miRNA Search Results

sort by 6 publications mentioning hsa-mir-4530 Open access articles that are associated with the species Homo sapiens and mention the gene name mir-4530. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.
1	[+] score: 24 Other miRNAs from this paper: hsa-mir-27a, hsa-mir-29a, hsa-mir-23b, hsa-mir-27b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-296, hsa-mir-491, hsa-mir-494, hsa-mir-548a-1, hsa-mir-548b, hsa-mir-548a-2, hsa-mir-548a-3, hsa-mir-548c, hsa-mir-638, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-548e, hsa-mir-548j, hsa-mir-548k, hsa-mir-548l, hsa-mir-548f-1, hsa-mir-548f-2, hsa-mir-548f-3, hsa-mir-548f-4, hsa-mir-548f-5, hsa-mir-548g, hsa-mir-548n, hsa-mir-548m, hsa-mir-548o, hsa-mir-548h-1, hsa-mir-548h-2, hsa-mir-548h-3, hsa-mir-548h-4, hsa-mir-548p, hsa-mir-548i-1, hsa-mir-548i-2, hsa-mir-548i-3, hsa-mir-548i-4, hsa-mir-548q, hsa-mir-548s, hsa-mir-548t, hsa-mir-548u, hsa-mir-548v, hsa-mir-548w, hsa-mir-548x, hsa-mir-548y, hsa-mir-548z, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548o-2, hsa-mir-548h-5, hsa-mir-548ab, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-4443, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548x-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-4492, hsa-mir-4505, hsa-mir-548am, hsa-mir-548an, hsa-mir-548ao, hsa-mir-548ap, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, hsa-mir-6125, hsa-mir-548ay, hsa-mir-548az, hsa-mir-6743, hsa-mir-548ba, hsa-mir-548bb, hsa-mir-548bc Among them, the expression patterns of 7 up-regulated (hsa-miR-4530, hsa-miR-4492, hsa-miR-6125, hsa-miR-494-3p, hsa-miR-638, hsa-miR-6743-5p, hsa-miR-4459) and 1 down-regulated miRNA (hsa-miR-4443) were consistent with the microarray data. [score:9] 8 of the most significantly up-regulated miRNAs (hsa-miR-4530, hsa-miR-4492, hsa-miR-4505, hsa-miR-6125, hsa-miR-494-3p, hsa-miR-638, hsa-miR-6743-5p and hsa-miR-4459) and 3 of the most significantly down-regulated microRNAs (hsa-miR-29a-3p, hsa-miR-4443, hsa-miR-27b-5p) were selected as representatives for confirmation. [score:7] The expressions of hsa-miR-4530, hsa-miR-4492, hsa-miR-6125, hsa-miR-494-3p, hsa-miR-638, hsa-miR-6743-5p, hsa-miR-4459 and hsa-miR-4443 detected by qRT-PCR were consistent with the microarray data. [score:3] As shown in Figure 4, the expressions of hsa-miR-4530, hsa-miR-4492, hsa-miR-6125, hsa-miR-494-3p, hsa-miR-638, hsa-miR-6743-5p, hsa-miR-4459 and hsa-miR-4443 detected by qRT-PCR were consistent with the microarray data with significance (P < 0.05). [score:3] Hsa-miR-4530 was validated as a miRNA marker that differentiated pancreato-biliary cancers from other clinical conditions including healthy controls, non-malignant abnormalities, and other types of cancers [20]. [score:1] But all of the 8 miRNAs including hsa-miR-4530, hsa-miR-4492, hsa-miR-6125, hsa-miR-494-3p, hsa-miR-638, hsa-miR-6743-5p, hsa-miR-4459 and hsa-miR-4443 were found to be related with EV71 infection for the first time. [score:1] [1 to 20 of 6 sentences]
2	[+] score: 9 Other miRNAs from this paper: hsa-mir-197, hsa-mir-486-1, hsa-mir-630, hsa-mir-33b, hsa-mir-762, hsa-mir-940, hsa-mir-4443, hsa-mir-4455, hsa-mir-4515, hsa-mir-3960, hsa-mir-4739, hsa-mir-486-2 hsa-miR-197-5p (MIMAT0022691) CGGGUAGAGAGGGCAGUGGGAGG 2102555 hsa-miR-33b-3p (MIMAT0004811) CAGUGCCUCGGCAGUGCAGCCC 204462 hsa-miR-3960 (MIMAT0019337) GGCGGCGGCGGAGGCGGGGG 2100264 hsa-miR-4443 (MIMAT0018961) UUGGAGGCGUGGGUUUU 2104824 hsa-miR-4455 (MIMAT0018977) AGGGUGUGUGUGUUUUU 2105370 hsa-miR-4515 (MIMAT0019052) AGGACUGGACUCCCGGCAGCCC 2118009 hsa-miR-762 (MIMAT0010313) GGGGCUGGGGCCGGGGCCGAGC 2114944 hsa-miR-940 (MIMAT0004983) AAGGCAGGGCCCCCGCUCCCC 204094 hsa-miR-4530 (MIMAT0019069) CCCAGCAGGACGGGAGCG 