6 publications mentioning hsa-mir-4443

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-4443. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1

c Scheme, proposed mechanism of miR-4443 -mediated signaling downstream of leptin and insulin Using three CRC-derived lines as a cellular mo del, we have identified a signaling pathway that integrates insulin and leptin signaling in the activation of MEK1/2 and leads to up-regulation of miR-4443, which in turn down-regulates NCOA1 and TRAF4, possibly causing tumor suppression and decreased cell invasion.

To assess if MEK1/2 indeed regulate miR-4443 downstream of leptin and insulin signaling, HCT-116 cells were pre-incubated for 45 min with or without a MEK inhibitor, PD-98059 (10 μM), before being exposed to leptin (100 ng/ml) or insulin (20 ng/ml) for 24 h. The inhibitor attenuated the leptin -induced up-regulation of miR-4443 (Fig.   4a).

Fig. 3Leptin and insulin exposure and overexpression of miR-4443 down-regulate the miR-4443 targets, NCOA1 and TRAF4, in HCT-116 cells.

Since miR-4443 was up-regulated following both leptin and insulin treatment, we hypothesized that its promoter or enhancer regions may contain the CCAAT motif, which binds transcription factors from the CCAAT-enhancer -binding proteins (C/EBP) family, that act downstream of MEK1/2 in leptin and insulin signaling [3, 40– 43] and were previously described as up-regulated by both insulin and leptin [44, 45].

Overexpression of miR-4443 also significantly decreased the proliferation of HCT-116 cells (Fig.   2e), implying that miR-4443 may act as a tumor suppressor via its downstream targets.

Leptin and insulin exposure and miR-4443 overexpression down-regulate NCOA1 and TRAF4 in HCT-116 cells.

Exposure to leptin (at 100 ng/ml for 24 h), as well as overexpression of miR-4443 in HCT-116 cells (24 h post-transfection) resulted in significant (p < 0.05) down-regulation of endogenous NCOA1 and TRAF4 on the mRNA and protein levels (Fig.   3a– d).

The up-regulation of miR-4443 by leptin and insulin is attenuated by the inhibition of MEK1/2.

Our findings suggest that miR-4443 acts in a tumor-suppressive manner by down -regulating TRAF4 and NCOA1 downstream of MEK-C/EBP -mediated leptin and insulin signaling, and that insulin and/or leptin resistance (e. g. in obesity) may suppress this pathway and increase the risk of metastatic CRC.

Of ~800 miRNAs profiled, miR-4443 was consistently up-regulated by leptin and insulin in HCT-116 and HT-29, but not in DLD-1, which lacked normal leptin receptor expression.

Moreover, leptin and miR-4443 transfection significantly down-regulated endogenous NCOA1 and TRAF4, both predicted targets of miR-4443 with known roles in cancer metastasis.

The up-regulation of miR-4443 by leptin or insulin was attenuated by the inhibition of MEK1/2.

Fig. 2Leptin exposure up-regulates miR-4443 and decreases invasion, while overexpression of miR-4443 decreases the proliferation of cultured HCT-116 cells.

A list of predicted miR-4443 targets was obtained using the TargetScan algorithm [9, 24] (Release 6.2), accessible online [25].

a– b for miR-4443 (a), or human NCOA1 and TRAF4 mRNAs (b), in HCT-116 cells, pre-incubated for 45 min, with or without a MEK inhibitor, PD-98059, an inhibitor of MEK activity (dissolved in DMSO) (10 μM), before being exposed to leptin (100 ng/ml) or insulin (20 ng/ml) for 24 h. Controls included the appropriate concentration of DMSO (less than 0.1 %), PD alone and leptin or insulin alone.

To identify possible cancer-relevant targets of miR-4443, the TargetScan algorithm [9, 24] was used.

c Scheme, proposed mechanism of miR-4443 -mediated signaling downstream of leptin and insulin To check the effects of leptin and insulin exposure on the expression levels of a wide cross-section of miRNAs, we profiled miRNA levels in the CRC-derived cell lines HCT-116, HT-29 and DLD-1 that had been treated with leptin or insulin (at 200 ng/ml) for 24 h, using the Nanostring nCounter probe array platform (clustered heat map for leptin -induced changes, Additional file 2: Figure S1; all expression data, Additional file 3: Table S2).

Dose response experiments showed that leptin at 100 ng/ml consistently up-regulated miR-4443 in HCT-116 cells, concomitantly with a significant decrease in cell invasion ability.

Thus, miR-4443 was up-regulated by insulin in all three lines, and by leptin in HCT-116 and HT-29, but not in DLD-1 (miR-4443 marked in black, in Fig.   1d– g).

*: p < 0.05; **: P < 0.01; t-test; bars: SE, n = 6 To check if miR-4443 directly targets the 3′UTR region of NCOA1 and TRAF4 mRNAs, HCT-116 cells were co -transfected with miR-4443 mimic (or control oligos) and a secreted dual-reporter encoding vector, with or without the relevant 3′UTR (SecretePair from Genecopoeia).

