1 |
[+]
score:
284
Other miRNAs from this paper: gma-MIR159a, gma-MIR166a, gma-MIR166b, gma-MIR159b, gma-MIR159c, gma-MIR159d, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR159e, gma-MIR159f, gma-MIR166i, gma-MIR166j, gma-MIR166k, gma-MIR166l, gma-MIR166m, gma-MIR166n, gma-MIR166o, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u
For example, miR166 up-regulation upon salinity stress and concomitant depression of its targets were observed in andigena potato, suggesting an important network node for modulating gene expression responsive for growth adjustments [18].
[score:8]
Although five novel MIR166s in soybean were differentially regulated during seed development or in response to stresses, their expression patterns were not negatively correlated with the ones of miR166 target genes (Figs. 9 and 10).
[score:7]
b Expression patterns of the 5 MIR166 genes in seedlings exposed to cold stress for 0, 3, 6, 12, 24, 48 and 72 h. c Expression patterns of the 5 MIR166 genes in seedlings exposed to drought stress for 0, 2, 4, 6, 8 and 10 d. d Expression patterns of the 5 MIR166 genes in seedlings exposed to salinity stress for 0, 3, 6, 12, 24 and 72 h. Error bars indicate SE of two biological and three technical replicates.
[score:7]
For example, RICE Dof DAILY FLUCTUATIONS 1 (RDD1) can be targeted by miR166 in rice, thereby regulating nutrient ion uptake and accumulation in rice [16]; while miR166m rather than other miR166 members in Physcomitrella patens was predicted to target 3 non-HD-ZIPIII transcripts such as TC21828, FC366912 and TC13986 [24].
[score:6]
It has been well demonstrated that miR166 family can control the expression of HD-ZIPIII genes via directly targeting their transcripts for degradation [14, 17, 21].
[score:6]
Expression pattern of miR166 target genes during seed development or in response to abiotic stresses.
[score:6]
Another kind of examples are that miR166 in potato was significantly up-regulated by salinity stress [18], and depression of miR166 by small tandem target mimic can lead to improvement of salt tolerance in Arabidopsis [44].
[score:6]
Analyzing cis-regulatory motifs in MIR166 promotersTo provide clues for understanding the regulatory mechanism of MIR166 expression, bioinformatics analysis was conducted to identify putative cis-regulatory elements in promoter region, which was defined based on the estimated transcription start site (TSS).
[score:6]
To obtain a further understanding of biological functions of miR166 family in soybean, the transcripts of Glycine max from JGI genomic project were utilized as a reference system to predict the targets of soybean miR166s by employing the psRNATarget tool.
[score:5]
The fragments per kilobase of transcript per million mapped reads (FPKM) values for each MIR166 and its targets were extracted from Phytozome database by tracking soybean gene-level expression (http://www.
[score:5]
Fig. 8Expression patterns of miR166 target genes in different soybean tissues.
[score:5]
net) Expression pattern of the five newly identified MIR166 genes during seed development or in response to abiotic stressesSeveral studies have documented that miR166 plays important roles during seed development and in response to abiotic stresses [13, 14, 36– 38].
[score:5]
Fig. 7Phylogenetic analysis of unique target sequences (UTS) present in plant species and binding sites of miR166 in target genes.
[score:5]
Fig. 6Predicted targets of miR166 family and validation of miR166 target gene using RLM-RACE PCR.
[score:5]
To provide clues for understanding the regulatory mechanism of MIR166 expression, bioinformatics analysis was conducted to identify putative cis-regulatory elements in promoter region, which was defined based on the estimated transcription start site (TSS).
[score:5]
These expression patterns are consistent with previous report that miR166 in Brassica napus was strongly accumulated at late stage of seed development [43].
[score:4]
Expression pattern of the five newly identified MIR166 genes during seed development or in response to abiotic stresses.
[score:4]
Furthermore, the expression patterns of five newly identified MIR166s during seed development and in response to abiotic stresses provided important clues for elucidating the functional specificity and redundancy of miR166 family in soybean.
[score:4]
These results suggested that miR166 -mediated silencing of target genes was under sophisticated regulation.
[score:4]
miR166 family Soybean Evolutionary conservation and diversification Promoter analysis Gene expression pattern MicroRNAs (miRNAs) are a class of endogenous, single-stranded, small regulatory RNA molecules, which broadly exist in diverse eukaryotes.
[score:4]
a Expression patterns of the 5 MIR166 genes during seed development (15, 30, 45, 65 days after flowering).
[score:4]
Light-responsive elements were most enriched in the promoters of MIR166 family genes (100% of promoters were found to contain light responsive elements), followed by two endosperm-specific regulatory motifs (Skn1, 84.6% and GCN4, 65.4%) and four stress-responsive elements such as TC-rich (76.9%), HSE (61.5%), ARE (61.5%) and MBS (61.5%), suggesting that these cis-elements are fundamental to the expression of MIR166 family genes.
[score:4]
Interestingly, MIR166g, MIR166r and MIR166z contained HD-ZIPIII binding site in their promoter regions (Fig. 4), implying a possible HD-ZIPIII -mediated feedback regulatory loop for MIR166 expression in soybean.
[score:4]
Fig. 9Expression analysis of the five newly identified MIR166 genes in response to seed development and abiotic stresses.
[score:4]
Future study will aim at investigating the effect of each MIR166 gene on seed development and stress tolerance, identifying target genes and dissecting the regulatory mechanisms for each MIR166, and exploring combination of multiple MIR166 genes during seed development and in response to specific stress.
[score:4]
For example, miR166 can repress the seed maturation program during vegetative development via controlling the expression of HD-ZIP III family genes such as PHB [14]; while it might also be involved in somatic embryo formation via acting as a positional signal from the basal–peripheral region of early embryos [13].
[score:4]
These different set of targets suggest functional diversity of miR166 family in plant species.
[score:3]
Expression analysis of MIR166s in soybeanTo investigate the expression patterns of MIR166 genes, we mined the publicly available transcript profiling data of soybean tissues at the Phytozome database (http://www.
[score:3]
Group 2 contains MIR166g and MIR166i with high expression in flowers, shoot apical meristem, leaf and/or nodules, while group 3 consists of MIR166n/y, MIR166e/q and MIR166p with high transcript abundance either in seed, pod, flower or shoot apical meristem.
[score:3]
Furthermore, promoter analysis and target prediction results pointed to functional diversification of soybean MIR166 gene family.
[score:3]
miR166 sequences are displayed to highlight complementarity to target mRNAs.
[score:3]
Similarly, three MIR166 genes (MIR165a, MIR166a and MIR166b) were observed to be expressed specifically in the root endodermis and post-embryonic meristem in Arabidopsis [26].
[score:3]
The unique miR166 binding sites in target transcripts were designated as UTS and numbered (Additional file 10: Table S7).
[score:3]
Fig. 5Expression analysis of soybean MIR166 genes in various tissues.
[score:3]
So, we speculated that MIR166 gene family possibly contributes to the accumulation pattern of target genes in a family member-specific manner.
[score:3]
Thus, addressing the evolutionary conservation and diversification of MIR166 gene family becomes an important step towards understanding their fine-tuned regulatory roles in plant developmental processes and/or resistance to stresses.
[score:3]
In the study, the differential expression patterns of 5 MIR166 genes under same stress indicated their functional specificity (Fig. 9b-d).
[score:3]
Thus, the diversity and evolutionary conservation of MIR166 family genes are expected to be elucidated for further understanding their fine-tuned regulatory roles in plant developmental processes and/or resistance to stresses.
[score:3]
Secondly, spatio-temporal expression patterns of MIR166 genes also reflect their functional specialization [25].
