-146b
Impaired cytokine production following TLR agonist challenge in preterm pigs at birth is likely due to defective expression of leukocyte receptors, such as CD14, TLRs 12, or of second-messenger signaling intermediates, such as IRAK-4 or MyD88 proteins 8. Interestingly, previous mechanistic studies revealed that inhibition of the intermediate IRAK-4 is derived from the action of microRNAs, such as miR146, which is highly expressed in cord blood monocytes, relative to adult monocytes 40. [score:7]
[1 to 20 of 1 sentences]
20
[+] score: 6
To screen the potential miRNAs which can reduce PRRSV replication, the mimics or inhibitors of 10 miRNAs (Table S1), including miR-24, miR-93, miR-122, miR-125b, miR-146a, miR-155, miR-181, miR-196, miR-351, and miR-365, were chosen and synthetized. [score:3]
The mimics and inhibitors of miR-24, miR-93, miR-122, miR-125b, miR-146a, miR-155, miR-181, miR-196, miR-351, and miR-365 (shown in Table S1) were obtained from GenePharma (Shanghai, China). [score:3]
[1 to 20 of 2 sentences]
21
[+] score: 6
Among the 20 specific DEmiRNAs in Landraces' lungs, six DEmiRNAs (ssc-let-7i, ssc-miR-122, ssc-miR-195, ssc-miR-146b, ssc-miR-146a-5p, ssc-miR-30b-5p) had an expression value (TMM) larger than 10,000 at 0 dpi and all of them were down-regulated significantly at 3, 5, 7 dpi (Table 3). [score:6]
[1 to 20 of 1 sentences]
22
[+] score: 5
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-21, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-99a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-16-2, hsa-mir-192, hsa-mir-148a, hsa-mir-10b, hsa-mir-181a-2, hsa-mir-181a-1, hsa-mir-215, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-mir-15b, hsa-mir-27b, hsa-mir-125b-1, hsa-mir-141, hsa-mir-143, hsa-mir-152, hsa-mir-125b-2, hsa-mir-126, hsa-mir-146a, hsa-mir-184, hsa-mir-200c, hsa-mir-155, hsa-mir-29c, hsa-mir-200a, hsa-mir-99b, hsa-mir-296, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-378a, hsa-mir-342, hsa-mir-148b, hsa-mir-451a, ssc-mir-125b-2, ssc-mir-148a, ssc-mir-15b, ssc-mir-184, ssc-mir-224, ssc-mir-23a, ssc-mir-24-1, ssc-mir-26a, ssc-mir-29b-1, ssc-let-7f-1, ssc-mir-103-1, ssc-mir-21, ssc-mir-29c, hsa-mir-486-1, hsa-mir-499a, hsa-mir-671, hsa-mir-378d-2, bta-mir-26a-2, bta-mir-29a, bta-let-7f-2, bta-mir-103-1, bta-mir-148a, bta-mir-16b, bta-mir-21, bta-mir-499, bta-mir-99a, bta-mir-125b-1, bta-mir-126, bta-mir-181a-2, bta-mir-27b, bta-mir-31, bta-mir-15b, bta-mir-215, bta-mir-30e, bta-mir-148b, bta-mir-192, bta-mir-200a, bta-mir-200c, bta-mir-23a, bta-mir-29b-2, bta-mir-29c, bta-mir-10b, bta-mir-24-2, bta-mir-30a, bta-mir-200b, bta-let-7a-1, bta-mir-342, bta-let-7f-1, bta-let-7a-2, bta-let-7a-3, bta-mir-103-2, bta-mir-125b-2, bta-mir-15a, bta-mir-99b, hsa-mir-664a, ssc-mir-99b, hsa-mir-103b-1, hsa-mir-103b-2, ssc-mir-15a, ssc-mir-16-2, ssc-mir-16-1, bta-mir-141, bta-mir-143, bta-mir-146a, bta-mir-152, bta-mir-155, bta-mir-16a, bta-mir-184, bta-mir-24-1, bta-mir-223, bta-mir-224, bta-mir-26a-1, bta-mir-296, bta-mir-29d, bta-mir-378-1, bta-mir-451, bta-mir-486, bta-mir-671