sort by

33 publications mentioning hsa-mir-374c

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-374c. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 31
Regarding these observations, we performed qRT-PCR for 8 target genes of commonly regulated miRNA; 4 target genes (ATG5, ITGA6, NCKAP1, SARBS1) of the 2 up-regulated miRNA (mmu-miR-291b-5p, mmu-miR-296-5p) and 4 target genes (AKT1, APC, LMO7, MSN) of the 3 down-regulated miRNA (mmu-miR-30c-1*, mmu-miR-467b* and mmu-miR-374*). [score:14]
For example, mmu-miR-374* is up-regulated after mutagenesis in apoE mice by a factor of 2.96 comparing to the wild-type mice, however when supplemented by polyphenols, this miRNA is down-regulated in apoE by an average factor of −2.44. [score:7]
Interestingly, in cluster A, 3 miRNAs (mmu-miR-30c-1*, mmu-miR-374* and mmu-miR-497b*) were identified as being down-regulated by all nine polyphenols tested, while in cluster 2, 2 miRNAs (mmu-miR-291b-5p and mmu-miR-296-5p) were observed as up-regulated by all nine polyphenols (Table 2). [score:7]
Moreover, changes in miRNA expression were observed after polyphenol supplementation, and five miRNAs (mmu-miR-291b-5p, mmu-miR-296-5p, mmu-miR-30c-1*, mmu-miR-467b* and mmu-miR-374*) were identified as being commonly modulated by these polyphenols. [score:3]
[1 to 20 of 4 sentences]
2
[+] score: 30
This study describes how p19 affects the RNA world and shows that: i) miR-342, miR-206, miR-330, miR-138 and miR-99b are upregulated by p19 but not by p19W164A mutant; ii) anti-miR-206 can restore the G2 phase in the presence of p19; iii) p19 and p21Q61L regulate their own alternative splicing; iv) miR-206 and miR-138 are differentially regulated by p19 and p21 H-Ras and v) P19G12S Costello mutants show a clear upregulation of miR-374, miR-126, miR-342, miR-330, miR-335 and let-7. These results allow us to conclude that the H-Ras G12S mutation plays an important role in miRNA expression and open up a new line of study to understand the consequences of this mutation on Costello syndrome. [score:13]
These miRNAs included miR-342 and miR-330, which are already known to be upregulated by p19 overexpression (Fig.   1), miR-126 and miR-335, which significantly reduce the ability of CN34-LM1 and CN34-BoM1 cells to metastasize to the lung [23], miR-374, which is known to be associated with aggressive small cell lung cancer [26], and let-7, which targets Ras genes [27]. [score:8]
Those results showed that miR-330, miR-335 and miR-374 are statiscaly and significally overexpressed in those CS patients cells, and thus they are putative cadidates to be miRNAs overexpressed in CS patients (R. García-Cruz and K. Sol-Church, personnel communication). [score:5]
Thus, p21 was found to upregulate miR-374, miR-126, miR-342, miR-335 and let-7 but not miR-330, and p21G12S was found to have the same effect as p21 on miR-374, miR-342 and miR-126. [score:4]
[1 to 20 of 4 sentences]
3
[+] score: 22
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-26b, hsa-mir-29a, hsa-mir-30a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, mmu-let-7g, mmu-let-7i, mmu-mir-15b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-130a, mmu-mir-138-2, mmu-mir-181a-2, mmu-mir-182, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-10a, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-181a-1, mmu-mir-297a-1, mmu-mir-297a-2, mmu-mir-301a, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, mmu-mir-106a, mmu-mir-106b, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-138-2, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-138-1, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-26b, mmu-mir-29a, mmu-mir-29c, mmu-mir-34a, rno-mir-301a, rno-let-7d, rno-mir-344a-1, mmu-mir-344-1, rno-mir-346