Indeed, our results show that one of the lines (DLD-1) exhibited abnormal expression of LEPR, and in agreement with our proposed regulatory pathway, miR-4443 was not significantly affected by leptin treatment in this line.

This in- silico analysis suggests that miR-4443 is regulated by the MEK1/2 – C/EBP pathway downstream of both the insulin and leptin receptors, providing a possible explanation for the similar effects of exposure to insulin and leptin on miR-4443 and its downstream targets.

NCOA1, TRAF4 are direct targets of miR-4443.

In a dose-response experiment, leptin treatment at 100 ng/ml was found to up-regulate miR-4443 reproducibly as well as significantly (p < 0.05) (Fig.   2b).

We also established that 20 ng/nl insulin was sufficient to cause the up-regulation of miR-4443 (data not shown).

Leptin and insulin up-regulate miR-4443 in CRC-derived cell lines; the effect of leptin on miR-4443 is LEPR -dependent.

miR-4443, which showed robust up-regulation by leptin in both the Nanostring profiling and the qRT-PCR validation, was chosen as a candidate for further study.

Leptin up-regulates miR-4443 and decreases invasion in HCT-116 cells.

In our study, miR-4443 greatly contributed to the observed correlation between the effects of insulin and leptin exposure on miRNA expression profiles of CRC-derived cell lines.

Among the top-scored predicted targets of miR-4443, NCOA1 and TRAF4 have known roles in cell migration and cancer metastasis [35– 39], and were chosen for validation.

Overexpression of miR-4443 decreases the invasion and proliferation of HCT-116 cells.

but not in a control plasmid lacking the 3′UTRs (Fig.   3g), supporting the predicted direct regulation of these mRNAs by miR-4443.

Here, we show that a specific miRNA, miR-4443, responds to leptin and insulin treatment in CRC-derived cells and that its impaired regulation may contribute to deregulation of downstream signaling, increased cancer metastasis and worse prognosis in a state of leptin resistance.

These results support the notion that miR-4443 is regulated by the MEK1/2 – C/EBP pathway downstream of both the insulin and leptin receptors, although it is impossible to discount other, miR-4443-independent signaling pathways that could affect the levels of NCOA1 and TRAF4 downstream of these receptors.

miR-4443 was found to directly regulate TRAF4 and NCOA1, as validated by a reporter assay.

The Gaussia Luciferase signal was significantly suppressed by the co -transfected miR-4443 mimic, compared with the negative control oligo, in both NCOA1 and TRAF4 3′UTR-containing constructs.

The miR-4443 promoter/enhancer region contains the CCAAT motif, supporting regulation by C/EBPs.

Fig. 4The effects of leptin and insulin on miR-4443 and NCOA1/TRAF4 are likely mediated by the MAPK pathway.

*: p < 0.05; t-test; bars: SD, n = 5. d Immunoblot for human NCOA1 and TRAF4 in HCT-116 cells transfected with miR-4443 mimicking oligo, or mock -transfected cells.

b Dose response of miR-4443 levels under leptin exposure, in HCT-116 cells.

Of ~800 miRNAs profiled, miR-4443 stood out in its robust and similar response to leptin and insulin.

Circle representing miR-4443 marked in black.

cgi?species=Human&gid=&mir_sc=&mir_c=&mir_nc=&mirg=hsa-mir-4443.

e Secrete-Pair Luciferase/SEAP ratios in media of HCT-116 cells 48 h post co-transfection with constructs containing the 3′ UTR of TRAF4, NCOA1, or no UTR, with miR-4443 - mimicking or control oligo (miR-Neg).

c for human NCOA1 and TRAF4 in HCT-116 cells transfected with miR-4443 mimicking oligo, or mock -transfected cells.

A 10 kb segment of the human genomic sequence upstream of the miR-4443 locus (3:48186564–48196564) was used, having ascertained that the segment contained no other known genes in the “plus” orientation.

bars: SE; n = 5. e CyQuant quantification of cell proliferation over 48 h, in HCT-116 cells transfected with miR-4443 mimic or negative control (miR-Neg).

Two high-score (0.99) matches for CCAAT motifs were found at positions 1903–18 and 1955–70 of the sequence, in addition to other adjacent cis-elements predicted to bind SP1 and E2F transcription factors that combine to form a predicted high probability enhancer region ~8 kb upstream of the miR-4443-encoding locus (Additional file 4: Figure S2).

Our results suggest that miR-4443 mediates a novel mechanism by which the metabolic state of the organism may influence the risk of tumorigenesis.

with miR-4443 mimic decreased invasion and proliferation of HCT-116 cells.

