miRNA Search Results

sort by 6 publications mentioning hsa-mir-676 Open access articles that are associated with the species Homo sapiens and mention the gene name mir-676. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.
1	[+] score: 20 Other miRNAs from this paper: hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-22, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-30a, hsa-mir-93, hsa-mir-107, mmu-mir-15b, mmu-mir-23b, mmu-mir-30a, mmu-mir-30b, mmu-mir-125b-2, mmu-mir-130a, mmu-mir-9-2, mmu-mir-152, hsa-mir-192, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-10a, hsa-mir-34a, mmu-mir-130b, hsa-mir-15b, hsa-mir-23b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-152, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, mmu-mir-19b-2, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-192, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-20a, mmu-mir-22, mmu-mir-26a-1, mmu-mir-26b, mmu-mir-93, mmu-mir-34a, mmu-mir-323, mmu-mir-107, mmu-mir-10a, mmu-mir-17, mmu-mir-19a, mmu-mir-25, mmu-mir-26a-2, mmu-mir-19b-1, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-125b-1, hsa-mir-30c-1, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-369, hsa-mir-382, mmu-mir-382, hsa-mir-323a, mmu-mir-410, mmu-mir-411, hsa-mir-20b, mmu-mir-433, hsa-mir-433, hsa-mir-410, hsa-mir-494, hsa-mir-495, mmu-mir-494, mmu-mir-369, mmu-mir-20b, hsa-mir-411, mmu-mir-495, mmu-mir-676, hsa-mir-323b, mmu-mir-30f, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3 Moreover, analyzing miRNAs expression in a mouse mo del (TH- MYCN/p53ER [TAM]) possessing a transgenic p53 allele that drives the expression of an inactive protein, we identified miR-125b-3p and miR-676 as directly or indirectly regulated by the level of functional p53. [score:8] Although cluster analysis based on all miRNAs did not distinguish tumors with respect to p53 genotype, miR-125b-3p and miR-676 were significantly down-regulated (p<0.03) in TH- MYCN/p53ER [TAM] tumors (Figure 1B–C) based on the Wilcoxon Rank Sum Test with p-values corrected for multiple comparisons (n = 440). [score:4] The only two miRNAs that were down-regulated in TH- MYCN tumors from TH- MYCN/p53ER [TAM] mice were miR-125b-3p and miR-676. [score:4] Expression of miR-125b-3p and miR-676 in TH- MYCN (n = 9) and TH- MYCN/p53ER [TAM] tumors (n = 13). [score:3] No specific role has thus far been ascribed to miR-676 in human neuroblastoma, which has a seed region that is not identical between the two species. [score:1] [1 to 20 of 5 sentences]
2	[+] score: 11 Other miRNAs from this paper: hsa-mir-181b-1, hsa-mir-181b-2, hsa-mir-193b To further explore the sensitivity and specificity of cmiRNAs in discriminating between acclimatized and un-acclimatized individuals, we measured the expression levels of has-miR-676-3p (MIMAT0018204), has-miR-3591-3p (MIMAT0019877), has-miR-181b-5p (MIMAT0000257) and has-miR-193b-5p (MIMAT0004767), the most differentially up-regulated cmiRNAs, by qRT-PCR. [score:4] Indeed, has-miR-676-3p, has-miR-3591-3p, has-miR-181b-5p, and has-miR-193b-5p were differentially expressed between acclimatized and un-acclimatized individuals. [score:3] microRNA name Forward primer Reverse primer miR-181b-5p CACGACACCAACATTCATTGC TATGGTTGTTCTCGTCTCCTTCTC