sort by

5 publications mentioning mtr-MIR160f

Open access articles that are associated with the species Medicago truncatula and mention the gene name MIR160f. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 39
Prediction of the microRNA putative target sites of MtARF genesIn Arabidopsis, the expression levels of ARF6 and ARF8 are regulated by microRNA167 (Yang et al., 2006) and ARF10, 16, and 17 were targeted by microRNA160 (Liu et al., 2007). [score:7]
Ectopic expression of miR160 results in auxin hypersensitivity, cytokinin hyposensitivity, and inhibition of symbiotic nodule development in soybean. [score:6]
Sequence analysis of ARFs in M. truncatula implied that the 1344–1364 bp region on MtARF1 and the 1314–1330 bp region on MtARF10 may be the target sites of miRNA160 and the 2457–2477 bp region on MtARF6 and the 2301–2321 bp region on MtARF9 may be the target sites of miRNA167 (Figure 4). [score:5]
As homologous genes of AtARF10, the expression of MtARF1 and MtARF10 may be also inhibited by mtr-miR160. [score:5]
In Arabidopsis, the expression levels of ARF6 and ARF8 are regulated by microRNA167 (Yang et al., 2006) and ARF10, 16, and 17 were targeted by microRNA160 (Liu et al., 2007). [score:5]
In Arabidopsis, negative regulation of AtARF10 by miR160 participates in seed germination and post-embryonic developmental programs (Liu et al., 2007). [score:3]
Figure 4Predictions of target sites of Mrt-miR167 and Mrt-miR160 in MtARF genes. [score:3]
A set of ARFs repressor could be silenced in plants overexposing miRNA160, suggesting that auxin hypersensitivity was regulated by miR160 in ARF -dependent manner. [score:2]
Our results suggest that five precursors (mtr-miR160, 160b, 160c, 160d, and 160e) in the M. truncatula genome were needed to produce the mature mtr-miRNA160 sequence (UGCCUGGCUCCCUGUAUGCCA), but only one precursor (mtr-miRNA167) was needed to produce the mature mtr-miRNA167 sequence (UGAAGCUGCCAGCAUGAUCUA). [score:1]
cn/PMRD/) was used to search the sequences of Mrt-miR160 and Mrt-miR167. [score:1]
Recently, miR160 in leguminous plants soybean has been reported by Turner's group (Turner et al., 2013). [score:1]
[1 to 20 of 11 sentences]
2
[+] score: 5
Other miRNAs from this paper: mtr-MIR160a, mtr-MIR166a, mtr-MIR169a, mtr-MIR399b, mtr-MIR399d, mtr-MIR393a, mtr-MIR395a, mtr-MIR395b, mtr-MIR399c, mtr-MIR399a, mtr-MIR399e, mtr-MIR156a, mtr-MIR171a, mtr-MIR395c, mtr-MIR395d, mtr-MIR395e, mtr-MIR395f, mtr-MIR395g, mtr-MIR395h, mtr-MIR395i, mtr-MIR395j, mtr-MIR395l, mtr-MIR395m, mtr-MIR395n, mtr-MIR395o, mtr-MIR395k, mtr-MIR156b, mtr-MIR167a, mtr-MIR164a, mtr-MIR160b, mtr-MIR166b, mtr-MIR160c, mtr-MIR169c, mtr-MIR169d, mtr-MIR169e, mtr-MIR171b, mtr-MIR166c, mtr-MIR166d, mtr-MIR169f, mtr-MIR156c, mtr-MIR156d, mtr-MIR390, mtr-MIR399f, mtr-MIR399g, mtr-MIR399h, mtr-MIR399i, mtr-MIR399j, mtr-MIR399k, mtr-MIR166e, mtr-MIR156e, mtr-MIR171c, mtr-MIR393b, mtr-MIR169g, mtr-MIR156f, mtr-MIR399l, mtr-MIR156g, mtr-MIR399m, mtr-MIR399n, mtr-MIR399o, mtr-MIR164b, mtr-MIR156h, mtr-MIR166f, mtr-MIR160d, mtr-MIR164c, mtr-MIR164d, mtr-MIR166g, mtr-MIR171d, mtr-MIR171e, mtr-MIR396a, mtr-MIR396b, mtr-MIR169h, mtr-MIR169b, mtr-MIR156i, mtr-MIR171f, mtr-MIR160e, mtr-MIR399p, mtr-MIR1507, mtr-MIR1509a, mtr-MIR2118, mtr-MIR169k, mtr-MIR2590a, mtr-MIR2590b, mtr-MIR2590c, mtr-MIR2590d, mtr-MIR2590e, mtr-MIR2590f, mtr-MIR2592b, mtr-MIR2592c, mtr-MIR2592d, mtr-MIR2592e, mtr-MIR2592f, mtr-MIR2592i, mtr-MIR2592j, mtr-MIR2592o, mtr-MIR2592p, mtr-MIR2592q, mtr-MIR2592r, mtr-MIR2592s, mtr-MIR2597, mtr-MIR2111c, mtr-MIR2111d, mtr-MIR2111e, mtr-MIR2111g, mtr-MIR2111h, mtr-MIR2111i, mtr-MIR2111m, mtr-MIR2111n, mtr-MIR2111o, mtr-MIR2610a, mtr-MIR2610b, mtr-MIR169j, mtr-MIR1509b, mtr-MIR2619a, mtr-MIR2592a, mtr-MIR2592g, mtr-MIR2592h, mtr-MIR2592k, mtr-MIR2592l, mtr-MIR2592m, mtr-MIR2592n, mtr-MIR2111b, mtr-MIR2111j, mtr-MIR2111k, mtr-MIR2630a, mtr-MIR2630b, mtr-MIR2630c, mtr-MIR2630w, mtr-MIR2630x, mtr-MIR2630y, mtr-MIR2630d, mtr-MIR2630e, mtr-MIR2630f, mtr-MIR2630g, mtr-MIR2630h, mtr-MIR2630i, mtr-MIR2630j, mtr-MIR2630k, mtr-MIR2630l, mtr-MIR2630m, mtr-MIR2630n, mtr-MIR2630o, mtr-MIR2630p, mtr-MIR2630q, mtr-MIR2630r, mtr-MIR2630s, mtr-MIR2630t, mtr-MIR2630u, mtr-MIR2630v, mtr-MIR2645, mtr-MIR399q, mtr-MIR5205a, mtr-MIR5205b, mtr-MIR5205c, mtr-MIR5205d, mtr-MIR2592t, mtr-MIR2592u, mtr-MIR2592v, mtr-MIR2592w, mtr-MIR2592x, mtr-MIR2592y, mtr-MIR2592z, mtr-MIR2592ab, mtr-MIR2592ac, mtr-MIR2592ad, mtr-MIR2592ae, mtr-MIR2592af, mtr-MIR2592ah, mtr-MIR2592ai, mtr-MIR2592aj, mtr-MIR2592al, mtr-MIR2592am, mtr-MIR2592an, mtr-MIR2592ao, mtr-MIR2592ap, mtr-MIR2592aq, mtr-MIR2592ar, mtr-MIR2592as, mtr-MIR2592at, mtr-MIR2592au, mtr-MIR2592av, mtr-MIR2592aw, mtr-MIR2592ax, mtr-MIR2592ay, mtr-MIR2592az, mtr-MIR2592ba, mtr-MIR2592bb, mtr-MIR2592bc, mtr-MIR2592bd, mtr-MIR2592be, mtr-MIR2592bf, mtr-MIR2592bg, mtr-MIR2592bi, mtr-MIR2592bj, mtr-MIR2592bk, mtr-MIR482, mtr-MIR5241a, mtr-MIR5241b, mtr-MIR5241c, mtr-MIR2111l, mtr-MIR2111f, mtr-MIR171h, mtr-MIR399r, mtr-MIR156j, mtr-MIR2590g, mtr-MIR5283, mtr-MIR2590h, mtr-MIR2590i, mtr-MIR2590j, mtr-MIR5287a, mtr-MIR5287b, mtr-MIR2619b, mtr-MIR2592bl, mtr-MIR2592bm, mtr-MIR2592bn, mtr-MIR167b, mtr-MIR2111a, mtr-MIR396c, mtr-MIR171g, mtr-MIR530, mtr-MIR169i, mtr-MIR397, mtr-MIR7696a, mtr-MIR7696b, mtr-MIR7696c, mtr-MIR7696d, mtr-MIR169l, mtr-MIR399s, mtr-MIR399t, mtr-MIR2592bo, mtr-MIR2592bp, mtr-MIR2592bq, mtr-MIR2592br
Many of them, like miR160, miR164, miR167, miR390 and miR393, directly or indirectly regulate genes related to auxin signaling [10]. [score:4]
To date, only few miRNAs have known functions in the root apical meristem - for example, ath-miR160 involved in root cap differentiation and stem cell niche maintenance in A. thaliana and M. truncatula [64, 65], and mtr-miR396, which restricts root growth and meristematic cell proliferation in M. truncatula [28]. [score:1]
[1 to 20 of 2 sentences]
3
[+] score: 3
We found homologs of known miRNA target genes for several conserved M. truncatula miRNAs, such as SBP for miR156, NAC for miR160, AGO1 for miR168, bZIP for miR165, GRAS for miR171, AP2 for miR172 and low affinity sulphur transporter for miR395. [score:3]
[1 to 20 of 1 sentences]
4
[+] score: 3
Bustos-Sanmamed P. Mao G. Deng Y. Elouet M. Khan G. A. Bazin J. Turner M. Subramanian S. Yu O. Crespi M. Overexpression of miR160 affects root growth and nitrogen-fixing nodule number in Medicago truncatula Funct. [score:3]
[1 to 20 of 1 sentences]
5
[+] score: 2
ARF10 has been shown to restrict the size of the stem cell niche in the distil root causing the differentiation of root cap cells, it is regulated by both IAA and miR160 [58]. [score:2]
[1 to 20 of 1 sentences]