[score:3]
net) and found that 9 MIR166 genes showed tissue-specific expression patterns.
[score:3]
Furthermore, the altered expression patterns of the five newly identified MIR166 genes suggest their prominent roles in response to cold, drought and salinity (Fig. 9b-d).
[score:3]
Prediction of miR166 targets in soybean.
[score:3]
The cis-elements in promoters of MIR166 family genes and their putative targets pointed to their possible contributions to the functional conservation and diversification.
[score:3]
When young seedlings were subjected to salt stress, the expressions of all the 5 MIR166 genes were promptly increased at 3 h after salt treatment (Fig. 9d).
[score:3]
Based on their expression patterns, the 9 MIR166 genes can be categorized into three groups (Fig. 5).
[score:3]
It was also observed that each of the pre-miR166 paralogous pairs generated identical mature sequence except the pair of miR166h and miR166j, suggesting that they might target the same set of genes in soybean.
[score:3]
Additionally, the most closely related pre-miR166 paralogs (such as miR166h and miR166j; miR166g and miR166i) also shared similar tissue-specific expression pattern in soybean (Fig. 5).
[score:3]
A good example is that only five members of MIR166 gene family (MIR165a, MIR165b, MIR166a, MIR166b and MIR166g) in Arabidopsis were found to be expressed in embryo, which might provide a positional signal from the basal–peripheral region of early embryos, whereas the other four MIR166s can not be detected in any stage of embryogenesis [13].
[score:3]
In contrast, some motifs exist only in three or fewer members of MIR166 gene family (such as MSA-like 3.8%, RY-element 11.5%, HD-ZIP III binding site 11.5% and MBSI 11.5%), implying that these motifs might be involved in controlling the specificity of MIR166 expression.
[score:3]
These findings have laid a foundation for elucidating functional conservation and diversification of miR166 family members, especially during seed development or under abiotic stresses.
[score:2]
net) Several studies have documented that miR166 plays important roles during seed development and in response to abiotic stresses [13, 14, 36– 38].
[score:2]
These findings laid a foundation for elucidating functional diversification of soybean MIR166 gene family, especially during seed development or in response to abiotic stresses.
[score:2]
The cis-regulatory elements were non-uniformly distributed in different MIR166 promoters.
[score:2]
Thus, it was hypothesized that these most closely related pre-miR166 paralogs in soybean perform similar cellular functions during developmental processes or in response to various stresses.
[score:2]
So, many efforts have been made to elucidate functional roles and regulatory mechanisms of miR166 family in different plant species.
[score:2]
Analyzing cis-regulatory motifs in MIR166 promoters.
[score:2]
It has been well-known that miR166 plays important roles during seed development.
[score:2]
Furthermore, specific promoter elements were analyzed for understanding MIR166 functional roles.
[score:1]
The five newly identified miR166s in soybean are highlighted with a star, and the identity between paralogous pair is listed Meanwhile, the topological tree of mature miR166s strongly supported the conserved property of miR166 family.
[score:1]
For syntenic mapping, we firstly used the coordinate of each pre-miR166 to map its genomic locus or flanking genes, which were subsequently subjected to retrieval of duplicated genomic regions and Ka/Ks values for each duplicated MIR166s from batch download option of Plant Genome Duplication Database (http://chibba.
[score:1]
Kitazumi A Kawahara Y Onda TS De Koeyer D de los Reyes BG Implications of miR166 and miR159 induction to the basal response mechanisms of an andigena potato (Solanum tuberosum subsp.
[score:1]
miR166 family generally comprises multiple miR166 members in plants, which might exhibit functional redundancy and specificity.
[score:1]
Promoter analysis of MIR166 genes in soybeanThe transcription start sites of MIR166 genes were predicted by TSSP software in Softberry (http://linux1.
[score:1]
a Phylogenetic analysis of miR166 precursors.
[score:1]
miR166 acts as a highly conserved miRNA to be implicated in a wide range of cellular and physiological processes in plants [12, 14– 18, 38].
[score:1]
We identified five novel miR166s in soybean by data mining approach, thus enlarging the size of miR166 family from 21 to 26 members.
[score:1]
The five newly identified miR166s in soybean are highlighted with a star, and the identity between paralogous pair is listed Meanwhile, the topological tree of mature miR166s strongly supported the conserved property of miR166 family.
[score:1]
Six UmiR166s presentative of 26 soybean miR166s were grouped in the Class IV (such as miR166a-g, i, n, o, v, w, x, y, UmiR166-28; miR166p-t, UmiR166-29; miR166m, UmiR166-41; miR166z, k, h, UmiR166-49; miR166j, UmiR166-53; miR166u, UmiR166-62), while the representative of gma-miR166l (UmiR166-13) formed a branch with 26 UmiR166s in the Class I. The observation indicated that soybean miR166s are highly conserved among plant species.
[score:1]
Additionally, some evidences indicated that miR166 family might play crucial roles in response to abiotic and biotic stresses.
[score:1]
Percentage identity of all mature miR166 sequences (A) and their precursor sequences (B) in plant species.
[score:1]
Similarly, miR166 was induced by Phytophthora sojae infection in soybean, indicating that it may be implicated in soybean basal defense [19].
[score:1]
Thus, the stress-specific properties of MIR166 genes provided important clues for elucidating their functional specificity.
[score:1]
net); miR166 precursor sequences from soybean, Arabidopsis and rice were downloaded from the publicly available miRBase (www.
[score:1]
To estimate cluster numbers in soybean miR166 family, a maximal distance of 3 kb between two consecutive miR166s was used as a stringent criterion.
[score:1]
Fig. 2Phylogenetic analysis and alignment of miR166 family in soybean.
[score:1]
Colored lines indicate the linkage group with segmental duplicated MIR166 genes, and segmental duplication regions were determined using the Plant Genome Duplication Database It has been demonstrated previously that approximately 20% of plant miRNAs are clustered, and generally contain conserved miRNAs of the same family [32].
[score:1]
In the study, all the miR166s except miR166l were highly conserved in mature sequence, and identical mature sequence exists in each of the pre-miR166 paralogous pairs with exception of pre-miR166h and pre-miR166j (Fig. 2).
[score:1]
The chromosomal location image of soybean MIR166 genes was generated by the Circos software [51].
[score:1]
Also, it was proposed that the accumulation of mature miR166 reached its major peak at late cotyledonary embryo stage in larch, suggesting that it might be associated with cotyledon formation [36].
[score:1]
This results support the previous report that miR166 family displays the functional diversity and specificity in plants [24].
[score:1]
It has been documented that plant miR166s might be involved in response to diverse abiotic stresses, and main evidences were derived from the altered accumulation pattern of mature miR166 under diverse abiotic stresses.
[score:1]
Fig. 3Chromosomal localization and duplication of MIR166 family genes in soybean.
[score:1]
For instance, the accumulation of mature miR166 was decreased by drought stress in Sorghum bicolor [38], whereas drought stress led to increase of miRN166 accumulation in root and leaf of wheat [37].
[score:1]
Additionally, smaller than 1 of Ka/Ks values suggest that these MIR166 genes likely had undergone through a purifying selection with limited functional divergence after duplication.
[score:1]
Transcription start site of MIR166 genes in soybean.
[score:1]
Finally, the putative miRNAs were identified based on the following criteria [49]: 1) novel mature miR166 should be identical or nearly identical to one of known miR166s in plants; 2) the position of mature miRNA on the hairpin; 3) the maximum number of unpaired residues should be five between miRNA and miRNA*; 4) the maximum number of G_U pairs in miRNA should be 5; 5) the maximum size for a bulge in miRNA sequence should be 3 nt; 6) the negative minimal folding free energy (MFE) should be low; and 7) the minimal folding free energy index (MFEI) should be high.