miR-676-3p ACGCCGTCCTGAGGTTGT TATGGTTTTGACGACTGTGTGAT miR-193b-5p AGGCCGGGGTTTTGAGG TATGGTTGTTCACGACTCCTTCAC miR-3591-3p GCCGCTTAAACACCATTGTC TATGCTTGTTCTCGTCTCTGTGTC cel-miR-39 ATATCATCTCACCGGGTGTAAATC TATGGTTTTGACGACTGTGTGAT After microRNA profiling, we searched three well-known target prediction databases, including TargetScan (http://www. [score:3] Moreover, among the four cmiRNAs, has-miR-3591-3p, has-miR-676-3p, and has-miR-181b-5p yielded ROC AUCs of 0.805 (P < 0.0001), 0.713 (P < 0.01), and 0.734 (P < 0.01), respectively, indicating that these cmiRNAs were fairly accurate in determining un-acclimatization diagnosis (Figure 5B). [score:1] [1 to 20 of 4 sentences]
3	[+] score: 7 Other miRNAs from this paper: hsa-let-7d, hsa-let-7e, hsa-mir-27a, mmu-mir-1a-1, mmu-mir-10b, hsa-mir-208a, hsa-mir-10a, hsa-mir-10b, hsa-mir-181b-1, mmu-let-7d, hsa-mir-1-2, mmu-mir-208a, mmu-let-7e, mmu-mir-27a, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-181b-2, mmu-mir-10a, mmu-mir-181b-1, mmu-mir-181b-2, hsa-mir-423, hsa-mir-486-1, mmu-mir-486a, mmu-mir-423, mmu-mir-676, mmu-mir-1b, mmu-mir-486b, mmu-mir-5099, hsa-mir-486-2 After applying a 5% Benjamini–Hochberg false discovery rate correction, miR-5099, miR-486-3p, miR-423-5p, Let-7d-3p, miR-676-3p, miR-181b-5p, and Let-7e-5p were significantly upregulated and miR-10b-5p downregulated (Figure 2E, hatched bars). [score:7] [1 to 20 of 1 sentences]
4	[+] score: 6 Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-20a, hsa-mir-22, hsa-mir-23a, hsa-mir-25, hsa-mir-26a-1, hsa-mir-28, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-197, hsa-mir-30d, hsa-mir-139, hsa-mir-10a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-203a, hsa-mir-181a-1, hsa-mir-215, hsa-mir-30b, hsa-mir-130a, hsa-mir-132, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-127, hsa-mir-136, hsa-mir-181b-2, hsa-mir-101-2, hsa-mir-34c, hsa-mir-26a-2, hsa-mir-378a, hsa-mir-133b, hsa-mir-196b, hsa-mir-495, hsa-mir-497, hsa-mir-499a, hsa-mir-502, hsa-mir-503, hsa-mir-505, hsa-mir-532, hsa-mir-574, hsa-mir-599, hsa-mir-628, hsa-mir-33b, hsa-mir-646, hsa-mir-652, hsa-mir-653, hsa-mir-421, hsa-mir-542, hsa-mir-1296, hsa-mir-1271, hsa-mir-378d-2, hsa-mir-770, hsa-mir-939, hsa-mir-1306, hsa-mir-1307, hsa-mir-378b, hsa-mir-1193, hsa-mir-3065, hsa-mir-378c, hsa-mir-4298, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-203b, hsa-mir-499b, hsa-mir-378j severe (p<0.05) cfa-let-7d, cfa-miR-101, cfa-miR-10a, cfa-miR-1296, cfa-miR-1306, cfa-miR-1307, cfa-miR-130a, cfa-miR-136, cfa-miR-17, cfa-miR-181b, cfa-miR-196b, cfa-miR-197, cfa-miR-215, cfa-miR-22, cfa-miR-30d, cfa-miR-33b, cfa-miR-497, cfa-miR-503, cfa-miR-574, cfa-miR-628, cfa-miR-676 Comparing the miRNA differential expression analyses between disease states obtained by RT-qPCR and RNAseq, we observed discordances between the two methods. [score:5] severe (p<0.05) cfa-let-7c, cfa-miR-10a, cfa-miR-1307, cfa-miR-132, cfa-miR-136, cfa-miR-181a, cfa-miR-181b, cfa-miR-196b, cfa-miR-20a, cfa-miR-30d, cfa-miR-33b, cfa-miR-34c, cfa-miR-497, cfa-miR-499, cfa-miR-676 Mild vs. [score:1] [1 to 20 of 2 sentences]
5	[+] score: 1 Other miRNAs from this paper: hsa-mir-675 H19 encodes two conserved miRNAs processed from its first exon, miR-676-5p and miR-675-3p [9]. [score:1] [1 to 20 of 1 sentences]