, mmu-mir-346, rno-mir-352, hsa-mir-181b-2, mmu-mir-10a, mmu-mir-181a-1, mmu-mir-29b-2, mmu-mir-138-1, mmu-mir-181b-1, mmu-mir-181c, mmu-mir-125b-1, hsa-mir-106b, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-30e, hsa-mir-362, mmu-mir-362, hsa-mir-369, hsa-mir-374a, mmu-mir-181b-2, hsa-mir-346, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-10a, rno-mir-15b, rno-mir-26b, rno-mir-29b-2, rno-mir-29a, rno-mir-29b-1, rno-mir-29c-1, rno-mir-30c-1, rno-mir-30e, rno-mir-30b, rno-mir-30d, rno-mir-30a, rno-mir-30c-2, rno-mir-34b, rno-mir-34c, rno-mir-34a, rno-mir-106b, rno-mir-125a, rno-mir-125b-1, rno-mir-125b-2, rno-mir-130a, rno-mir-138-2, rno-mir-138-1, rno-mir-181c, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-181a-1, hsa-mir-449a, mmu-mir-449a, rno-mir-449a, mmu-mir-463, mmu-mir-466a, hsa-mir-483, hsa-mir-493, hsa-mir-181d, hsa-mir-499a, hsa-mir-504, mmu-mir-483, rno-mir-483, mmu-mir-369, rno-mir-493, rno-mir-369, rno-mir-374, hsa-mir-579, hsa-mir-582, hsa-mir-615, hsa-mir-652, hsa-mir-449b, rno-mir-499, hsa-mir-767, hsa-mir-449c, hsa-mir-762, mmu-mir-301b, mmu-mir-374b, mmu-mir-762, mmu-mir-344d-3, mmu-mir-344d-1, mmu-mir-673, mmu-mir-344d-2, mmu-mir-449c, mmu-mir-692-1, mmu-mir-692-2, mmu-mir-669b, mmu-mir-499, mmu-mir-652, mmu-mir-615, mmu-mir-804, mmu-mir-181d, mmu-mir-879, mmu-mir-297a-3, mmu-mir-297a-4, mmu-mir-344-2, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-493, mmu-mir-504, mmu-mir-466d, mmu-mir-449b, hsa-mir-374b, hsa-mir-301b, rno-mir-466b-1, rno-mir-466b-2, rno-mir-466c, rno-mir-879, mmu-mir-582, rno-mir-181d, rno-mir-182, rno-mir-301b, rno-mir-463, rno-mir-673, rno-mir-652, mmu-mir-466l, mmu-mir-669k, mmu-mir-466i, mmu-mir-669i, mmu-mir-669h, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-466j, mmu-mir-1193, mmu-mir-767, rno-mir-362, rno-mir-504, rno-mir-582, rno-mir-615, mmu-mir-3080, mmu-mir-466m, mmu-mir-466o, mmu-mir-466c-2, mmu-mir-466b-4, mmu-mir-466b-5, mmu-mir-466b-6, mmu-mir-466b-7, mmu-mir-466p, mmu-mir-466n, mmu-mir-344e, mmu-mir-344b, mmu-mir-344c, mmu-mir-344g, mmu-mir-344f, mmu-mir-374c, mmu-mir-466b-8, hsa-mir-466, hsa-mir-1193, rno-mir-449c, rno-mir-344b-2, rno-mir-466d, rno-mir-344a-2, rno-mir-1193, rno-mir-344b-1, hsa-mir-499b, mmu-mir-466q, mmu-mir-344h-1, mmu-mir-344h-2, mmu-mir-344i, rno-mir-344i, rno-mir-344g, mmu-let-7j, mmu-mir-30f, mmu-let-7k, mmu-mir-692-3, rno-let-7g, rno-mir-15a, rno-mir-762, mmu-mir-466c-3, rno-mir-29c-2, rno-mir-29b-3, rno-mir-344b-3, rno-mir-466b-3, rno-mir-466b-4
The relative expression intensities of miR-374 were 8.9 ± 2.4 in adenoma-free mice and 21.1 ± 6.9 in adenoma-bearing mice, thus accounting for a 2.4-fold upregulation, which is in line with the 3.0-fold upregulation detected in adenoma bearing mice by microarray (see Table 2). [score:9]
Such a situation occurred for miR-26b, miR-30, and miR-374 downregulation, and for miR-34, miR-301, and miR-352 upregulation [121]. [score:7]
1Proliferation, Invasion, Tumor suppression [63– 66] miR-344 ↓2.0 ↓3.2 NA miR-346 ↓2.4Proliferation [67, 68] miR-362 ↓2.3Proliferation, Invasion, Apoptosis [69– 76] miR-369 ↓2.8 ↓2.6 ↓2.1Aerobic glycolysis [77] miR-374 ↑3.0 ↓2.2 NA miR-449 ↑2.7 ↑2.4Proliferation [78– 81] miR-463 ↓2.7 NAmiR-466 [°] ↑2.4 ↑2.1 ↓3.5 NA miR-483 ↓3.2Apoptosis [82] miR-493 ↑2.1 ↓2.2Proliferation [83– 85] miR-499a ↓5.0 ↑2.3Proliferation [86] miR-504 ↓2.6 ↑2.0Proliferation, Apoptosis [87, 88] miR-579 ↑2.8 NAmiR-582 [^] ↑2.4Proliferation [89] miR-615 ↓2.1Proliferation, Invasion [90, 91] miR-652 ↑2.4Proliferation, EMT [92, 93] miR-669b ↓2.1 NA miR-669h ↓3.6 ↑2.3 NA miR-669i ↓2.3 NA miR-669k ↓7.2 ↓5. [score:3]
The panels report the amplification curves for each one of the 20 mouse lung fragments tested, either adenoma-free (green) or adenoma-bearing (purple), relatively to miRNAs miR-125, miR-374, and miR-669k. [score:1]