[score:1]
Chromosome 6 has the largest number with four pre-miR166s, followed by chromosome 4 and 8 with three pre-miR166s, while two miR166s were distributed on chromosome 5, 7, 9, 10, 16, and one miR166 on chromosome 1, 2, 3, 15, 19 and 20.
[score:1]
However, the evolutionary conservation and functional diversification of miR166 family members in soybean remain poorly understood.
[score:1]
Maximum FPKM value for each MIR166 is shown Additionally, blast search against ESTs in NCBI database revealed that 12 pre-miR166s can perfectly match with one or more ESTs including nine gene-mapped pre-miR166s and three gene-unmapped pre-miR166s (Additional file 6: Table S3).
[score:1]
As shown in Fig. 4, nine pairs of MIR166 promoters can individually form a discrete clade in phylogenetic tree (MIR166d and MIR166f, MIR166m and MIR166u, MIR166e/q and MIR166o/v, MIR166p and MIR166t, MIR166b/x and MIR166n/y, MIR166k and MIR166z, MIR166i and MIR166j, MIR166a and MIR166c, MIR166h and MIR166r) and have similar motif composition in their promoter regions.
[score:1]
The soybean miR166 family consists of 21 members according to the miRBase database.
[score:1]
Phylogenetic relationship of MIR166 promoters is shown in left panel.
[score:1]
This study enlarged the size of soybean miR166 family from 21 to 26 members, and the 26 soybean miR166s exhibited evolutionary conservation and diversification.
[score:1]
Promoter analysis of MIR166 genes in soybean.
[score:1]
The phylogram of miR166 precursors revealed that 26 soybean pre-miR166s were grouped into three classes representing similarities and divergence.
[score:1]
microRNA166 (miR166) is a highly conserved family of miRNAs implicated in a wide range of cellular and physiological processes in plants.
[score:1]
The approximate distribution of each soybean MIR166 gene is marked on the circle with a short black line.
[score:1]
Promoter analysis of MIR166 family genes in soybean.
[score:1]
Eight sets of MIR166s were mapped on eight distinct duplicate blocks (Additional file 7: Table S4), including three newly identified miR166-containing blocks (MIR166v/o and MIR166e/q on the block 446, MIR166x/b and MIR166y/n on the block 571, MIR166z and MIR166k on the block 1447) and five previously known miR166-containing blocks (MIR166g and MIR166i on the block 210, MIR166s and MIR166t on the block 816, MIR166a and MIR166c on the block 867, MIR166h and MIR166j on the block 958, MIR166d and MIR166f on the block 1157).
[score:1]
It is interesting to note that ten pairs of miR166 precursors with high sequence identity (93.8% or higher), were individually grouped into discrete clades in the phylogenetic tree (Fig. 2a and Additional file 2: Figure S1), including three pairs containing the newly identified pre-miR166s (pre-miR166v and pre-miR166e, pre-miR166x and pre-miR166y, pre-miR166z and pre-miR166k) and seven previously known pre-miR166 pairs (pre-miR166b and pre-miR166n, pre-miR166a and pre-miR166c, pre-miR166s and pre-miR166t, pre-miR166d and pre-miR166f, pre-miR166g and pre-miR166i, pre-miR166h and pre-miR166j, pre-miR166o and pre-miR166q).
[score:1]
This study enlarged the size of soybean miR166 family from 21 to 26 members.
[score:1]
For promoter analysis, a 1,500 bp interval upstream of the transcription start site of MIR166 genes was analyzed in the PlantCARE database (http://bioinformatics.
[score:1]
As shown in Fig. 2a, ten pre-miR166 paralogous pairs with high sequence identity (93.8% or higher) were individually grouped into a discrete clade in the phylogenetic tree.
[score:1]
Colored lines indicate the linkage group with segmental duplicated MIR166 genes, and segmental duplication regions were determined using the Plant Genome Duplication Database It has been demonstrated previously that approximately 20% of plant miRNAs are clustered, and generally contain conserved miRNAs of the same family [32].
[score:1]
Nevertheless, emerging evidences indicate that functional specialization exists in miR166 family.
[score:1]
To investigate the expression patterns of MIR166 genes, we mined the publicly available transcript profiling data of soybean tissues at the Phytozome database (http://www.
[score:1]
Phylogenetic analyses of the 26 miR166s and their precursors indicated that soybean miR166 family exhibited both evolutionary conservation and diversification, and ten pairs of miR166 precursors with high sequence identity were individually grouped into a discrete clade in the phylogenetic tree.
[score:1]
To further understand the conservation and divergence of soybean miR166s, 63 unique mature miR166 sequences were isolated from miRBase (Release 21) and designated as UmiR166-1 to 63, respectively (Additional file 3: Table S2).
[score:1]
For example, pre-miR166p and pre-miR166l were situated in the UTR region of the UNAG KINASE gene and anti-sense strand of intron region of the CHAPERONIN gene, respectively.
[score:1]
Thus, the study enlarged the size of soybean miR166 family from 21 to 26 members.
[score:1]
Evidently, the existence of multiple copies of MIR166 genes contributes to the functional diversity and specificity of MIR166 gene family members in plants.
[score:1]
Maximum FPKM value for each MIR166 is shown Additionally, blast search against ESTs in NCBI database revealed that 12 pre-miR166s can perfectly match with one or more ESTs including nine gene-mapped pre-miR166s and three gene-unmapped pre-miR166s (Additional file 6: Table S3).
[score:1]
As a result, four miR166 clusters on the same DNA strand were identified in soybean (Fig. 3), and each cluster contained two copies of miR166 family members (pre-mir166v and pre-miR166o, pre-miR166x and pre-miR166b, pre-miR166y and pre-miR166n, pre-miR166e and pre-mir166q).
[score:1]
As shown in Fig. 9a, all the five newly identified MIR166 genes showed gradual increase in transcript accumulation as seeds developed, and reached the peak at 65 DAF.
[score:1]
Soybean harbors the largest miR166 family with 21 members in plant.
[score:1]
The analysis of genomic organization and evolution of MIR166 gene family revealed that eight segmental duplications and four tandem duplications might occur during evolution of the miR166 family in soybean.
[score:1]
As expected, the core promoter element TATA-box was observed in all the MIR166 promoter regions, while 18 out of 22 MIR166 genes contained CAAT-box, a common cis-acting element in promoter and enhancer regions.
[score:1]
Fig. 4Promoter analysis of MIR166 genes in soybean.
[score:1]
Segmental duplication events during evolution of MIR166 family genes in soybean.
[score:1]
Thus, the size of soybean miR166 family was enlarged from 21 to 26 members (Additional file 1: Table S1).
[score:1]
MIR166 gene family has large number of members in plant species, and at least 26 miR166 members exist in soybean.
[score:1]
Additionally, phylogenetic analysis revealed diversification of MIR166 gene family among Arabidopsis, rice and Physcomitrella patens, which laid a foundation for further exploration of the evolutionary and functional divergence of plant miRNAs [24].
[score:1]
miR166s are highly conserved in plants, and 262 miR166 species have been identified in 45 plant species according to the miRBase database (Release 21, June 2014).
[score:1]
In the study, the presence of stress-responsive elements in the promoter regions of MIR166 genes pointed to their possible roles under various stresses (Fig. 4).
[score:1]
The transcription start sites of MIR166 genes were predicted by TSSP software in Softberry (http://linux1.