2105012 hsa-miR-486-5p (MIMAT0002177) UCCUGUACUGAGCUGCCCCGAG 204001 hsa-miR-630 (MIMAT0003299) AGUAUUCUGUACCAGGGAAGGU 204392 cel-miR-39 (MIMAT0000010) UCACCGGGUGUAAAUCAGCUUG 203952 Using an miRWalk 1.0 online tool, target genes of differentially expressed miRNAs were further co-predicted with miRWalk, Targetscan, miRanda, PICTAR2, and DIANAmT software programs. [score:7] Only 7 of 11 miRNAs, including miR-33b-3p, miR-940, miR-4443, miR-4530, miR-4739, miR-486-5p, and miR-3960, were stably detected in all 4 groups (Figure 1). [score:1] Figure 2Comparison of the serum levels of miR-33b-3p (A), miR-940 (B), miR-486-5p (C), miR-4443 (D), miR-3960 (E), miR-4530 (F), and miR-4739 (G) in subclinical hypothyroidism (SCH) + spontaneous abortion (SA), SCH, SA, and healthy control (HC) groups. [score:1] [1 to 20 of 3 sentences]
3	[+] score: 7 Other miRNAs from this paper: hsa-mir-20a, hsa-mir-197, hsa-mir-139, hsa-mir-126, hsa-mir-296, hsa-mir-369, hsa-mir-494, hsa-mir-520f, hsa-mir-505, hsa-mir-574, hsa-mir-586, hsa-mir-638, hsa-mir-877, hsa-mir-1225, hsa-mir-1238, hsa-mir-1915, hsa-mir-2861, hsa-mir-3162, hsa-mir-4307, hsa-mir-4312, hsa-mir-4281, hsa-mir-3665, hsa-mir-3940, hsa-mir-4455, hsa-mir-4466, hsa-mir-4484, hsa-mir-4505, hsa-mir-4516, hsa-mir-1587, hsa-mir-3960, hsa-mir-4687, hsa-mir-4753, hsa-mir-371b, hsa-mir-4787, hsa-mir-5001, hsa-mir-6068, hsa-mir-6069 A study by Xun et al. show that the expression level of miR-4530 [72] and miR-296-5p are most differentially up-regulated in enterovirus 71 (EV71) infections [73]. [score:6] Indeed, some miRNAs that have been previously linked to carcinogenesis of different organs and tissues, such as miR-2861 [47, 48], miR-4530 [49], miR-638 [50], miR-371b-5p [51], miR-1225-5p [52, 53], miR-296-5p [54, 55], miR-4787-5p [56], miR-4281 [57], miR-4455 [58], miR-197-3p [59], miR-369-5p [60, 61] and miR-505-3p [62] which were found to be altered in brucellosis in our analysis. [score:1] [1 to 20 of 2 sentences]
4	[+] score: 6 Other miRNAs from this paper: hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-155, hsa-mir-146b, hsa-mir-665, hsa-mir-543, hsa-mir-4430 Five (miR-155-5p, 665, 19b-3p, 146b-5p, and 543) of the 15 miRNAs were upregulated, and the other 10 miRNAs (miR-4530, 4430, 4271, 3177-3p, 4732-5p, 6886-5p, 4640-5p, 6847-5p, 601, and 4497) were downregulated in the cytokine group compared with the normal group. [score:6] [1 to 20 of 1 sentences]
5	[+] score: 3 Other miRNAs from this paper: hsa-mir-199a-1, hsa-mir-139, hsa-mir-183, hsa-mir-199a-2, hsa-mir-125b-1, hsa-mir-125b-2, hsa-mir-150, hsa-mir-328, hsa-mir-483, hsa-mir-494, hsa-mir-572, hsa-mir-574, hsa-mir-638, hsa-mir-762, hsa-mir-885, hsa-mir-940, hsa-mir-1225, hsa-mir-1238, hsa-mir-1202, hsa-mir-1207, hsa-mir-1275, hsa-mir-1915, hsa-mir-1973, hsa-mir-3162, hsa-mir-3196, hsa-mir-4299, hsa-mir-4284, hsa-mir-3679, hsa-mir-3940, hsa-mir-4485, hsa-mir-4516, hsa-mir-4649, hsa-mir-4728, hsa-mir-4739, hsa-mir-371b, hsa-mir-4787, hsa-mir-5787, hsa-mir-6069, hsa-mir-6090 Eleven miRNAs (miRNA-4530, miRNA-4739, miRNA-762, miRNA-4787-5p, miRNA-940, miRNA-3676-5p, miRNA-6090, miRNA-150-5p, miRNA-4516, miRNA-4284, miRNA-3656) demonstrated a similar expression trend in both the acute and chronic groups. [score:3] [1 to 20 of 1 sentences]
6	[+] score: 2 Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-30a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-30b, hsa-mir-320a, hsa-mir-155, hsa-mir-30c-1, hsa-mir-30e, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-320e, hsa-mir-4270 Six of 16 (miR-4530, -4428, -6124, -4459, -1915-3p, and -4270) occupied a central position in the regulation of inflammatory processes (Figure 3). [score:2] [1 to 20 of 1 sentences]