6	[+] score: 1 Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-20a, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-29a, hsa-mir-30a, hsa-mir-93, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-107, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-15b, mmu-mir-23b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-101a, mmu-mir-124-3, mmu-mir-125a, mmu-mir-130a, mmu-mir-9-2, mmu-mir-135a-1, mmu-mir-136, mmu-mir-138-2, mmu-mir-140, mmu-mir-144, mmu-mir-145a, mmu-mir-146a, mmu-mir-149, mmu-mir-152, mmu-mir-10b, mmu-mir-181a-2, mmu-mir-182, mmu-mir-183, mmu-mir-185, mmu-mir-24-1, mmu-mir-191, mmu-mir-193a, mmu-mir-195a, mmu-mir-200b, mmu-mir-204, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-204, hsa-mir-181a-1, hsa-mir-221, hsa-mir-222, hsa-mir-200b, mmu-mir-301a, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, mmu-mir-130b, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-23b, hsa-mir-30b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-130a, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-138-2, hsa-mir-140, hsa-mir-144, hsa-mir-145, hsa-mir-152, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-136, hsa-mir-138-1, hsa-mir-146a, hsa-mir-149, hsa-mir-185, hsa-mir-193a, hsa-mir-195, hsa-mir-320a, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-20a, mmu-mir-23a, mmu-mir-24-2, mmu-mir-26a-1, mmu-mir-26b, mmu-mir-29a, mmu-mir-29c, mmu-mir-93, mmu-mir-34a, mmu-mir-330, mmu-mir-339, mmu-mir-340, mmu-mir-135b, mmu-mir-101b, hsa-mir-200c, hsa-mir-181b-2, mmu-mir-107, mmu-mir-10a, mmu-mir-17, mmu-mir-200c, mmu-mir-181a-1, mmu-mir-320, mmu-mir-26a-2, mmu-mir-221, mmu-mir-222, mmu-mir-29b-2, mmu-mir-135a-2, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-138-1, mmu-mir-181b-1, mmu-mir-181c, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-361, mmu-mir-361, hsa-mir-376a-1, mmu-mir-376a, hsa-mir-340, hsa-mir-330, hsa-mir-135b, hsa-mir-339, hsa-mir-335, mmu-mir-335, mmu-mir-181b-2, mmu-mir-376b, mmu-mir-434, mmu-mir-467a-1, hsa-mir-376b, hsa-mir-485, hsa-mir-146b, hsa-mir-193b, hsa-mir-181d, mmu-mir-485, mmu-mir-541, hsa-mir-376a-2, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, mmu-mir-301b, mmu-mir-674, mmu-mir-146b, mmu-mir-467b, mmu-mir-669c, mmu-mir-708, mmu-mir-676, mmu-mir-181d, mmu-mir-193b, mmu-mir-467c, mmu-mir-467d, hsa-mir-541, hsa-mir-708, hsa-mir-301b, mmu-mir-467e, mmu-mir-467f, mmu-mir-467g, mmu-mir-467h, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, mmu-mir-467a-2, mmu-mir-467a-3, mmu-mir-467a-4, mmu-mir-467a-5, mmu-mir-467a-6, mmu-mir-467a-7, mmu-mir-467a-8, mmu-mir-467a-9, mmu-mir-467a-10, hsa-mir-320e, mmu-mir-101c, mmu-mir-195b, mmu-mir-145b, mmu-let-7j, mmu-mir-130c, mmu-mir-30f, mmu-let-7k, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3 88E-0327mmu-miR-451mir-4510.3310.722.79E-046.57E-0366mmu-miR-669c-5pmir-4670.178.847.68E-037.41E-0255mmu-miR-485-3pmir-4850.196.755.52E-036.39E-0265mmu-miR-669nmir-669n0.147.887.46E-037.31E-0260mmu-miR-674-5pmir-6740.178.646.08E-036.45E-0254mmu-miR-676-3pmir-6760.156.634.48E-035.28E-0211mmu-miR-7a-5pmir-70.249.171.37E-057.91E-0436mmu-miR-708-5pmir-7080.179.389.09E-041. [score:1] [1 to 20 of 1 sentences]

