sort by

1 publications mentioning asu-mir-100a-1

Open access articles that are associated with the species Ascaris suum and mention the gene name mir-100a-1. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 33
The second most expressed microRNA, miR-100, was found to be an oncogene in human, which is differently expressed in many cancer cells [51]. [score:5]
In acute myeloblastic leukemia, miR-100 targets the RBSP3 to regulate cell differentiation and survival [51]. [score:4]
In nasopharyngeal cancer, miR-100 regulates the expression of Polo-like kinase 1 [52]. [score:4]
Interestingly, there are two microRNAs, miR-100 and miR-92, that were highly expressed in M. incognita, but were lost in C. elegans. [score:3]
In the M. incognita genome, the miR-100 is clustered within ~350 bp of let-7. Many organisms express multiple miR-100 paralogues. [score:3]
In adrenocortical cancer cells and in clear cell ovarian cancer, miR-100 targets mTOR [53]. [score:3]
It is interesting that miR-100 has been lost in free living nematodes such as C. elegans [44] and P. pacificus (Fig 6B). [score:1]
If the mature sequences of two microRNA genes were identical, we treated them as the same microRNA genes with two copies in the genome, such as miR-100a-1 and miR-100a-2 in M. incognita with mature sequences both as uacccguagauccgaacuaguc. [score:1]
If the mature sequences of two microRNA genes were different from less than three bases, we labeled them as derivations of the same microRNA gene, such as miR-100a-1 and miR-100b, with mature sequences such as uacccguagauccgaacuaguc and aacccguagauccgaacuagucu, respectively. [score:1]
The microRNA cluster let-7 and miR-100 has been found in Brugia malayi [41], Drosophila [42] and humans [43]. [score:1]
The sequences alignment of the miR-100 orthologues from human, fly, B. malayi, A. suum, B. xylophilus, and M. incognita showed that the seed sequence, ACCCGUA, conserved in these species (Fig 6A). [score:1]
There are four microRNAs, miR-100, miR-92, miR-279 and miR-137, which exist only in genomes of parasitic nematodes A. suum, B. malayi, P. pacificus and M. incognita, but do not exist in the genomes of the free living nematode C. elegans. [score:1]
There are four paralogues (miR-100a through 100d) in B. malayi. [score:1]
We have identified 3 miR-100 paralogues in M. incognita. [score:1]
Conservation of miR-100, in sequence and genomic organization. [score:1]
Contig Position Strand Cluster Reported in other nematode MiV1ctg20 43319–43619 + miR-71-1 H. contortus [48] miR-2a-1 MiV1ctg221 69290–69588 - miR-71-2 miR-2a-2 MiV1ctg1924 3647–4158 + let-7 B. malayi [41] miR-100 MiV1ctg644 18822–19030 - miR-279 B. pahangi [48] miR-2b MiV1ctg27 99326–99923 - NOVEL-1-1 NOVEL-39 MiV1ctg2865 1792–2014 + miR-240 NOVEL-30 MiV1ctg1143 4187–4580 + NOVEL-12 NOVEL-11 NOVEL-14 MiR-100 orthologues are often found in clusters with let-7 and the clusters range in size from ~300 to 4000 bp [41]. [score:1]
0133491.g006 Fig 6Conservation of miR-100, in sequence and genomic organization. [score:1]
[1 to 20 of 17 sentences]