Figure 4 The panels report the amplification curves for each one of the 20 mouse lung fragments tested, either adenoma-free (green) or adenoma-bearing (purple), relatively to miRNAs miR-125, miR-374, and miR-669k. [score:1]
Validation of microarray data was performed by real time-qPCR for miR-125, miR-374, and miR-669k. [score:1]
[1 to 20 of 6 sentences]
4
[+] score: 15
High Ca [++] intake significantly downregulated the expression levels of miR-9 and miR-374 in TALH cells, which in turn causes a reciprocal increase in claudin-14 expression level. [score:8]
Treatments with antisense oligonucleotide against miR-9 or miR-374 revealed that both microRNAs suppressed claudin-14 translation and induced its mRNA decay in a synergistic manner [36]. [score:5]
The promoters of both miR-9 (miR-9-3 locus) and miR-374 genes contain a canonical myc -binding site (E-box: CACGTG). [score:1]
Gong et al. have identified two microRNA molecules, miR-9 and miR-374 from TALH cells, both of which recognize partially complementary binding sites located in 3′-UTRs of claudin-14 mRNA (Figure 3) [36]. [score:1]
[1 to 20 of 4 sentences]
5
[+] score: 13
miR-374 was also downregulated in older participants in an earlier study [18], but in contrast with our study, miR-376 was upregulated in older participants in another report [20]. [score:7]
Interestingly, none of the six miRNAs has previously been shown to play a mechanistic role in aging, and none has been implicated in heart disease, but many have been shown to function and/or act as biomarkers in different cancers (miR-211: melanoma cell invasive-ness; head, neck, renal cell carcinomas; pancreatic cancer; miR-374: small cell lung cancer; miR-340: osteosarcoma, colorectal cancer, breast cancer, gastric cancer; miR-376: glioblastoma, hepato-cellular carcino-ma) [24]. [score:3]
Four of these miRNAs (miR-374, 376, 29, 378) have been shown in prior studies to be differentially expressed between older and younger persons in separate profiling experiments [18, 20, 21]. [score:3]
[1 to 20 of 3 sentences]
6
[+] score: 11
Other miRNAs from this paper: hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-98, hsa-mir-99a, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-196a-1, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-196a-2, hsa-mir-199a-2, hsa-mir-210, hsa-mir-181a-1, hsa-mir-214, hsa-mir-222, hsa-mir-223, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-140, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-146a, hsa-mir-150, hsa-mir-186, hsa-mir-188, hsa-mir-195, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-363, hsa-mir-302c, hsa-mir-370, hsa-mir-373, hsa-mir-374a, hsa-mir-328, hsa-mir-342, hsa-mir-326, hsa-mir-135b, hsa-mir-338, hsa-mir-335, hsa-mir-345, hsa-mir-424, hsa-mir-20b, hsa-mir-146b, hsa-mir-520a, hsa-mir-518a-1, hsa-mir-518a-2, hsa-mir-500a, hsa-mir-513a-1, hsa-mir-513a-2, hsa-mir-92b, hsa-mir-574, hsa-mir-614, hsa-mir-617, hsa-mir-630, hsa-mir-654, hsa-mir-374b, hsa-mir-301b, hsa-mir-1204, hsa-mir-513b, hsa-mir-513c, hsa-mir-500b
Comparison of miRNA expression of microdissected HRS cells from cHL patients to CD77+ GC B cells showed three downregulated miRNAs, namely, miR-520a, miR- 200a, and miR-614 and twelve upregulated miRNAs, namely, miR-20a, miR-21, miR-9, miR-155, miR-16, miR-140, miR-18a, miR-30b, miR-30a- 5p, miR-196a, miR-374, and miR-186 [36]. [score:9]
This study also uncovered a novel set of miRNAs like miR-222 and let-7f (associated with other malignancies), miR-513 and miR-223 (linked to immune regulation and related B-cell tumors), miR-424 (hematopoiesis), and miR-188 and miR-374 (no known physiological or pathological functions) [49]. [score:2]