[score:1]
[1 to 20 of 125 sentences]
|
2 |
[+]
score:
47
Other miRNAs from this paper: gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR159a, gma-MIR160a, gma-MIR166a, gma-MIR166b, gma-MIR167a, gma-MIR167b, gma-MIR168a, gma-MIR172a, gma-MIR172b, gma-MIR319a, gma-MIR319b, gma-MIR156a, gma-MIR396a, gma-MIR396b, gma-MIR319c, gma-MIR156b, gma-MIR159b, gma-MIR159c, gma-MIR167c, gma-MIR390a, gma-MIR390b, gma-MIR482a, gma-MIR1507a, gma-MIR1508a, gma-MIR1510a, gma-MIR1511, gma-MIR167d, gma-MIR396c, gma-MIR1507b, gma-MIR1508b, gma-MIR1510b, gma-MIR2109, gma-MIR167e, gma-MIR167f, gma-MIR172c, gma-MIR172d, gma-MIR172e, gma-MIR396d, gma-MIR482b, gma-MIR167g, gma-MIR156f, gma-MIR172f, gma-MIR4412, gma-MIR4413a, gma-MIR156g, gma-MIR159d, gma-MIR396e, gma-MIR156h, gma-MIR156i, gma-MIR160b, gma-MIR160c, gma-MIR160d, gma-MIR160e, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR168b, gma-MIR319d, gma-MIR319e, gma-MIR319f, gma-MIR390c, gma-MIR408d, gma-MIR482c, gma-MIR1507c, gma-MIR1508c, gma-MIR4998, gma-MIR167h, gma-MIR396f, gma-MIR396g, gma-MIR167i, gma-MIR5368, gma-MIR5371, gma-MIR395a, gma-MIR395b, gma-MIR395c, gma-MIR408a, gma-MIR408b, gma-MIR408c, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR159e, gma-MIR159f, gma-MIR166i, gma-MIR166j, gma-MIR172g, gma-MIR172h, gma-MIR172i, gma-MIR172j, gma-MIR319g, gma-MIR319h, gma-MIR319i, gma-MIR319j, gma-MIR319k, gma-MIR319l, gma-MIR319m, gma-MIR396h, gma-MIR396i, gma-MIR482d, gma-MIR4413b, gma-MIR167j, gma-MIR156p, gma-MIR172k, gma-MIR156q, gma-MIR172l, gma-MIR319n, gma-MIR156r, gma-MIR396j, gma-MIR156s, gma-MIR396k, gma-MIR166k, gma-MIR156t, gma-MIR482e, gma-MIR166l, gma-MIR395d, gma-MIR395e, gma-MIR395f, gma-MIR395g, gma-MIR166m, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR160f, gma-MIR166n, gma-MIR166o, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR390d, gma-MIR390e, gma-MIR390f, gma-MIR390g, gma-MIR395h, gma-MIR395i, gma-MIR395j, gma-MIR395k, gma-MIR395l, gma-MIR395m, gma-MIR319o, gma-MIR319p, gma-MIR167k, gma-MIR319q, gma-MIR167l
S2 FileqRT-PCR was used to verify the targets prediction at 8 and 16 h. (Fig A) The results of qRT-PCR validation of the targets of miR159e-3p and miR482b-3p at 8 h. (Fig B) The results of the qRT-PCR validation of the targets of miR1507 and miR1508 at 8 h. (Fig C) The results of the qRT-PCR validation of the targets of miR166 at 8 h. (Fig D) The results of the qRT-PCR validation of the targets of miR1510 at 8 h. (Fig E) The results of the qRT-PCR validation of the targets of miR4413 at 16 h. (Fig F) The results of the qRT-PCR validation of the targets of miR396 and miR159e-3p at 16 h. (Fig G) The results of the qRT-PCR validation of the targets of miR1508 and miR4413 (the expression of the two targets were much higher than other targets of miR4413).
[score:23]
In addition, the results of the present study revealed conserved miRNAs detected in other plants, such as miR166 (regulating shoot apical meristem and floral development in Arabidopsis) [63, 64], miR482 (in resistance to disease or abiotic stress via NBS-LRR proteins) [65], miR319 (affecting organ development and the processes of phase change in Arabidopsis) [46], miR160 (responses to the plant hormone auxin) [66], miR167 (involved in the floral organ formation) [27], miR390 (influence not only vegetative developmental transitions but also organ polarity in flowering plants) [67, 68], miR395 (regulating sulfate accumulation and allocation) [69], and miR408 (influenced through a variety of environmental conditions) [70, 71].
[score:8]
At 8 h, the expression of the targets of miR1507, miR1508, miR482, miR1510 and miR166 were increased under LDs, indicating that these miRNAs responded to day-length changes (Fig A-D in S2 File), and the miRNAs were inferred as negative regulators of flowering time in soybean.
[score:6]
The expression of four targets of miR166 at 8 h was verified through qRT-PCR (Fig C in S2 File).
[score:5]
MIR166/165 genes exhibit dynamic expression patterns in regulating shoot apical meristem and floral development in Arabidopsis.
[score:5]
[1 to 20 of 5 sentences]
|
3 |
[+]
score:
41
Other miRNAs from this paper: gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR166a, gma-MIR166b, gma-MIR167a, gma-MIR167b, gma-MIR168a, gma-MIR156a, gma-MIR396a, gma-MIR396b, gma-MIR156b, gma-MIR167c, gma-MIR1507a, gma-MIR1508a, gma-MIR1509a, gma-MIR167d, gma-MIR396c, gma-MIR1507b, gma-MIR1508b, gma-MIR167e, gma-MIR167f, gma-MIR1509b, gma-MIR396d, gma-MIR167g, gma-MIR156f, gma-MIR394b, gma-MIR156g, gma-MIR394a, gma-MIR396e, gma-MIR156h, gma-MIR156i, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR168b, gma-MIR394c, gma-MIR530a, gma-MIR1507c, gma-MIR1508c, gma-MIR167h, gma-MIR396f, gma-MIR396g, gma-MIR167i, gma-MIR395a, gma-MIR395b, gma-MIR395c, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR166i, gma-MIR166j, gma-MIR396h, gma-MIR396i, gma-MIR167j, gma-MIR530b, gma-MIR156p, gma-MIR530c, gma-MIR530d, gma-MIR156q, gma-MIR530e, gma-MIR394d, gma-MIR156r, gma-MIR396j, gma-MIR156s, gma-MIR396k, gma-MIR166k, gma-MIR156t, gma-MIR394e, gma-MIR166l, gma-MIR394f, gma-MIR395d, gma-MIR395e, gma-MIR395f, gma-MIR395g, gma-MIR166m, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR166n, gma-MIR166o, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR394g, gma-MIR395h, gma-MIR395i, gma-MIR395j, gma-MIR395k, gma-MIR395l, gma-MIR395m, gma-MIR167k, gma-MIR167l
Collectively, this suggests that miR394, miR396, miR1509, and miR2218 were up-regulated in the apical hook by FRc; In the hypocotyl, miR168, miR166, and miR1507 were down regulated and miR167 was up-regulated by FRc (Figure 5A; Table S6).
[score:8]
miR394, miR396, miR530, miR1509, and miR2218 were up-regulated by FRc in the hook concave region (Figure 5A), while miR166, miR394, miR396, miR1508, miR1509, and miR2218 were up-regulated by FRc in the hook convex region (Figure 5A).
[score:7]
In Arabidopsis, miR166 targets HD-ZIPIII genes which regulate many aspects of plant development, including shoot apical meristem architecture (Williams et al., 2005; Jung and Park, 2007), vascular patterning (Zhong and Ye, 2007), leaf polarity (Juarez et al., 2004; Nogueiral et al., 2007), and floral development (Jung and Park, 2007).
[score:6]
MIR166/165 genes exhibit dynamic expression patterns in regulating shoot apical meristem and floral development in Arabidopsis.