2

Among them, the expression patterns of 7 up-regulated (hsa-miR-4530, hsa-miR-4492, hsa-miR-6125, hsa-miR-494-3p, hsa-miR-638, hsa-miR-6743-5p, hsa-miR-4459) and 1 down-regulated miRNA (hsa-miR-4443) were consistent with the microarray data.

8 of the most significantly up-regulated miRNAs (hsa-miR-4530, hsa-miR-4492, hsa-miR-4505, hsa-miR-6125, hsa-miR-494-3p, hsa-miR-638, hsa-miR-6743-5p and hsa-miR-4459) and 3 of the most significantly down-regulated microRNAs (hsa-miR-29a-3p, hsa-miR-4443, hsa-miR-27b-5p) were selected as representatives for confirmation.

As shown in Figure  4, the expressions of hsa-miR-4530, hsa-miR-4492, hsa-miR-6125, hsa-miR-494-3p, hsa-miR-638, hsa-miR-6743-5p, hsa-miR-4459 and hsa-miR-4443 detected by qRT-PCR were consistent with the microarray data with significance (P < 0.05).

The expressions of hsa-miR-4530, hsa-miR-4492, hsa-miR-6125, hsa-miR-494-3p, hsa-miR-638, hsa-miR-6743-5p, hsa-miR-4459 and hsa-miR-4443 detected by qRT-PCR were consistent with the microarray data.

But all of the 8 miRNAs including hsa-miR-4530, hsa-miR-4492, hsa-miR-6125, hsa-miR-494-3p, hsa-miR-638, hsa-miR-6743-5p, hsa-miR-4459 and hsa-miR-4443 were found to be related with EV71 infection for the first time.

3

hsa-miR-197-5p (MIMAT0022691) CGGGUAGAGAGGGCAGUGGGAGG 2102555 hsa-miR-33b-3p (MIMAT0004811) CAGUGCCUCGGCAGUGCAGCCC 204462 hsa-miR-3960 (MIMAT0019337) GGCGGCGGCGGAGGCGGGGG 2100264 hsa-miR-4443 (MIMAT0018961) UUGGAGGCGUGGGUUUU 2104824 hsa-miR-4455 (MIMAT0018977) AGGGUGUGUGUGUUUUU 2105370 hsa-miR-4515 (MIMAT0019052) AGGACUGGACUCCCGGCAGCCC 2118009 hsa-miR-762 (MIMAT0010313) GGGGCUGGGGCCGGGGCCGAGC 2114944 hsa-miR-940 (MIMAT0004983) AAGGCAGGGCCCCCGCUCCCC 204094 hsa-miR-4530 (MIMAT0019069) CCCAGCAGGACGGGAGCG 2105012 hsa-miR-486-5p (MIMAT0002177) UCCUGUACUGAGCUGCCCCGAG 204001 hsa-miR-630 (MIMAT0003299) AGUAUUCUGUACCAGGGAAGGU 204392 cel-miR-39 (MIMAT0000010) UCACCGGGUGUAAAUCAGCUUG 203952 Using an miRWalk 1.0 online tool, target genes of differentially expressed miRNAs were further co-predicted with miRWalk, Targetscan, miRanda, PICTAR2, and DIANAmT software programs.

Figure 2Comparison of the serum levels of miR-33b-3p (A), miR-940 (B), miR-486-5p (C), miR-4443 (D), miR-3960 (E), miR-4530 (F), and miR-4739 (G) in subclinical hypothyroidism (SCH) + spontaneous abortion (SA), SCH, SA, and healthy control (HC) groups.

Only 7 of 11 miRNAs, including miR-33b-3p, miR-940, miR-4443, miR-4530, miR-4739, miR-486-5p, and miR-3960, were stably detected in all 4 groups (Figure 1).

4

5% O [2] Three microRNAs were significantly different between regional macrophages miR-4443 (P = 0.003), miR-30e-5p (P = 0.018) and miR-4454 (P = 0.032).

5% O [2] Three microRNAs were significantly different between regional macrophages miR-4443 (P = 0.003), miR-30e-5p (P = 0.018) and miR-4454 (P = 0.032).

5

Six modulated microRNAs were then selected for real-time PCR validation, which confirmed significant induction of miR-30a-3p and-5p, miR-30c-5p and miR-30c2-3p and miR-365a-5p in keratinocytes from aged skin, whereas miR-4443 was significantly reduced in the aged sample (Figure 1B).

6

Ten candidates (seq-3625_x495, seq-14257_x71, seq-20706_x41, seq-24049_x33, seq-24718_x32, seq-29564_x25, seq-35522_x19, seq-35714_x19, seq-39128_x17, and seq-40419_x16) share seed sequences with known Homo sapiens miRNAs (hsa-miR-4731-5p, hsa-miR-4276, hsa-miR-4693-5p, hsa-miR-4329, hsa-miR-4764-5p, hsa-miR-17-3p, hsa-miR-4633-5p, hsa-miR-3928, hsa-miR-4443, and hsa-miR-3128) respectively.