[1 to 20 of 2 sentences]
7
[+] score: 9
Of these, 14 (miR-23b, miR-28, miR-98, miR-103, miR-107, miR-193a,0, miR-324-5p, miR-324-3p, miR-331, miR-374, miR-432, miR-502, and miR-660) were upregulated and 6 (miR-31, miR-451, miR-452, miR-565, miR-594 and miR-659) were downregulated. [score:7]
[27]↓quail myoblasts diff, ↓ C2C12 diff [29] ↓ C2C12 diff [28] ↓ muscle development [32]40miR-320↓(this study)↑ pMyo diff [33]  41 miR-324-3p (n)↑↑(this study)   42 miR-324-5p (n)↑(this study)   43 miR-331 (n)↑(this study)-  44miR-339↓(this study)↑ C2C12 diff [33] ↑ pMyo diff [33]  45miR-361↑(this study)↑ pMyo diff [33]  46 miR-362↑↑(this study)↑ C2C12 diff [28]  47 miR-374 (n)↑(this study)   48 miR-432 (n)↑(this study)   49 miR-451 (n)↓↓↓(this study)   50 miR-452 (n)↓↓(this study)   51 miR-500↑↑(this study)↑ C2C12 diff [28, 33] ↑ pMyo diff [33]  52 miR-501↑↑↑(this study)↑ C2C12 diff [28, 33]  53 miR-502 (n)↑↑(this study)-  54 miR-503↑(this study)↑ C2C12 diff [19, 28, 33] ↑ pMyo diff [33]  55 miR-532↑↑(this study)↑ C2C12 diff [28, 33] ↑ pMyo diff [33]  56↓↓ pMyo diff. [score:2]
[1 to 20 of 2 sentences]
8
[+] score: 8
Other miRNAs from this paper: hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-374a, hsa-mir-374b
Clues in this direction come from an elegant recent work by Gong and coworkers, demonstrating that activation of the CaSR regulates the expression levels of two microRNAs: miR-9 and miR-374, which in turn transduce the extracellular signal to CLDN14 through microRNA mediated gene silencing [41]. [score:5]
Although, this study reported miR-9 and miR-374 convergence onto CLDN14, regulation of microRNA by CaSR signaling may occur on several layers including key regulatory proteins involved in CaSR receptor activated calcium signaling. [score:3]
[1 to 20 of 2 sentences]
9
[+] score: 8
miR-374c was downregulated in Merkel cell carcinoma [29]. [score:4]
Our bioinformatical analysis identified eight potential microRNAs that might be regulated by PTIP, including miR-548k, miR-374b, miR-374a, miR-369-3p, miR-374c, miR-655, miR-4307, miR-570. [score:2]
We selected 8 potential microRNAs including miR-548k, miR-374b, miR-374a, miR-369-3p, miR-374c, miR-655, miR-4307, miR-570. [score:1]
miR-374a, miR-374b, miR-374c and miR-570 decreased in HCCLM3shPTIP cells. [score:1]
[1 to 20 of 4 sentences]
10
[+] score: 7
The upregulateds included miR-3180-5p, miR-3189-3p, miR-369-5p, miR-4283, miR-4287, miR-4323, miR-483-3p, miR-501-5p, and miR-552-3p (Table 1), and the downregulateds included miR-106b-5p, miR-17-3p, miR-374c-5p, and miR-543 (Table 1). [score:7]
[1 to 20 of 1 sentences]
11
[+] score: 7
Moreover, the upregulation of miR-142-5p, miR-221, miR-30, miR-32, miR-374, miR-99a, miR-122 and miR-101 and the downregulation of miR-145, miR-195 and miR-98 observed in JEV-infected PK-15 cells in our study have been reported in the brains of mice infected with West Nile virus (WNV), another mosquito-borne flavivirus [34]. [score:7]
[1 to 20 of 1 sentences]
12
[+] score: 6
In contrast, 11 miRNAs (hsa-miR-206, hsa-miR-34a, hsa-miR-374, hsa-miR-424, hsa-miR-100, hsa-miR-101, hsa-miR-323, hsa-miR-368, hsa-miR-137, hsa-miR-138 and hsa-miR-377) were abundantly expressed in day 9 neuronal progenitors (Figures 1B and 2A). [score:3]
Another 11 miRNAs (miR-206, miR-34a, miR-374, miR-424, miR-100, miR-101, miR-323, miR-368, miR-137, miR-138 and miR-377) were abundantly expressed in transdifferentiated neuronal progenitors. [score:3]
[1 to 20 of 2 sentences]
13
[+] score: 6