[score:5]
Our data also suggested, without confirmation, that two miRNAs, miR1508, and miR166, are up-regulated by FRc specifically in the hook convex region.
[score:4]
Interestingly, the comparison between the hook convex region and hook concave region of FRc treated seedlings showed that miR166 and miR1508 were expressed higher in the hook convex region than the hook concave region under FRc (Figure 5B; Table S7).
[score:3]
An induction of miR166 in response to FRc in the hook convex in our study may suggest miR166 and its target HD-ZIPIII genes are involved in the opening of apical hook.
[score:3]
For some of the microRNAs, e. g., miR166, miR167, and miR396, their mRNA targets have been well characterized to regulate plant growth and development (Williams et al., 2005; Wu et al., 2006; Jung and Park, 2007; Liu et al., 2009; Rodriguez et al., 2010).
[score:3]
Therefore, miR166 and miR1508 are likely induced by FRc only in the hook convex (Figure 6A).
[score:1]
Recently, miR166 was implicated in soybean Nematode defense (Li et al., 2012a).
[score:1]
[1 to 20 of 10 sentences]
|
4 |
[+]
score:
22
Other miRNAs from this paper: gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR159a, gma-MIR160a, gma-MIR166a, gma-MIR166b, gma-MIR167a, gma-MIR167b, gma-MIR168a, gma-MIR172a, gma-MIR172b, gma-MIR156a, gma-MIR396a, gma-MIR396b, gma-MIR398a, gma-MIR398b, gma-MIR156b, gma-MIR169a, gma-MIR159b, gma-MIR159c, gma-MIR164a, gma-MIR167c, gma-MIR169b, gma-MIR169c, gma-MIR171a, gma-MIR390a, gma-MIR390b, gma-MIR393a, gma-MIR171b, gma-MIR482a, gma-MIR1507a, gma-MIR1508a, gma-MIR1509a, gma-MIR1510a, gma-MIR1511, gma-MIR1512a, gma-MIR1514a, gma-MIR1514b, gma-MIR167d, gma-MIR396c, gma-MIR1507b, gma-MIR1508b, gma-MIR1510b, gma-MIR2109, gma-MIR2119, gma-MIR167e, gma-MIR167f, gma-MIR172c, gma-MIR172d, gma-MIR172e, gma-MIR1509b, gma-MIR4345, gma-MIR396d, gma-MIR4369, gma-MIR482b, gma-MIR167g, gma-MIR4397, gma-MIR156f, gma-MIR4409, gma-MIR169d, gma-MIR172f, gma-MIR171c, gma-MIR169e, gma-MIR394b, gma-MIR4413a, gma-MIR156g, gma-MIR159d, gma-MIR394a, gma-MIR396e, gma-MIR156h, gma-MIR156i, gma-MIR160b, gma-MIR160c, gma-MIR160d, gma-MIR160e, gma-MIR164b, gma-MIR164c, gma-MIR164d, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR168b, gma-MIR169f, gma-MIR169g, gma-MIR171d, gma-MIR171e, gma-MIR171f, gma-MIR171g, gma-MIR390c, gma-MIR394c, gma-MIR398c, gma-MIR408d, gma-MIR2118a, gma-MIR2118b, gma-MIR482c, gma-MIR1507c, gma-MIR1508c, gma-MIR171h, gma-MIR171i, gma-MIR169h, gma-MIR167h, gma-MIR169i, gma-MIR396f, gma-MIR396g, gma-MIR167i, gma-MIR5373, gma-MIR403a, gma-MIR403b, gma-MIR171j, gma-MIR395a, gma-MIR395b, gma-MIR395c, gma-MIR397a, gma-MIR397b, gma-MIR408a, gma-MIR408b, gma-MIR408c, gma-MIR3522, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR159e, gma-MIR159f, gma-MIR166i, gma-MIR166j, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR171k, gma-MIR172g, gma-MIR172h, gma-MIR172i, gma-MIR172j, gma-MIR396h, gma-MIR396i, gma-MIR482d, gma-MIR1512b, gma-MIR1513c, gma-MIR4413b, gma-MIR167j, gma-MIR171l, gma-MIR1512c, gma-MIR5767, gma-MIR5770a, gma-MIR393b, gma-MIR5781, gma-MIR5770b, gma-MIR399a, gma-MIR156p, gma-MIR171m, gma-MIR172k, gma-MIR171n, gma-MIR156q, gma-MIR171o, gma-MIR172l, gma-MIR169o, gma-MIR171p, gma-MIR394d, gma-MIR169p, gma-MIR156r, gma-MIR399b, gma-MIR396j, gma-MIR171q, gma-MIR156s, gma-MIR169r, gma-MIR169s, gma-MIR396k, gma-MIR166k, gma-MIR156t, gma-MIR482e, gma-MIR399c, gma-MIR171r, gma-MIR394e, gma-MIR399d, gma-MIR399e, gma-MIR169t, gma-MIR171s, gma-MIR166l, gma-MIR171t, gma-MIR394f, gma-MIR171u, gma-MIR399f, gma-MIR399g, gma-MIR395d, gma-MIR395e, gma-MIR395f, gma-MIR395g, gma-MIR166m, gma-MIR169u, gma-MIR399h, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR160f, gma-MIR164e, gma-MIR164f, gma-MIR164g, gma-MIR164h, gma-MIR164i, gma-MIR164j, gma-MIR164k, gma-MIR166n, gma-MIR166o, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR169v, gma-MIR390d, gma-MIR390e, gma-MIR390f, gma-MIR390g, gma-MIR393c, gma-MIR393d, gma-MIR393e, gma-MIR393f, gma-MIR393g, gma-MIR393h, gma-MIR393i, gma-MIR393j, gma-MIR393k, gma-MIR394g, gma-MIR395h, gma-MIR395i, gma-MIR395j, gma-MIR395k, gma-MIR395l, gma-MIR395m, gma-MIR398d, gma-MIR399i, gma-MIR167k, gma-MIR5770c, gma-MIR1446, gma-MIR167l, gma-MIR399j, gma-MIR399k, gma-MIR169w, gma-MIR399l, gma-MIR399m, gma-MIR399n, gma-MIR399o
On the other hand, miR166 and miR390 was downregulated by N deficiency [34] whereas these were upregulated under water stress (Additional file 2 and Table 2).
[score:7]
On the other hand Kulcheski et al. [9] have reported that miR166-5p, miR169f-3p, miR1513c, and miR397a,b, were upregulated in sensitive genotype BR16 while these were upregulated in tolerant Embarpa48.
[score:7]
miR156 regulates several SBP transcription factors and miR166 targets HD-ZIP transcription factors whereas miR1507, miR1509 and miR1510 largely found in legumes so far.
[score:4]
Among the highly conserved 23 miRNA families [23], two (miR156 and miR166) were classified as high, three (miR168, miR396 and miR172) as moderate and seven (miR169, miR171, miR164, miR390, miR159, miR160 and miR167) as low and two (miR395 and miR399) as extremely low abundantly expressed miRNA families in primary root tips of soybean.
[score:3]
Of the 171 miRNA families, five (miR156, miR166, miR1507, miR1509 and miR1510) were categorized as highly abundant.