sort by

6 publications mentioning hsa-mir-4530

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-4530. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

[+] score: 24

Other miRNAs from this paper: hsa-mir-27a, hsa-mir-29a, hsa-mir-23b, hsa-mir-27b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-296, hsa-mir-491, hsa-mir-494, hsa-mir-548a-1, hsa-mir-548b, hsa-mir-548a-2, hsa-mir-548a-3, hsa-mir-548c, hsa-mir-638, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-548e, hsa-mir-548j, hsa-mir-548k, hsa-mir-548l, hsa-mir-548f-1, hsa-mir-548f-2, hsa-mir-548f-3, hsa-mir-548f-4, hsa-mir-548f-5, hsa-mir-548g, hsa-mir-548n, hsa-mir-548m, hsa-mir-548o, hsa-mir-548h-1, hsa-mir-548h-2, hsa-mir-548h-3, hsa-mir-548h-4, hsa-mir-548p, hsa-mir-548i-1, hsa-mir-548i-2, hsa-mir-548i-3, hsa-mir-548i-4, hsa-mir-548q, hsa-mir-548s, hsa-mir-548t, hsa-mir-548u, hsa-mir-548v, hsa-mir-548w, hsa-mir-548x, hsa-mir-548y, hsa-mir-548z, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548o-2, hsa-mir-548h-5, hsa-mir-548ab, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-4443, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548x-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-4492, hsa-mir-4505, hsa-mir-548am, hsa-mir-548an, hsa-mir-548ao, hsa-mir-548ap, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, hsa-mir-6125, hsa-mir-548ay, hsa-mir-548az, hsa-mir-6743, hsa-mir-548ba, hsa-mir-548bb, hsa-mir-548bc

Among them, the expression patterns of 7 up-regulated (hsa-miR-4530, hsa-miR-4492, hsa-miR-6125, hsa-miR-494-3p, hsa-miR-638, hsa-miR-6743-5p, hsa-miR-4459) and 1 down-regulated miRNA (hsa-miR-4443) were consistent with the microarray data. [score:9]

8 of the most significantly up-regulated miRNAs (hsa-miR-4530, hsa-miR-4492, hsa-miR-4505, hsa-miR-6125, hsa-miR-494-3p, hsa-miR-638, hsa-miR-6743-5p and hsa-miR-4459) and 3 of the most significantly down-regulated microRNAs (hsa-miR-29a-3p, hsa-miR-4443, hsa-miR-27b-5p) were selected as representatives for confirmation. [score:7]

The expressions of hsa-miR-4530, hsa-miR-4492, hsa-miR-6125, hsa-miR-494-3p, hsa-miR-638, hsa-miR-6743-5p, hsa-miR-4459 and hsa-miR-4443 detected by qRT-PCR were consistent with the microarray data. [score:3]

As shown in Figure 4, the expressions of hsa-miR-4530, hsa-miR-4492, hsa-miR-6125, hsa-miR-494-3p, hsa-miR-638, hsa-miR-6743-5p, hsa-miR-4459 and hsa-miR-4443 detected by qRT-PCR were consistent with the microarray data with significance (P < 0.05). [score:3]

Hsa-miR-4530 was validated as a miRNA marker that differentiated pancreato-biliary cancers from other clinical conditions including healthy controls, non-malignant abnormalities, and other types of cancers [20]. [score:1]

But all of the 8 miRNAs including hsa-miR-4530, hsa-miR-4492, hsa-miR-6125, hsa-miR-494-3p, hsa-miR-638, hsa-miR-6743-5p, hsa-miR-4459 and hsa-miR-4443 were found to be related with EV71 infection for the first time. [score:1]

[1 to 20 of 6 sentences]

