sort by

13 publications mentioning hsa-mir-3940

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-3940. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 38
Table 1 Nine miRNAs selected after rescreening miRNA_miRBase-18th Fold change (3/1) Direction hsa-miR-1469 1.262138297 Upregulated hsa-miR-762 1.200592588 Upregulated hsa-miR-338-5p 2.129779884 Upregulated hsa-miR-3173-3p 1.226251386 Upregulated hsa-miR-4467 1.284049958 Upregulated hsa-miR-3940-5p 1.336691618 Upregulated hsa-miR-3195 1.376221162 Upregulated hsa-miR-3621 1.273270254 Upregulated hsa-miR-663a 1.221943009 Upregulated As miR-338-5p demonstrated the highest upregulation by ACBP-3, it was selected for validation by qRT-PCR. [score:32]
The differentially expressed miRNAs detected in two chips did not overlap, so, after multiple rescreening processes, nine miRNAs significantly upregulated by ACBP-3 (P < 0.05) were selected for further analysis: hsa-miR-1469, hsa-miR-762, hsa-miR-338-5p, hsa-miR-3173-3p, hsa-miR-4467, hsa-miR-3940-5p, hsa-miR-3195, hsa-miR-3621, and hsa-miR-663a (Table  1). [score:6]
[1 to 20 of 2 sentences]
2
[+] score: 24
Among these AF -associated miRNAs, 22 were up-regulated and 20 were down-regulated (Table  3 and Figure  3B) Table 3 miRNA expression differences between AF-LAA and SR-LAA miRNA SR-LAA signal AF-LAA signal Log 2 (AF-LAA/SR-LAA) P -valueUp-regulated (n = 22*)hsa-miR-3613-3p29430633.381.07E-02hsa-miR-49429618812.675.89E-02hsa-miR-3591-3p53920691.947.14E-02hsa-miR-4485802841.835.03E-02hsa-miR-574-3p4478135161.592.41E-02hsa-miR-466118333431.502.31E-02hsa-miR-44923348341.322.73E-02hsa-let-7d-3p1463441.239.94E-02hsa-miR-4707-5p3878571.152.92E-02hsa-miR-4534791721.126.66E-02hsa-miR-3940-5p3978031.025.71E-02hsa-miR-31781853741.011.97E-02hsa-miR-15b-5p3837230.923.04E-02hsa-miR-21-5p4428190.894.66E-02hsa-miR-3196138324770.841.34E-02hsa-miR-1307-3p821450.835. [score:12]
Among these AF -associated miRNAs, 22 were up-regulated and 20 were down-regulated (Table  3 and Figure  3B) Table 3 miRNA expression differences between AF-LAA and SR-LAA miRNA SR-LAA signal AF-LAA signal Log 2 (AF-LAA/SR-LAA) P -valueUp-regulated (n = 22*)hsa-miR-3613-3p29430633.381.07E-02hsa-miR-49429618812.675.89E-02hsa-miR-3591-3p53920691.947.14E-02hsa-miR-4485802841.835.03E-02hsa-miR-574-3p4478135161.592.41E-02hsa-miR-466118333431.502.31E-02hsa-miR-44923348341.322.73E-02hsa-let-7d-3p1463441.239.94E-02hsa-miR-4707-5p3878571.152.92E-02hsa-miR-4534791721.126.66E-02hsa-miR-3940-5p3978031.025.71E-02hsa-miR-31781853741.011.97E-02hsa-miR-15b-5p3837230.923.04E-02hsa-miR-21-5p4428190.894.66E-02hsa-miR-3196138324770.841.34E-02hsa-miR-1307-3p821450.835. [score:12]
[1 to 20 of 2 sentences]
3
[+] score: 12
Some of the EV miRNAs (miR-181d-3p, miR-155-3p, miR-185-5p, miR-3940-3p, miR-4532, miR-7107-5p miR-504-3p, miR-320d, miR-19b-3p and miR-22-3p) up-regulated in female OA synovial fluid were down-regulated in response to estrogen treatment in human and mouse cells 51– 54. [score:7]