[score:1]
[1 to 20 of 5 sentences]
|
5 |
[+]
score:
17
Other miRNAs from this paper: gma-MIR166a, gma-MIR166b, gma-MIR167a, gma-MIR167b, gma-MIR167c, gma-MIR1507a, gma-MIR167d, gma-MIR1507b, gma-MIR167e, gma-MIR167f, gma-MIR167g, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR1507c, gma-MIR167h, gma-MIR167i, gma-MIR166i, gma-MIR166j, gma-MIR167j, gma-MIR166k, gma-MIR166l, gma-MIR166m, gma-MIR399h, gma-MIR166n, gma-MIR166o, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR167k, gma-MIR167l, gma-MIR399k
During Se treatment, auxin response factor 8-like was upregulated while miR167 was downregulated; The expression of omeobox-leucine zipper protein HOX32-like, Class III HD-Zip protein, DNA (cytosine-5)-methyltransferase CMT3-like, F-box protein SKIP2-like protein was up-regulated by Se exposure but based on the degradome data, their targeting miRNAs, miR166, miR166i, miR399k, miR399h-5p, were down-regulated, respectively.
[score:17]
[1 to 20 of 1 sentences]
|
6 |
[+]
score:
16
Other miRNAs from this paper: gma-MIR166a, gma-MIR166b, gma-MIR172a, gma-MIR172b, gma-MIR319a, gma-MIR319b, gma-MIR319c, gma-MIR169a, gma-MIR159b, gma-MIR167c, gma-MIR169b, gma-MIR169c, gma-MIR171a, gma-MIR171b, gma-MIR172c, gma-MIR172d, gma-MIR172e, gma-MIR169d, gma-MIR172f, gma-MIR171c, gma-MIR169e, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR169f, gma-MIR169g, gma-MIR171d, gma-MIR171e, gma-MIR171f, gma-MIR171g, gma-MIR319d, gma-MIR319e, gma-MIR319f, gma-MIR171h, gma-MIR171i, gma-MIR169h, gma-MIR169i, gma-MIR171j, gma-MIR397a, gma-MIR397b, gma-MIR166i, gma-MIR166j, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR171k, gma-MIR172g, gma-MIR172h, gma-MIR172i, gma-MIR172j, gma-MIR319g, gma-MIR319h, gma-MIR319i, gma-MIR319j, gma-MIR319k, gma-MIR319l, gma-MIR319m, gma-MIR171l, gma-MIR2111a, gma-MIR399a, gma-MIR171m, gma-MIR172k, gma-MIR171n, gma-MIR171o, gma-MIR172l, gma-MIR169o, gma-MIR319n, gma-MIR171p, gma-MIR169p, gma-MIR399b, gma-MIR171q, gma-MIR169r, gma-MIR169s, gma-MIR2111b, gma-MIR2111c, gma-MIR166k, gma-MIR2111d, gma-MIR399c, gma-MIR171r, gma-MIR399d, gma-MIR399e, gma-MIR169t, gma-MIR171s, gma-MIR166l, gma-MIR171t, gma-MIR2111e, gma-MIR2111f, gma-MIR171u, gma-MIR399f, gma-MIR399g, gma-MIR166m, gma-MIR169u, gma-MIR399h, gma-MIR166n, gma-MIR166o, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR169v, gma-MIR319o, gma-MIR319p, gma-MIR399i, gma-MIR319q, gma-MIR399j, gma-MIR399k, gma-MIR169w, gma-MIR399l, gma-MIR399m, gma-MIR399n, gma-MIR399o
The reported targets of miR166 are PHB (At2g34710) and ATHB-8 (At4g32880), which are down-regulated by cold exposure [8].
[score:6]
miR166 is predicted to target homeodomain (HD)-ZIP transcription factors, and the target sites are conserved in Arabidopsis, rice, Brachypodium, maize and Populus [9, 10, 13, 49, 57, 58].
[score:5]
Among the eleven cold-responsive miRNAs we identified, four (miR166, miR171, miR2111 and miR169) are highly conserved in higher plants, and these miRNAs have been shown to regulate plant cold responses [8, 10, 11, 48, 49].
[score:2]
Thus, multiple miRNAs, including miR166, miR171, miR2111 and miR397, are required for nodule development, nitrogenase activity and nitrogen fixation efficiency control in nodules and in the adaptation of plants to adverse environmental conditions.
[score:2]
Notably, previous studies have shown that miR166, miR171, miR2111 and miR397 are involved in nodulation in the legumes, Medicago and Lotus [52, 53, 54, 55].
[score:1]
[1 to 20 of 5 sentences]
|
7 |
[+]
score:
15
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR398a, osa-MIR398b, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR160e, osa-MIR160f, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR172d, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, osa-MIR396e, gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR159a, gma-MIR160a, gma-MIR166a, gma-MIR166b, gma-MIR167a, gma-MIR167b, gma-MIR168a, gma-MIR172a, gma-MIR172b, gma-MIR156a, gma-MIR396a, gma-MIR396b, gma-MIR398a, gma-MIR398b, gma-MIR156b, gma-MIR169a, osa-MIR169r, gma-MIR159b, gma-MIR159c, gma-MIR164a, gma-MIR167c, gma-MIR169b, gma-MIR169c, gma-MIR1514a, gma-MIR1514b, gma-MIR1536, gma-MIR1530, osa-MIR396f, gma-MIR167d, gma-MIR396c, gma-MIR167e, gma-MIR167f, gma-MIR172c, gma-MIR172d, gma-MIR172e, osa-MIR2118a, osa-MIR2118b, osa-MIR2118c, osa-MIR2118d, osa-MIR2118e, osa-MIR2118f, osa-MIR2118g, osa-MIR2118h, osa-MIR2118i, osa-MIR2118j, osa-MIR2118k, osa-MIR2118l, osa-MIR2118m, osa-MIR2118n, osa-MIR2118o, osa-MIR2118p, osa-MIR2118q, osa-MIR2118r, osa-MIR396g, osa-MIR396h, osa-MIR396d, gma-MIR396d, gma-MIR167g, gma-MIR156f, gma-MIR169d, gma-MIR172f, gma-MIR169e, gma-MIR156g, gma-MIR159d, gma-MIR396e, gma-MIR156h, gma-MIR156i, gma-MIR160b, gma-MIR160c, gma-MIR160d, gma-MIR160e, gma-MIR164b, gma-MIR164c, gma-MIR164d, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR168b, gma-MIR169f, gma-MIR169g, gma-MIR398c, gma-MIR2118a, gma-MIR2118b, gma-MIR169h, gma-MIR167h, gma-MIR169i, gma-MIR396f, gma-MIR396g, gma-MIR167i, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR159e, gma-MIR159f, gma-MIR166i, gma-MIR166j, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR172g, gma-MIR172h, gma-MIR172i, gma-MIR172j, gma-MIR396h, gma-MIR396i, gma-MIR167j, gma-MIR156p, gma-MIR172k, gma-MIR156q, gma-MIR172l, gma-MIR169o, gma-MIR169p, gma-MIR156r, gma-MIR396j, gma-MIR156s, gma-MIR169r, gma-MIR169s, gma-MIR396k, gma-MIR166k, gma-MIR156t, gma-MIR169t, gma-MIR166l, gma-MIR166m, gma-MIR169u, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR160f, gma-MIR164e, gma-MIR164f, gma-MIR164g, gma-MIR164h, gma-MIR164i, gma-MIR164j, gma-MIR164k, gma-MIR166n, gma-MIR166o, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR169v, gma-MIR398d, gma-MIR167k, gma-MIR167l, gma-MIR169w
It should be noted that many targets of a single conserved miRNA are in pairs with very similar sequences, and the gma-miR156, gma-miR160, gma-miR164, gma-miR166, gma-miR172 and gma-miR396 had at least 10 targets, with the gma-miR396 having more than 20 targets (Table 3).
[score:7]
Figure 5 Validation of gma-miR166 targets matched by identical reads.
[score:3]
For gma-miR166, 7 targets were matched by identical reads (Table 3).