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-29a, hsa-mir-31, hsa-mir-99a, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-192, hsa-mir-199a-1, hsa-mir-208a, hsa-mir-30c-2, hsa-mir-147a, hsa-mir-10a, hsa-mir-34a, hsa-mir-181b-1, hsa-mir-199a-2, hsa-mir-203a, hsa-mir-204, hsa-mir-217, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-200b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-132, hsa-mir-140, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-146a, hsa-mir-150, hsa-mir-185, hsa-mir-193a, hsa-mir-195, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, hsa-mir-30c-1, hsa-mir-219a-2, hsa-mir-296, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-302d, hsa-mir-374a, hsa-mir-375, hsa-mir-378a, hsa-mir-330, hsa-mir-328, hsa-mir-342, hsa-mir-325, hsa-mir-424, hsa-mir-429, hsa-mir-450a-1, hsa-mir-486-1, hsa-mir-146b, hsa-mir-497, hsa-mir-520e, hsa-mir-520f, hsa-mir-520a, hsa-mir-520b, hsa-mir-520c, hsa-mir-520d, hsa-mir-520g, hsa-mir-520h, hsa-mir-450a-2, hsa-mir-503, hsa-mir-608, hsa-mir-625, hsa-mir-629, hsa-mir-663a, hsa-mir-1271, hsa-mir-769, hsa-mir-378d-2, hsa-mir-675, hsa-mir-147b, hsa-mir-374b, hsa-mir-663b, hsa-mir-378b, hsa-mir-378c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-4661, hsa-mir-219b, hsa-mir-203b, hsa-mir-378j, hsa-mir-486-2
In a rat mo del of selenium deficiency, five miRNAs extracted from harvested heart (miR-374, miR-16, miR-199a-5p, miR-195 and miR-30e*) were identified as upregulated >5-fold in the deficiency group, compared to the selenium-supplemented group, and three were downregulated (miR-3571, miR-675 and miR-450a*). [score:6]
[1 to 20 of 1 sentences]
14
[+] score: 5
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-98, hsa-mir-99a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-10a, hsa-mir-10b, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-181a-1, hsa-mir-221, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-27b, hsa-mir-30b, hsa-mir-130a, hsa-mir-152, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-185, hsa-mir-193a, hsa-mir-320a, hsa-mir-200c, hsa-mir-1-1, hsa-mir-181b-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-99b, hsa-mir-130b, hsa-mir-30e, hsa-mir-363, hsa-mir-374a, hsa-mir-375, hsa-mir-378a, hsa-mir-148b, hsa-mir-331, hsa-mir-339, hsa-mir-423, hsa-mir-20b, hsa-mir-491, hsa-mir-193b, hsa-mir-181d, hsa-mir-92b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, bta-mir-29a, bta-let-7f-2, bta-mir-148a, bta-mir-18a, bta-mir-20a, bta-mir-221, bta-mir-27a, bta-mir-30d, bta-mir-320a-2, bta-mir-99a, bta-mir-181a-2, bta-mir-27b, bta-mir-30b, bta-mir-106a, bta-mir-10a, bta-mir-15b, bta-mir-181b-2, bta-mir-193a, bta-mir-20b, bta-mir-30e, bta-mir-92a-2, bta-mir-98, bta-let-7d, bta-mir-148b, bta-mir-17, bta-mir-181c, bta-mir-191, bta-mir-200c, bta-mir-22, bta-mir-29b-2, bta-mir-29c, bta-mir-423, bta-let-7g, bta-mir-10b, bta-mir-24-2, bta-mir-30a, bta-let-7a-1, bta-let-7f-1, bta-mir-30c, bta-let-7i, bta-mir-25, bta-mir-363, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-15a, bta-mir-19a, bta-mir-19b, bta-mir-331, bta-mir-374a, bta-mir-99b, hsa-mir-374b, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, bta-mir-1-2, bta-mir-1-1, bta-mir-130a, bta-mir-130b, bta-mir-152, bta-mir-181d, bta-mir-182, bta-mir-185, bta-mir-24-1, bta-mir-193b, bta-mir-29d, bta-mir-30f, bta-mir-339a, bta-mir-374b, bta-mir-375, bta-mir-378-1, bta-mir-491, bta-mir-92a-1, bta-mir-92b, bta-mir-9-1, bta-mir-9-2, bta-mir-29e, bta-mir-29b-1, bta-mir-181a-1, bta-mir-181b-1, bta-mir-320b, bta-mir-339b, bta-mir-19b-2, bta-mir-320a-1, bta-mir-193a-2, bta-mir-378-2, hsa-mir-378b, hsa-mir-320e, hsa-mir-378c, bta-mir-148c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-378j, bta-mir-378b, bta-mir-378c, bta-mir-378d, bta-mir-374c, bta-mir-148d
In addition, many miRNA families showed low expression (count number <100) in milk exosomes, such as the miR-1, miR-130, miR-17, miR-10, miR-29, miR-374, mir-9, miR-15 and miR-491 families (Figure 12F), which are routinely expressed in specific tissues [53– 56]. [score:5]