[+] score: 9

Other miRNAs from this paper: hsa-mir-197, hsa-mir-486-1, hsa-mir-630, hsa-mir-33b, hsa-mir-762, hsa-mir-940, hsa-mir-4443, hsa-mir-4455, hsa-mir-4515, hsa-mir-3960, hsa-mir-4739, hsa-mir-486-2

hsa-miR-197-5p (MIMAT0022691) CGGGUAGAGAGGGCAGUGGGAGG 2102555 hsa-miR-33b-3p (MIMAT0004811) CAGUGCCUCGGCAGUGCAGCCC 204462 hsa-miR-3960 (MIMAT0019337) GGCGGCGGCGGAGGCGGGGG 2100264 hsa-miR-4443 (MIMAT0018961) UUGGAGGCGUGGGUUUU 2104824 hsa-miR-4455 (MIMAT0018977) AGGGUGUGUGUGUUUUU 2105370 hsa-miR-4515 (MIMAT0019052) AGGACUGGACUCCCGGCAGCCC 2118009 hsa-miR-762 (MIMAT0010313) GGGGCUGGGGCCGGGGCCGAGC 2114944 hsa-miR-940 (MIMAT0004983) AAGGCAGGGCCCCCGCUCCCC 204094 hsa-miR-4530 (MIMAT0019069) CCCAGCAGGACGGGAGCG 2105012 hsa-miR-486-5p (MIMAT0002177) UCCUGUACUGAGCUGCCCCGAG 204001 hsa-miR-630 (MIMAT0003299) AGUAUUCUGUACCAGGGAAGGU 204392 cel-miR-39 (MIMAT0000010) UCACCGGGUGUAAAUCAGCUUG 203952 Using an miRWalk 1.0 online tool, target genes of differentially expressed miRNAs were further co-predicted with miRWalk, Targetscan, miRanda, PICTAR2, and DIANAmT software programs. [score:7]

Only 7 of 11 miRNAs, including miR-33b-3p, miR-940, miR-4443, miR-4530, miR-4739, miR-486-5p, and miR-3960, were stably detected in all 4 groups (Figure 1). [score:1]

Figure 2Comparison of the serum levels of miR-33b-3p (A), miR-940 (B), miR-486-5p (C), miR-4443 (D), miR-3960 (E), miR-4530 (F), and miR-4739 (G) in subclinical hypothyroidism (SCH) + spontaneous abortion (SA), SCH, SA, and healthy control (HC) groups. [score:1]

[1 to 20 of 3 sentences]

[+] score: 7

A study by Xun et al. show that the expression level of miR-4530 [72] and miR-296-5p are most differentially up-regulated in enterovirus 71 (EV71) infections [73]. [score:6]

Indeed, some miRNAs that have been previously linked to carcinogenesis of different organs and tissues, such as miR-2861 [47, 48], miR-4530 [49], miR-638 [50], miR-371b-5p [51], miR-1225-5p [52, 53], miR-296-5p [54, 55], miR-4787-5p [56], miR-4281 [57], miR-4455 [58], miR-197-3p [59], miR-369-5p [60, 61] and miR-505-3p [62] which were found to be altered in brucellosis in our analysis. [score:1]

[1 to 20 of 2 sentences]

[+] score: 6

Other miRNAs from this paper: hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-155, hsa-mir-146b, hsa-mir-665, hsa-mir-543, hsa-mir-4430

Five (miR-155-5p, 665, 19b-3p, 146b-5p, and 543) of the 15 miRNAs were upregulated, and the other 10 miRNAs (miR-4530, 4430, 4271, 3177-3p, 4732-5p, 6886-5p, 4640-5p, 6847-5p, 601, and 4497) were downregulated in the cytokine group compared with the normal group. [score:6]

[1 to 20 of 1 sentences]

[+] score: 3

Eleven miRNAs (miRNA-4530, miRNA-4739, miRNA-762, miRNA-4787-5p, miRNA-940, miRNA-3676-5p, miRNA-6090, miRNA-150-5p, miRNA-4516, miRNA-4284, miRNA-3656) demonstrated a similar expression trend in both the acute and chronic groups. [score:3]

[1 to 20 of 1 sentences]

[+] score: 2

Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-30a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-30b, hsa-mir-320a, hsa-mir-155, hsa-mir-30c-1, hsa-mir-30e, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-320e, hsa-mir-4270

Six of 16 (miR-4530, -4428, -6124, -4459, -1915-3p, and -4270) occupied a central position in the regulation of inflammatory processes (Figure 3). [score:2]

[1 to 20 of 1 sentences]

miRBase

6 publications mentioning hsa-mir-4530