[score:3]
Three genes, Glyma13640, Glyma6g09100 and Glyma08g21610, were found to be cleaved by gma-miRNA166 after sequencing 6, 10 and 4 clones, respectively (Figure 5).
[score:1]
One gene (Glyma07g01950) could not be confirmed to be cleaved by gma-miR166.
[score:1]
[1 to 20 of 5 sentences]
|
8 |
[+]
score:
13
Other miRNAs from this paper: gma-MIR159a, gma-MIR160a, gma-MIR166a, gma-MIR166b, gma-MIR167a, gma-MIR167b, gma-MIR168a, gma-MIR172a, gma-MIR172b, gma-MIR319a, gma-MIR319b, gma-MIR396a, gma-MIR396b, gma-MIR319c, gma-MIR169a, gma-MIR159b, gma-MIR159c, gma-MIR162a, gma-MIR164a, gma-MIR167c, gma-MIR169b, gma-MIR169c, gma-MIR171a, gma-MIR390a, gma-MIR390b, gma-MIR393a, gma-MIR171b, gma-MIR482a, gma-MIR1507a, gma-MIR1509a, gma-MIR1510a, gma-MIR167d, gma-MIR396c, gma-MIR1507b, gma-MIR1510b, gma-MIR167e, gma-MIR167f, gma-MIR172c, gma-MIR172d, gma-MIR172e, gma-MIR1509b, gma-MIR396d, gma-MIR482b, gma-MIR167g, gma-MIR169d, gma-MIR172f, gma-MIR171c, gma-MIR169e, gma-MIR159d, gma-MIR396e, gma-MIR160b, gma-MIR160c, gma-MIR160d, gma-MIR160e, gma-MIR162b, gma-MIR164b, gma-MIR164c, gma-MIR164d, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR168b, gma-MIR169f, gma-MIR169g, gma-MIR171d, gma-MIR171e, gma-MIR171f, gma-MIR171g, gma-MIR319d, gma-MIR319e, gma-MIR319f, gma-MIR482c, gma-MIR1507c, gma-MIR171h, gma-MIR171i, gma-MIR169h, gma-MIR167h, gma-MIR169i, gma-MIR396f, gma-MIR396g, gma-MIR167i, gma-MIR171j, gma-MIR397a, gma-MIR397b, gma-MIR159e, gma-MIR159f, gma-MIR162c, gma-MIR166i, gma-MIR166j, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR171k, gma-MIR172g, gma-MIR172h, gma-MIR172i, gma-MIR172j, gma-MIR319g, gma-MIR319h, gma-MIR319i, gma-MIR319j, gma-MIR319k, gma-MIR319l, gma-MIR319m, gma-MIR396h, gma-MIR396i, gma-MIR482d, gma-MIR167j, gma-MIR171l, gma-MIR393b, gma-MIR171m, gma-MIR172k, gma-MIR171n, gma-MIR171o, gma-MIR172l, gma-MIR169o, gma-MIR319n, gma-MIR171p, gma-MIR169p, gma-MIR396j, gma-MIR171q, gma-MIR169r, gma-MIR169s, gma-MIR396k, gma-MIR166k, gma-MIR482e, gma-MIR171r, gma-MIR169t, gma-MIR171s, gma-MIR166l, gma-MIR171t, gma-MIR171u, gma-MIR166m, gma-MIR169u, gma-MIR160f, gma-MIR164e, gma-MIR164f, gma-MIR164g, gma-MIR164h, gma-MIR164i, gma-MIR164j, gma-MIR164k, gma-MIR166n, gma-MIR166o, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR169v, gma-MIR393c, gma-MIR393d, gma-MIR393e, gma-MIR393f, gma-MIR393g, gma-MIR393h, gma-MIR393i, gma-MIR393j, gma-MIR393k, gma-MIR319o, gma-MIR319p, gma-MIR167k, gma-MIR319q, gma-MIR167l, gma-MIR169w
For example, transient up regulation of miR172 (Figure 5) which regulates a putative Apetala2-like transcription factor, down-regulation of miR166 and miR396 (Figure 5) targeting an HD-ZIPIII-like transcription factor and a cysteine protease respectively are potentially novel regulatory elements during nodulation.
[score:9]
The targets of miR166 and miR393 are well-conserved in other species.
[score:3]
UGCCUGGCUCCCUGAAUGCCA 21 H, N (21 nt) 162 gma-MIR162 UCGAUAAACCUCUGCAUCCA 20 H, P 164 gma-MIR164 UGGAGAAGCAGGGCACGUGCA 21 H, P, N (21 nt) 166 gma-MIR166a,b UCGGACCAGGCUUCAUUCCCC 21 H gma-MIR166?
[score:1]
[1 to 20 of 3 sentences]
|
9 |
[+]
score:
11
Other miRNAs from this paper: gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR166a, gma-MIR166b, gma-MIR168a, gma-MIR172a, gma-MIR172b, gma-MIR319a, gma-MIR319b, gma-MIR156a, gma-MIR396a, gma-MIR396b, gma-MIR319c, gma-MIR156b, gma-MIR390a, gma-MIR390b, gma-MIR482a, gma-MIR1507a, gma-MIR1510a, gma-MIR1511, gma-MIR1516a, gma-MIR396c, gma-MIR1507b, gma-MIR1510b, gma-MIR172c, gma-MIR172d, gma-MIR172e, gma-MIR396d, gma-MIR4374b, gma-MIR482b, gma-MIR156f, gma-MIR4401a, gma-MIR172f, gma-MIR156g, gma-MIR396e, gma-MIR156h, gma-MIR156i, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR168b, gma-MIR319d, gma-MIR319e, gma-MIR319f, gma-MIR390c, gma-MIR398c, gma-MIR482c, gma-MIR1507c, gma-MIR396f, gma-MIR396g, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR166i, gma-MIR166j, gma-MIR172g, gma-MIR172h, gma-MIR172i, gma-MIR172j, gma-MIR319g, gma-MIR319h, gma-MIR319i, gma-MIR319j, gma-MIR319k, gma-MIR319l, gma-MIR319m, gma-MIR396h, gma-MIR396i, gma-MIR482d, gma-MIR156p, gma-MIR172k, gma-MIR156q, gma-MIR172l, gma-MIR319n, gma-MIR156r, gma-MIR396j, gma-MIR156s, gma-MIR396k, gma-MIR166k, gma-MIR156t, gma-MIR482e, gma-MIR166l, gma-MIR166m, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR166n, gma-MIR166o, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR390d, gma-MIR390e, gma-MIR390f, gma-MIR390g, gma-MIR319o, gma-MIR319p, gma-MIR319q
Compared to A3244, all ten of the differentially expressed gma-miRNAs in MON89788 were down-regulated, including the members of miR1507, miR1510, miR166, miR319, miR390, miR396 and miR482 families.
[score:5]
As a result, ten gma-miRNAs were down-regulated in MON89788 compared with A3244 soybeans, including mature members of the miR1507, miR1510, miR166, miR319, miR390, miR396 and miR482 families.
[score:3]
miR166 has been reported to regulate the homeodomain leucine zipper (HD-ZIP) gene, which might play significant roles in seedling development [49].