[1 to 20 of 1 sentences]
15
[+] score: 5
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-96, hsa-mir-99a, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-192, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-139, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-210, hsa-mir-181a-1, hsa-mir-214, hsa-mir-215, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-140, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-134, hsa-mir-136, hsa-mir-146a, hsa-mir-150, hsa-mir-185, hsa-mir-190a, hsa-mir-194-1, hsa-mir-195, hsa-mir-206, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-101-2, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-99b, hsa-mir-296, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-370, hsa-mir-373, hsa-mir-374a, hsa-mir-375, hsa-mir-376a-1, hsa-mir-151a, hsa-mir-148b, hsa-mir-331, hsa-mir-338, hsa-mir-335, hsa-mir-423, hsa-mir-18b, hsa-mir-20b, hsa-mir-429, hsa-mir-491, hsa-mir-146b, hsa-mir-193b, hsa-mir-181d, hsa-mir-517a, hsa-mir-500a, hsa-mir-376a-2, hsa-mir-92b, hsa-mir-33b, hsa-mir-637, hsa-mir-151b, hsa-mir-298, hsa-mir-190b, hsa-mir-374b, hsa-mir-500b, hsa-mir-219b, hsa-mir-203b
Stimulation of HCC proliferationBudhu et al., 2008; Gramantieri et al., 2008; Huang et al., 2009, 2011 miR-373 Invasion and metastasisMeng et al., 2007; Bartels and Tsongalis, 2009; Wu et al., 2011 miR-374 DevelopmentWang et al., 2008; Wong et al., 2008, 2010; Koh et al., 2013 miR-375 Stimulation of HCC proliferationLiu et al., 2010; He et al., 2012 miR-376a Proliferation and apoptosisMeng et al., 2007; Zheng et al., 2012b miR-423 Enhanced CDK2 activityLin et al., 2011 miR-491-5p Inhibition of TNF-α-related apoptosisYoon et al., 2010 miR-500 Elevated in HCC, returned to physiologic level after surgical interventionYamamoto et al., 2009 miR-637 Active STAT3Zhang et al., 2011 let-7a/a-1/a-2/b/c/d/e/f/f-2/g Development. [score:5]
[1 to 20 of 1 sentences]
16
[+] score: 5
On the other hand, these 19 miRNAs (hsa-miR106a, hsa-miR-125a, hsa-miR-140, hsa-miR-146a, hsa-miR-146b, hsa-miR-155, hsa-miR-16, hsa-miR-17, hsa-miR186, hsa-miR-191, hsa-miR-197, hsa-miR-200b, hsa-miR-200c, hsa-miR-339, hsa-miR-374, hsa-miR-422, hsa-miR-422, hsa-miR-454, hsa-miR-484 and hsa-miR-590) were up-expressed in VP and ART (block1-group2) and down-expressed in EC and HIV- (block2-group2). [score:5]
[1 to 20 of 1 sentences]
17
[+] score: 4
The fixed-effects mo del revealed that downregulation of miR-374 was associated with shorter DFS (combined adjusted HR: 0.77; 95% CI: 0.65–0.90) (Fig. 5). [score:4]
[1 to 20 of 1 sentences]
18
[+] score: 4
Other miRNAs from this paper: hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-27a, hsa-mir-30a, hsa-mir-32, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-107, hsa-mir-129-1, hsa-mir-30c-2, hsa-mir-139, hsa-mir-181c, hsa-mir-204, hsa-mir-212, hsa-mir-181a-1, hsa-mir-222, hsa-mir-15b, hsa-mir-23b, hsa-mir-132, hsa-mir-138-2, hsa-mir-140, hsa-mir-142, hsa-mir-129-2, hsa-mir-138-1, hsa-mir-146a, hsa-mir-154, hsa-mir-186, rno-mir-324, rno-mir-140, rno-mir-129-2, rno-mir-20a, rno-mir-7a-1, rno-mir-101b, hsa-mir-29c, hsa-mir-296, hsa-mir-30e, hsa-mir-374a, hsa-mir-380, hsa-mir-381, hsa-mir-324, rno-mir-9a-1, rno-mir-9a-3, rno-mir-9a-2, rno-mir-15b, rno-mir-17-1, rno-mir-18a, rno-mir-19b-1, rno-mir-19b-2, rno-mir-19a, rno-mir-21, rno-mir-23a, rno-mir-23b, rno-mir-24-1, rno-mir-24-2, rno-mir-27a, rno-mir-29c-1, rno-mir-30e, rno-mir-30a, rno-mir-30c-2, rno-mir-32, rno-mir-92a-1, rno-mir-92a-2, rno-mir-93, rno-mir-107, rno-mir-129-1, rno-mir-132, rno-mir-138-2, rno-mir-138-1, rno-mir-139, rno-mir-142, rno-mir-146a, rno-mir-154, rno-mir-181c, rno-mir-186, rno-mir-204, rno-mir-212, rno-mir-181a-