sort by

6 publications mentioning hsa-mir-676

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-676. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

[+] score: 20

Other miRNAs from this paper: hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-22, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-30a, hsa-mir-93, hsa-mir-107, mmu-mir-15b, mmu-mir-23b, mmu-mir-30a, mmu-mir-30b, mmu-mir-125b-2, mmu-mir-130a, mmu-mir-9-2, mmu-mir-152, hsa-mir-192, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-10a, hsa-mir-34a, mmu-mir-130b, hsa-mir-15b, hsa-mir-23b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-152, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, mmu-mir-19b-2, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-192, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-20a, mmu-mir-22, mmu-mir-26a-1, mmu-mir-26b, mmu-mir-93, mmu-mir-34a, mmu-mir-323, mmu-mir-107, mmu-mir-10a, mmu-mir-17, mmu-mir-19a, mmu-mir-25, mmu-mir-26a-2, mmu-mir-19b-1, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-125b-1, hsa-mir-30c-1, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-369, hsa-mir-382, mmu-mir-382, hsa-mir-323a, mmu-mir-410, mmu-mir-411, hsa-mir-20b, mmu-mir-433, hsa-mir-433, hsa-mir-410, hsa-mir-494, hsa-mir-495, mmu-mir-494, mmu-mir-369, mmu-mir-20b, hsa-mir-411, mmu-mir-495, mmu-mir-676, hsa-mir-323b, mmu-mir-30f, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3

Moreover, analyzing miRNAs expression in a mouse mo del (TH- MYCN/p53ER [TAM]) possessing a transgenic p53 allele that drives the expression of an inactive protein, we identified miR-125b-3p and miR-676 as directly or indirectly regulated by the level of functional p53. [score:8]

Although cluster analysis based on all miRNAs did not distinguish tumors with respect to p53 genotype, miR-125b-3p and miR-676 were significantly down-regulated (p<0.03) in TH- MYCN/p53ER [TAM] tumors (Figure 1B–C) based on the Wilcoxon Rank Sum Test with p-values corrected for multiple comparisons (n = 440). [score:4]

The only two miRNAs that were down-regulated in TH- MYCN tumors from TH- MYCN/p53ER [TAM] mice were miR-125b-3p and miR-676. [score:4]

Expression of miR-125b-3p and miR-676 in TH- MYCN (n = 9) and TH- MYCN/p53ER [TAM] tumors (n = 13). [score:3]

No specific role has thus far been ascribed to miR-676 in human neuroblastoma, which has a seed region that is not identical between the two species. [score:1]

[1 to 20 of 5 sentences]

[+] score: 11

Other miRNAs from this paper: hsa-mir-181b-1, hsa-mir-181b-2, hsa-mir-193b

To further explore the sensitivity and specificity of cmiRNAs in discriminating between acclimatized and un-acclimatized individuals, we measured the expression levels of has-miR-676-3p (MIMAT0018204), has-miR-3591-3p (MIMAT0019877), has-miR-181b-5p (MIMAT0000257) and has-miR-193b-5p (MIMAT0004767), the most differentially up-regulated cmiRNAs, by qRT-PCR. [score:4]

Indeed, has-miR-676-3p, has-miR-3591-3p, has-miR-181b-5p, and has-miR-193b-5p were differentially expressed between acclimatized and un-acclimatized individuals. [score:3]

microRNA name Forward primer Reverse primer miR-181b-5p CACGACACCAACATTCATTGC TATGGTTGTTCTCGTCTCCTTCTC miR-676-3p ACGCCGTCCTGAGGTTGT TATGGTTTTGACGACTGTGTGAT miR-193b-5p AGGCCGGGGTTTTGAGG TATGGTTGTTCACGACTCCTTCAC miR-3591-3p GCCGCTTAAACACCATTGTC TATGCTTGTTCTCGTCTCTGTGTC cel-miR-39 ATATCATCTCACCGGGTGTAAATC TATGGTTTTGACGACTGTGTGAT After microRNA profiling, we searched three well-known target prediction databases, including TargetScan (http://www. [score:3]