Further detailed analysis showed that 6 miRNAs (miR-181d-3p, miR-3940-3p, miR-155-3p, miR-4532, miR-185-5p, miR-7107-5p) target 9 genes of the ovarian steroidogenesis pathway and the same number of miRNAs (miR-4532, miR-181d-3p, miR-185-5p miR-6865-3p, miR-4459, miR-7107-5p) target 14 genes of the estrogen signaling pathway. [score:5]
[1 to 20 of 2 sentences]
4
[+] score: 12
Despite the low levels of expression for miR-3615376 (currently annotated as miR-3940), this miRNA shows differential expression between healthy and failing myocardium, suggesting a functional role in the heart and more specifically in cardiac disease but the targets and functions of this novel miRNA remain to be investigated. [score:7]
This miRNA, which has very recently been annotated in miRBase as hsa-miR-3940, is expressed in various mouse tissues and although at relative low levels, also expressed in cardiac tissue. [score:5]
[1 to 20 of 2 sentences]
5
[+] score: 7
Among the miRNAs, the function of fifteen downregulated miRNAs (miR-1587, miR-4505, miR-1915-3p, miR-4466, miR-3162-5p, miR-4484, miR-5001-5p, miR-3940-5p, miR-4687-3p, miR-6068, miR-548ao-3p, miR-4687-5p, miR-1273g-3p, miR-877-3p, miR-4312) and the function of two miRNAs that were upregulated (miR-520f-3p, miR-4307) remain unknown. [score:7]
[1 to 20 of 1 sentences]
6
[+] score: 7
Different results were obtained with 5′- and 3′-tailed mirtrons, where disruption of the splicing sites did not inhibit the accumulation of hsa-miR-3064-5p, hsa-miR-6515-5p, hsa-miR-3940-5p, and hsa-miR-6850-5p (Fig.   1). [score:3]
Putative human conventional mirtron-derived hsa-miR-1227-3p, hsa-miR-1229-3p, hsa-miR-1236-3p, and hsa-miR-1238-3p [15] and 3′-tailed mirtron-derived hsa-miR-3940-5p and hsa-miR-6850-5p were identified in short 69–102 nucleotide introns, whereas hsa-miR-3064-5p and hsa-miR-6515-5p were processed from both long (1236 nt) and short (88 nt) 5′-tailed mirtrons [12]. [score:1]
Introns containing validated mirtronic miRNA hsa-mir-1226-3p or predicted miRNAs hsa-mir-1227-3p, hsa-mir-1229-3p, hsa-mir-1236-3p, and hsa-mir-1238-3p processed from conventional; hsa-miR-3064-5p and hsa-miR-6515-5p from 5′-tailed; and hsa-miR-3940-5p and hsa-miR-6850-5p from 3′-tailed mirtrons are depicted as red lines. [score:1]
Schemes represent protein-coding genes, harboring reside-verified mirtronic miRNA hsa-miR-1226-3p, putative conventional mirtronic miRNAs hsa-miR-1227-3p, hsa-miR-1229-3p, and hsa-miR-1238-3p, mirtronic miRNAs, located in 5′-tailed mirtrons hsa-miR-3064-5p and hsa-miR-6515-5p and mirtronic miRNAs, located in 3′-tailed mirtrons hsa-miR-3940-5p and hsa-miR-6850-5p. [score:1]
Despite successful experimental validation of mirtronic miRNAs derived from conventional mirtrons, analysis of the annotated 5′-tailed mirtrons containing hsa-miR-3064-5p and hsa-miR-6515-5p or 3′-tailed mirtrons with hsa-miR-3940-5p and hsa-miR-6850-5p revealed no splicing requirement for the biogenesis of the intron-derived miRNAs. [score:1]
[1 to 20 of 5 sentences]
7
[+] score: 5
The sequences of targeting motifs used to build the miRNA -inhibitor vectors are listed below: (1) aaagtgccgccatcttttgagt for miR-371b-5p, (2) gcacagcccccgtccctccct for miR-149, (3) cgccgccccgcacctgct for miR-3665, (4) cagagcccgccccaacccac for miR-3940-5p, (5) cccccgcctccgccgccgcc for miR-3960, (6) gcctgccccctccaacagcca for miR-4687-3p, (7) gcggtcccgcggcgccccgcct for miR-663, and (8) gctcggccccggccccagcccc for miR-762. [score:5]