1, rno-mir-222, rno-mir-296, rno-mir-300, hsa-mir-20b, hsa-mir-431, rno-mir-431, hsa-mir-433, rno-mir-433, hsa-mir-410, hsa-mir-494, hsa-mir-181d, hsa-mir-500a, hsa-mir-505, rno-mir-494, rno-mir-381, rno-mir-409a, rno-mir-374, rno-mir-20b, hsa-mir-551b, hsa-mir-598, hsa-mir-652, hsa-mir-655, rno-mir-505, hsa-mir-300, hsa-mir-874, hsa-mir-374b, rno-mir-466b-1, rno-mir-466b-2, rno-mir-466c, rno-mir-874, rno-mir-17-2, rno-mir-181d, rno-mir-380, rno-mir-410, rno-mir-500, rno-mir-598-1, rno-mir-674, rno-mir-652, rno-mir-551b, hsa-mir-3065, rno-mir-344b-2, rno-mir-3564, rno-mir-3065, rno-mir-1188, rno-mir-3584-1, rno-mir-344b-1, hsa-mir-500b, rno-mir-29c-2, rno-mir-3584-2, rno-mir-598-2, rno-mir-344b-3, rno-mir-466b-3, rno-mir-466b-4
Finally, miR-30c-2-3p, miR-101b-3p, miR-142-3p, miR-142-5p, miR-181a-1-3p, miR-374-5p, miR-466c-3p, miR-1188-3p, miR-3065-3p and miR-3582 were significantly down-regulated in the chronic stage (Supplementary Fig. S7D). [score:4]
[1 to 20 of 1 sentences]
19
[+] score: 3
MiRNA expression was normalized to that of hsa-RNU48 (1006), miR-16 (000391), miR-26b (000407) and miR-92 (000430) (solid tissues), or hsa-miR-16 and hsa-miR-374 (000563) (cultured cells), or hsa-miR-425-5p (001516), hsa-RNU-48 and hsa-miR-16 (serum samples). [score:3]
[1 to 20 of 1 sentences]
20
[+] score: 3
Oncogenic miRNAs [37], [38], including let-7 family, miR-374 family, miR-138, miR-195, miR-19a and miR-200a, had more than twice expression level in rpESCs comparing with their IVF counterparts. [score:3]
[1 to 20 of 1 sentences]
21
[+] score: 3
Of the nine miRNAs were specifically expressed in cashmere goat dorsal skin [18], only four of them were examined in the present study: miR-1, miR-374, miR-455-3p and miR-92b. [score:3]
[1 to 20 of 1 sentences]
22
[+] score: 3
Recently, we identified 6 potential biomarkers (mmu-miR140-5p, hsa-let-7g, hsa-miR-15b, hsa-miR-132, hsa-miR-222, and hsa-miR-374) that were differently expressed in whole saliva from patients with benign parotid neoplasms and malignant parotid neoplasms [16]. [score:3]
[1 to 20 of 1 sentences]
23
[+] score: 3
Data are presented as fold change (FC) in miR expression after normalization to the endogenous control, miR-374. [score:3]
[1 to 20 of 1 sentences]
24
[+] score: 2
Although the roles of miR-320a and miR-374–5p have been reported in many different types of cancer, there are no direct reports of these miRNAs in osteosarcoma to date. [score:2]
[1 to 20 of 1 sentences]
25
[+] score: 2
miRNA ΔΔCT(mean) p-value miR-374 -0.4458 0.454 miR-142-3p -0.4136 0.4322 miR-523 -0.5518 0.3424 miR-374-5p -0.2611 0.6425 miR-376c -0.4312 0.5867 miR-27a -0.3863 0.4776 miR-520d-5p -0.3081 0.7506 miR-122 -0.0856 0.9251 miR-485-3p -0.2611 0.6392 miR-21 -0.3976 0.5261 miR-218 -1.332 0.1659 miR-374 -0.4458 0.454 Comparison of mean ΔΔCT’s for various plasma miRNA from plasma samples drawn from the same 7 individuals on the same day 12 hours apart. [score:1]
B) ROC Curve for miR-523, miR-218, miR-142-3p,miR-27a,miR-376c,miR-374. [score:1]
[1 to 20 of 2 sentences]
26
[+] score: 2
More than 10-fold increase in miR-374 expression was observed in miR-374a lentivirus or mimics -treated NSCLC cells compared with the control group by quantitative real-time reverse transcription-PCR (qRT-PCR) (with P < 0.01; P < 0.001) (Supplementary Figure  1B). [score:2]
[1 to 20 of 1 sentences]
27
[+] score: 1
0008514hsa-miR-39413.390.0064610hsa-miR-39386.030.008213hsa-miR-4983.470.048419hsa-miR-374c-3p6.040.00125Xhsa-miR-548as-3p3.490.0065713hsa-miR-377-5p6.290.0002414hsa-miR-323a-3p3.700.0035014hsa-miR-43246.390.0066919hsa-miR-550a-3p3.710.000747hsa-miR-4436b-5p6.569.0E-052hsa-miR-30e-3p3.750.01335Unknownhsa-miR-11846.640.00266Xhsa-miR-1273e3.830.00201Unknownhsa-miR-56907.226.6E-056hsa-miR-200b-3p3.830.001481hsa-miR-125b-2-3p7.680. [score:1]