Moreover, among the four cmiRNAs, has-miR-3591-3p, has-miR-676-3p, and has-miR-181b-5p yielded ROC AUCs of 0.805 (P < 0.0001), 0.713 (P < 0.01), and 0.734 (P < 0.01), respectively, indicating that these cmiRNAs were fairly accurate in determining un-acclimatization diagnosis (Figure 5B). [score:1]

[1 to 20 of 4 sentences]

[+] score: 7

Other miRNAs from this paper: hsa-let-7d, hsa-let-7e, hsa-mir-27a, mmu-mir-1a-1, mmu-mir-10b, hsa-mir-208a, hsa-mir-10a, hsa-mir-10b, hsa-mir-181b-1, mmu-let-7d, hsa-mir-1-2, mmu-mir-208a, mmu-let-7e, mmu-mir-27a, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-181b-2, mmu-mir-10a, mmu-mir-181b-1, mmu-mir-181b-2, hsa-mir-423, hsa-mir-486-1, mmu-mir-486a, mmu-mir-423, mmu-mir-676, mmu-mir-1b, mmu-mir-486b, mmu-mir-5099, hsa-mir-486-2

After applying a 5% Benjamini–Hochberg false discovery rate correction, miR-5099, miR-486-3p, miR-423-5p, Let-7d-3p, miR-676-3p, miR-181b-5p, and Let-7e-5p were significantly upregulated and miR-10b-5p downregulated (Figure 2E, hatched bars). [score:7]

[1 to 20 of 1 sentences]

[+] score: 6

Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-20a, hsa-mir-22, hsa-mir-23a, hsa-mir-25, hsa-mir-26a-1, hsa-mir-28, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-197, hsa-mir-30d, hsa-mir-139, hsa-mir-10a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-203a, hsa-mir-181a-1, hsa-mir-215, hsa-mir-30b, hsa-mir-130a, hsa-mir-132, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-127, hsa-mir-136, hsa-mir-181b-2, hsa-mir-101-2, hsa-mir-34c, hsa-mir-26a-2, hsa-mir-378a, hsa-mir-133b, hsa-mir-196b, hsa-mir-495, hsa-mir-497, hsa-mir-499a, hsa-mir-502, hsa-mir-503, hsa-mir-505, hsa-mir-532, hsa-mir-574, hsa-mir-599, hsa-mir-628, hsa-mir-33b, hsa-mir-646, hsa-mir-652, hsa-mir-653, hsa-mir-421, hsa-mir-542, hsa-mir-1296, hsa-mir-1271, hsa-mir-378d-2, hsa-mir-770, hsa-mir-939, hsa-mir-1306, hsa-mir-1307, hsa-mir-378b, hsa-mir-1193, hsa-mir-3065, hsa-mir-378c, hsa-mir-4298, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-203b, hsa-mir-499b, hsa-mir-378j

severe (p<0.05) cfa-let-7d, cfa-miR-101, cfa-miR-10a, cfa-miR-1296, cfa-miR-1306, cfa-miR-1307, cfa-miR-130a, cfa-miR-136, cfa-miR-17, cfa-miR-181b, cfa-miR-196b, cfa-miR-197, cfa-miR-215, cfa-miR-22, cfa-miR-30d, cfa-miR-33b, cfa-miR-497, cfa-miR-503, cfa-miR-574, cfa-miR-628, cfa-miR-676 Comparing the miRNA differential expression analyses between disease states obtained by RT-qPCR and RNAseq, we observed discordances between the two methods. [score:5]

severe (p<0.05) cfa-let-7c, cfa-miR-10a, cfa-miR-1307, cfa-miR-132, cfa-miR-136, cfa-miR-181a, cfa-miR-181b, cfa-miR-196b, cfa-miR-20a, cfa-miR-30d, cfa-miR-33b, cfa-miR-34c, cfa-miR-497, cfa-miR-499, cfa-miR-676 Mild vs. [score:1]

[1 to 20 of 2 sentences]

[+] score: 1

Other miRNAs from this paper: hsa-mir-675

H19 encodes two conserved miRNAs processed from its first exon, miR-676-5p and miR-675-3p [9]. [score:1]

[1 to 20 of 1 sentences]