, bta-mir-29e, bta-mir-29b-1, bta-mir-181a-1, ssc-mir-181a-1, ssc-mir-215, ssc-mir-30a, bta-mir-2318, bta-mir-2339, bta-mir-2430, bta-mir-664a, bta-mir-378-2, ssc-let-7a-1, ssc-mir-378-1, ssc-mir-29a, ssc-mir-30e, ssc-mir-499, ssc-mir-143, ssc-mir-10b, ssc-mir-486-1, ssc-mir-152, ssc-mir-103-2, ssc-mir-181a-2, ssc-mir-27b, ssc-mir-24-2, ssc-mir-99a, ssc-mir-148b, ssc-mir-664, ssc-mir-192, ssc-mir-342, ssc-mir-125b-1, oar-mir-21, oar-mir-29a, oar-mir-125b, oar-mir-181a-1, hsa-mir-378b, hsa-mir-378c, ssc-mir-296, ssc-mir-155, bta-mir-148c, ssc-mir-126, ssc-mir-378-2, ssc-mir-451, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-451b, hsa-mir-499b, ssc-let-7a-2, ssc-mir-486-2, hsa-mir-664b, hsa-mir-378j, ssc-let-7f-2, ssc-mir-29b-2, ssc-mir-31, ssc-mir-671, bta-mir-378b, bta-mir-378c, hsa-mir-486-2, oar-let-7a, oar-let-7f, oar-mir-103, oar-mir-10b, oar-mir-143, oar-mir-148a, oar-mir-152, oar-mir-16b, oar-mir-181a-2, oar-mir-200a, oar-mir-200b, oar-mir-200c, oar-mir-23a, oar-mir-26a, oar-mir-29b-1, oar-mir-30a, oar-mir-99a, bta-mir-664b, chi-let-7a, chi-let-7f, chi-mir-103, chi-mir-10b, chi-mir-125b, chi-mir-126, chi-mir-141, chi-mir-143, chi-mir-146a, chi-mir-148a, chi-mir-148b, chi-mir-155, chi-mir-15a, chi-mir-15b, chi-mir-16a, chi-mir-16b, chi-mir-184, chi-mir-192, chi-mir-200a, chi-mir-200b, chi-mir-200c, chi-mir-215, chi-mir-21, chi-mir-223, chi-mir-224, chi-mir-2318, chi-mir-23a, chi-mir-24, chi-mir-26a, chi-mir-27b, chi-mir-296, chi-mir-29a, chi-mir-29b, chi-mir-29c, chi-mir-30a, chi-mir-30e, chi-mir-342, chi-mir-378, chi-mir-451, chi-mir-499, chi-mir-671, chi-mir-99a, chi-mir-99b, bta-mir-378d, ssc-mir-378b, oar-mir-29b-2, ssc-mir-141, ssc-mir-200b, ssc-mir-223, bta-mir-148d
A differential expression of four immune related miRNAs, miR-125b, miR-155, miR-146a, and miR-223 upon stimulation of bovine monocytes with LPS or Staphylococcus aureus enterotoxin B was demonstrated (Dilda et al., 2012). [score:3]
The 5’ regulatory sequences of active miR-146a promoters are hypomethylated and associated with euchromatic histone modification marks in B lymphoid cells. [score:2]
[1 to 20 of 2 sentences]
23
[+] score: 3
Moreover, several studies have demonstrated that cellular microRNAs (miR-323, miR-491, miR654, miR-146a) inhibit influenza virus replication or propagation [23, 24]. [score:3]
[1 to 20 of 1 sentences]
24
[+] score: 2
Increasing evidence has revealed that the miR-146 family (miR-146a and miR-146b) mediates IRAK1 (interleukin 1 receptor -associated kinase) and TGF-β (transforming growth factor-β) signaling pathways through negative feedback regulation during intestinal epithelial cell differentiation and in the mucosal immune system [45], [46]. [score:2]
[1 to 20 of 1 sentences]
25
[+] score: 1
Many immune-related miRNAs have been identified in innate and adaptive immune systems, including the miR-17—92 cluster, miR-221, miR-10, miR-196b, miR-126, miR-155, miR-150; miR-181a, miR-326, miR-142-3p, miR-424, miR-21, miR-106a, miR-223, miR-146; the let-7 family, miR-9, and miR-34 [6]. [score:1]
[1 to 20 of 1 sentences]