[1 to 20 of 1 sentences]
8
[+] score: 5
Other miRNAs from this paper: hsa-mir-106a, hsa-mir-222, hsa-mir-106b
In TargetScanHuman v. 7.1 database [28], miR-106a-5p, miR-3656, miR-3940-5p, miR-6087, miR-4792, and miR-222-3p had been predicted to have ABCG2 as a target. [score:5]
[1 to 20 of 1 sentences]
9
[+] score: 4
Human miRNA name M. oleifera miRNA name r-value Sequence alignment details hsa-miR6503-3p mol-miR166i 0.67 -GGAC-AGG-U-CA--CC-CC hsa-miR548ah-5p mol-miR393c 0.65 -AAAG-GAU-GCA-UG-U-- hsa-miR3940-5p mol-miR159a 0.65 -UGG-UUG--G-G-GCUCU- hsa-miR579 mol-miR168a 0.57 UC--UUGGU--A---CG-GA- hsa-miR4534 mol-miR159a 0.71 GGAU-GA-G-G-G-UCU hsa-miR1306-3p mol-miR6478 0.78 AC-UU-GCUC-G-UGGUG hsa-miR4703-3p mol-miR6300 0.72 GU-GUUGUA-U-UA-UG- hsa-miR5008-5p mol-miR6300 0.67 G-C-UUG--G-A-AGUGG hsa-miR4273 mol-miR398c 0.67 GUGUUCUC-G-U-G-C-- COMIR software [33] predicted human genes that could be regulated by M. oleifera miRNAs. [score:2]
Human miRNA name M. oleifera miRNA name r-value Sequence alignment details hsa-miR6503-3p mol-miR166i 0.67 -GGAC-AGG-U-CA--CC-CC hsa-miR548ah-5p mol-miR393c 0.65 -AAAG-GAU-GCA-UG-U-- hsa-miR3940-5p mol-miR159a 0.65 -UGG-UUG--G-G-GCUCU- hsa-miR579 mol-miR168a 0.57 UC--UUGGU--A---CG-GA- hsa-miR4534 mol-miR159a 0.71 GGAU-GA-G-G-G-UCU hsa-miR1306-3p mol-miR6478 0.78 AC-UU-GCUC-G-UGGUG hsa-miR4703-3p mol-miR6300 0.72 GU-GUUGUA-U-UA-UG- hsa-miR5008-5p mol-miR6300 0.67 G-C-UUG--G-A-AGUGG hsa-miR4273 mol-miR398c 0.67 GUGUUCUC-G-U-G-C--COMIR software [33] predicted human genes that could be regulated by M. oleifera miRNAs. [score:2]
[1 to 20 of 2 sentences]
10
[+] score: 4
Nineteen of the downregulated miRNAs in chronic patients were found to be associated with carcinogenesis in various organs and tissues, such as miR-1207 [40], miR-3162-5p [41, 42], miR-3196 [43, 44], miR-371b-5p [45], miR-574-5p [46, 47], miR-1225-5p [48], miR-4485 [49], miR-572 [50], miR-4299 [51], miR-3679-5p [52], miR-3940-5p [53], miR-638 [54, 55], miR-1202 [56], miR-5787 [57], miR-1973 [58], miR-4532 [59], miR-1275 [60], miR-4728-5p [61], and miR-1915-3p [62]. [score:4]
[1 to 20 of 1 sentences]
11
[+] score: 3
Sun Y. Su B. Zhang P. Xie H. Zheng H. Xu Y. Du Q. Zeng H. Zhou X. Chen C. Expression of miR-150 and miR-3940-5p is reduced in non-small cell lung carcinoma and correlates with clinicopathological features Oncol. [score:3]
[1 to 20 of 1 sentences]
12
[+] score: 1
Two novel seed sequence in dels found at low frequency were an “ACA” deletion in miRNA hsa-mir-4483 at chr10 115537763-115537766, found in 2 Yoruban individuals, and a “T”-allele insertion in hsa-mir-3940 at chr19 6416444 in 2 individuals with northern European ancestry from Utah. [score:1]
[1 to 20 of 1 sentences]
13
[+] score: 1
As a result, the MirGeneDB contains only 7 human and mouse mirtron entries (mmu-mir-1981, mmu-mir-3097, hsa-mir-3605, hsa-mir-3940, hsa-mir-4640, hsa-mir-5010, hsa-mir-6746). [score:1]
[1 to 20 of 1 sentences]