[+] score: 1

Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-20a, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-29a, hsa-mir-30a, hsa-mir-93, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-107, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-15b, mmu-mir-23b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-101a, mmu-mir-124-3, mmu-mir-125a, mmu-mir-130a, mmu-mir-9-2, mmu-mir-135a-1, mmu-mir-136, mmu-mir-138-2, mmu-mir-140, mmu-mir-144, mmu-mir-145a, mmu-mir-146a, mmu-mir-149, mmu-mir-152, mmu-mir-10b, mmu-mir-181a-2, mmu-mir-182, mmu-mir-183, mmu-mir-185, mmu-mir-24-1, mmu-mir-191, mmu-mir-193a, mmu-mir-195a, mmu-mir-200b, mmu-mir-204, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-204, hsa-mir-181a-1, hsa-mir-221, hsa-mir-222, hsa-mir-200b, mmu-mir-301a, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, mmu-mir-130b, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-23b, hsa-mir-30b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-130a, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-138-2, hsa-mir-140, hsa-mir-144, hsa-mir-145, hsa-mir-152, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-136, hsa-mir-138-1, hsa-mir-146a, hsa-mir-149, hsa-mir-185, hsa-mir-193a, hsa-mir-195, hsa-mir-320a, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-20a, mmu-mir-23a, mmu-mir-24-2, mmu-mir-26a-1, mmu-mir-26b, mmu-mir-29a, mmu-mir-29c, mmu-mir-93, mmu-mir-34a, mmu-mir-330, mmu-mir-339, mmu-mir-340, mmu-mir-135b, mmu-mir-101b, hsa-mir-200c, hsa-mir-181b-2, mmu-mir-107, mmu-mir-10a, mmu-mir-17, mmu-mir-200c, mmu-mir-181a-1, mmu-mir-320, mmu-mir-26a-2, mmu-mir-221, mmu-mir-222, mmu-mir-29b-2, mmu-mir-135a-2, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-138-1, mmu-mir-181b-1, mmu-mir-181c, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-361, mmu-mir-361, hsa-mir-376a-1, mmu-mir-376a, hsa-mir-340, hsa-mir-330, hsa-mir-135b, hsa-mir-339, hsa-mir-335, mmu-mir-335, mmu-mir-181b-2, mmu-mir-376b, mmu-mir-434, mmu-mir-467a-1, hsa-mir-376b, hsa-mir-485, hsa-mir-146b, hsa-mir-193b, hsa-mir-181d, mmu-mir-485, mmu-mir-541, hsa-mir-376a-2, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, mmu-mir-301b, mmu-mir-674, mmu-mir-146b, mmu-mir-467b, mmu-mir-669c, mmu-mir-708, mmu-mir-676, mmu-mir-181d, mmu-mir-193b, mmu-mir-467c, mmu-mir-467d, hsa-mir-541, hsa-mir-708, hsa-mir-301b, mmu-mir-467e, mmu-mir-467f, mmu-mir-467g, mmu-mir-467h, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, mmu-mir-467a-2, mmu-mir-467a-3, mmu-mir-467a-4, mmu-mir-467a-5, mmu-mir-467a-6, mmu-mir-467a-7, mmu-mir-467a-8, mmu-mir-467a-9, mmu-mir-467a-10, hsa-mir-320e, mmu-mir-101c, mmu-mir-195b, mmu-mir-145b, mmu-let-7j, mmu-mir-130c, mmu-mir-30f, mmu-let-7k, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3

88E-0327mmu-miR-451mir-4510.3310.722.79E-046.57E-0366mmu-miR-669c-5pmir-4670.178.847.68E-037.41E-0255mmu-miR-485-3pmir-4850.196.755.52E-036.39E-0265mmu-miR-669nmir-669n0.147.887.46E-037.31E-0260mmu-miR-674-5pmir-6740.178.646.08E-036.45E-0254mmu-miR-676-3pmir-6760.156.634.48E-035.28E-0211mmu-miR-7a-5pmir-70.249.171.37E-057.91E-0436mmu-miR-708-5pmir-7080.179.389.09E-041. [score:1]

[1 to 20 of 1 sentences]

miRBase

6 publications mentioning hsa-mir-676