[1 to 20 of 1 sentences]
28
[+] score: 1
Other housekeeping genes frequently used are the miRNAs: let-7, miR-16, miR-423 and miR-374, among others, but the use of a single miRNA to normalize data may induce a systematic error [78]. [score:1]
[1 to 20 of 1 sentences]
29
[+] score: 1
0094839.g005 Figure 5(A) We plotted two miRNAs (miR-34a-5p and miR-374-5p) detected in CSF from Table? [score:1]
[1 to 20 of 1 sentences]
30
[+] score: 1
Prognostic plot created using PROGmiR for miRNA hsa-miR-374 identified as prognostically important biomarker in Lung Squamous cell carcinoma (LUSC) by Annilo et al, using TCGA data. [score:1]
[1 to 20 of 1 sentences]
31
[+] score: 1
A serious miRNA, such as miR-374 [20], miR-203 [21], miR-21 [22], miR-7 [23, 24], play a role in cell proliferation, cancer metastasis, epithelial-mesenchymal transition et al through AKT/β-catenin signaling pathway. [score:1]
[1 to 20 of 1 sentences]
32
[+] score: 1
In an additional case, A-to-I editing was observed in a novel stem-loop structure in sequence adjacent to the unedited miRNA miR-374. [score:1]
[1 to 20 of 1 sentences]
33
[+] score: 1
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-27a, hsa-mir-31, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-16-2, hsa-mir-192, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-181a-2, hsa-mir-205, hsa-mir-181a-1, hsa-mir-214, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-146a, hsa-mir-184, hsa-mir-186, hsa-mir-193a, hsa-mir-194-1, hsa-mir-155, hsa-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-219a-2, hsa-mir-99b, hsa-mir-26a-2, hsa-mir-365a, hsa-mir-365b, hsa-mir-374a, hsa-mir-148b, hsa-mir-423, hsa-mir-486-1, hsa-mir-499a, hsa-mir-532, hsa-mir-590, bta-mir-26a-2, bta-let-7f-2, bta-mir-103-1, bta-mir-148a, bta-mir-16b, bta-mir-21, bta-mir-221, bta-mir-222, bta-mir-27a, bta-mir-499, bta-mir-125b-1, bta-mir-181a-2, bta-mir-205, bta-mir-27b, bta-mir-30b, bta-mir-31, bta-mir-193a, bta-let-7d, bta-mir-148b, bta-mir-186, bta-mir-191, bta-mir-192, bta-mir-200a, bta-mir-214, bta-mir-22, bta-mir-23a, bta-mir-29c, bta-mir-423, bta-let-7g, bta-mir-24-2, bta-let-7a-1, bta-mir-532, bta-let-7f-1, bta-mir-30c, bta-let-7i, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-125b-2, bta-mir-365-1, bta-mir-374a, bta-mir-99b, hsa-mir-374b, hsa-mir-664a, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-1915, bta-mir-146a, bta-mir-155, bta-mir-16a, bta-mir-184, bta-mir-24-1, bta-mir-194-2, bta-mir-219-1, bta-mir-223, bta-mir-26a-1, bta-mir-365-2, bta-mir-374b, bta-mir-486, bta-mir-763, bta-mir-9-1, bta-mir-9-2, bta-mir-181a-1, bta-mir-2284i, bta-mir-2284s, bta-mir-2284l, bta-mir-2284j, bta-mir-2284t, bta-mir-2284d, bta-mir-2284n, bta-mir-2284g, bta-mir-2339, bta-mir-2284p, bta-mir-2284u, bta-mir-2284f, bta-mir-2284a, bta-mir-2284k, bta-mir-2284c, bta-mir-2284v, bta-mir-2284q, bta-mir-2284m, bta-mir-2284b, bta-mir-2284r, bta-mir-2284h, bta-mir-2284o, bta-mir-664a, bta-mir-2284e, bta-mir-1388, bta-mir-194-1, bta-mir-193a-2, bta-mir-2284w, bta-mir-2284x, bta-mir-148c, hsa-mir-219b, hsa-mir-499b, hsa-mir-664b, bta-mir-2284y-1, bta-mir-2284y-2, bta-mir-2284y-3, bta-mir-2284y-4, bta-mir-2284y-5, bta-mir-2284y-6, bta-mir-2284y-7, bta-mir-2284z-1, bta-mir-2284aa-1, bta-mir-2284z-3, bta-mir-2284aa-2, bta-mir-2284aa-3, bta-mir-2284z-4, bta-mir-2284z-5, bta-mir-2284z-6, bta-mir-2284z-7, bta-mir-2284aa-4, bta-mir-2284z-2, hsa-mir-486-2, hsa-mir-6516, bta-mir-2284ab, bta-mir-664b, bta-mir-6516, bta-mir-219-2, bta-mir-2284ac, bta-mir-219b, bta-mir-374c, bta-mir-148d
54376002:- bta-miR-374b′-5pbta-mir-374b′bta-miR-374-3p1.460ugauaauacaaccugauaagug220cuuagcagguuguauuauaucc22X:82023929.. [score:1]
[1 to 20 of 1 sentences]