[score:3]
[1 to 20 of 3 sentences]
|
10 |
[+]
score:
10
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR162a, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR171a, osa-MIR393a, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397a, osa-MIR398a, osa-MIR398b, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR319b, osa-MIR160e, osa-MIR160f, osa-MIR162b, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR393b, osa-MIR408, osa-MIR172d, osa-MIR171i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, osa-MIR390, osa-MIR396e, gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR159a, gma-MIR160a, gma-MIR166a, gma-MIR166b, gma-MIR167a, gma-MIR167b, gma-MIR168a, gma-MIR172a, gma-MIR172b, gma-MIR319a, gma-MIR319b, gma-MIR156a, gma-MIR396a, gma-MIR396b, gma-MIR398a, gma-MIR398b, gma-MIR319c, gma-MIR156b, gma-MIR169a, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR169r, gma-MIR159b, gma-MIR159c, gma-MIR162a, gma-MIR164a, gma-MIR167c, gma-MIR169b, gma-MIR169c, gma-MIR171a, gma-MIR390a, gma-MIR390b, gma-MIR393a, gma-MIR171b, gma-MIR482a, gma-MIR1507a, gma-MIR1508a, gma-MIR1509a, gma-MIR1510a, gma-MIR1511, gma-MIR1512a, gma-MIR1515a, osa-MIR827, osa-MIR396f, gma-MIR167d, gma-MIR396c, gma-MIR1507b, gma-MIR1510b, gma-MIR2109, gma-MIR167e, gma-MIR167f, gma-MIR172c, gma-MIR172d, gma-MIR172e, gma-MIR1509b, osa-MIR2118a, osa-MIR2118b, osa-MIR2118c, osa-MIR2118d, osa-MIR2118e, osa-MIR2118f, osa-MIR2118g, osa-MIR2118h, osa-MIR2118i, osa-MIR2118j, osa-MIR2118k, osa-MIR2118l, osa-MIR2118m, osa-MIR2118n, osa-MIR2118o, osa-MIR2118p, osa-MIR2118q, osa-MIR2118r, osa-MIR396g, osa-MIR396h, osa-MIR396d, osa-MIR395x, osa-MIR395y, gma-MIR396d, gma-MIR482b, gma-MIR167g, gma-MIR156f, gma-MIR169d, gma-MIR172f, gma-MIR171c, gma-MIR169e, gma-MIR156g, gma-MIR159d, gma-MIR4416a, gma-MIR396e, gma-MIR156h, gma-MIR156i, gma-MIR160b, gma-MIR160c, gma-MIR160d, gma-MIR160e, gma-MIR162b, gma-MIR164b, gma-MIR164c, gma-MIR164d, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR168b, gma-MIR169f, gma-MIR169g, gma-MIR171d, gma-MIR171e, gma-MIR171f, gma-MIR171g, gma-MIR319d, gma-MIR319e, gma-MIR319f, gma-MIR390c, gma-MIR398c, gma-MIR408d, gma-MIR2118a, gma-MIR2118b, gma-MIR482c, gma-MIR1507c, gma-MIR171h, gma-MIR171i, gma-MIR169h, gma-MIR167h, gma-MIR169i, gma-MIR396f, gma-MIR396g, gma-MIR167i, gma-MIR171j, gma-MIR395a, gma-MIR395b, gma-MIR395c, gma-MIR397a, gma-MIR408a, gma-MIR408b, gma-MIR408c, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR159e, gma-MIR159f, gma-MIR162c, gma-MIR166i, gma-MIR166j, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR171k, gma-MIR172g, gma-MIR172h, gma-MIR172i, gma-MIR172j, gma-MIR319g, gma-MIR319h, gma-MIR319i, gma-MIR319j, gma-MIR319k, gma-MIR319l, gma-MIR319m, gma-MIR396h, gma-MIR396i, gma-MIR482d, gma-MIR1512b, gma-MIR167j, gma-MIR171l, gma-MIR2111a, gma-MIR1512c, gma-MIR393b, gma-MIR399a, gma-MIR156p, gma-MIR171m, gma-MIR172k, gma-MIR171n, gma-MIR156q, gma-MIR171o, gma-MIR172l, gma-MIR169o, gma-MIR319n, gma-MIR171p, gma-MIR169p, gma-MIR156r, gma-MIR399b, gma-MIR396j, gma-MIR171q, gma-MIR156s, gma-MIR169r, gma-MIR169s, gma-MIR396k, gma-MIR2111b, gma-MIR2111c, gma-MIR166k, gma-MIR2111d, gma-MIR156t, gma-MIR482e, gma-MIR399c, gma-MIR171r, gma-MIR399d, gma-MIR399e, gma-MIR169t, gma-MIR171s, gma-MIR166l, gma-MIR171t, gma-MIR2111e, gma-MIR2111f, gma-MIR171u, gma-MIR399f, gma-MIR399g, gma-MIR395d, gma-MIR395e, gma-MIR395f, gma-MIR395g, gma-MIR166m, gma-MIR169u, gma-MIR399h, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR160f, gma-MIR164e, gma-MIR164f, gma-MIR164g, gma-MIR164h, gma-MIR164i, gma-MIR164j, gma-MIR164k, gma-MIR166n, gma-MIR166o, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR169v, gma-MIR390d, gma-MIR390e, gma-MIR390f, gma-MIR390g, gma-MIR393c, gma-MIR393d, gma-MIR393e, gma-MIR393f, gma-MIR393g, gma-MIR393h, gma-MIR393i, gma-MIR393j, gma-MIR393k, gma-MIR395h, gma-MIR395i, gma-MIR395j, gma-MIR395k, gma-MIR395l, gma-MIR395m, gma-MIR1515b, gma-MIR398d, gma-MIR319o, gma-MIR319p, gma-MIR399i, gma-MIR167k, gma-MIR319q, gma-MIR167l, gma-MIR399j, gma-MIR399k, gma-MIR169w, gma-MIR399l, gma-MIR399m, gma-MIR399n, gma-MIR399o
For example, expression levels of miR156 family members ranged from 46 to 66744 TPM in leaves, and from 0.01 (actually 0, only for normalization) to 22303 TPM in roots, and expression levels of miR166 family members ranged from from 48 to 16705 TPM in leaves, and from 12 to 20693 TPM in roots (Table 3).
[score:5]
It was reported that five conserved miRNAs (miR159, miR162, miR166, miR390, and miR399) presented similar expression levels in root apexes and nodules, but miR169, miR171, miR393, and miR396 enriched in root tips [41].
[score:3]
Consistently, four HD-ZIP transcription factors were predicted to be cleaved by miR166 family miRNAs (Additional file 7).
[score:1]
In addition, 11 miR166s were identified for the first time (Table 3), indicating that miR166 is also a very big miRNA family in soybean.
[score:1]
[1 to 20 of 4 sentences]
|
11 |
[+]
score:
8
Other miRNAs from this paper: gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR160a, gma-MIR166a, gma-MIR166b, gma-MIR167a, gma-MIR167b, gma-MIR172b, gma-MIR319a, gma-MIR319b, gma-MIR156a, gma-MIR398a, gma-MIR398b, gma-MIR319c, gma-MIR156b, gma-MIR162a, gma-MIR167c, gma-MIR171a, gma-MIR393a, gma-MIR171b, gma-MIR482a, gma-MIR1507a, gma-MIR1517, gma-MIR1520d, gma-MIR1520c, gma-MIR167d, gma-MIR1507b, gma-MIR1508b, gma-MIR167e, gma-MIR167f, gma-MIR172d, gma-MIR4341, gma-MIR4361, gma-MIR1520j, gma-MIR4369, gma-MIR4374b, gma-MIR482b, gma-MIR1520n, gma-MIR4387a, gma-MIR167g, gma-MIR4396, gma-MIR4397, gma-MIR1520r, gma-MIR4399, gma-MIR156f, gma-MIR4407, gma-MIR169d, gma-MIR156g, gma-MIR394a, gma-MIR156h, gma-MIR156i, gma-MIR162b, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR169g, gma-MIR319d, gma-MIR319e, gma-MIR319f, gma-MIR398c, gma-MIR408d, gma-MIR482c, gma-MIR1507c, gma-MIR167h, gma-MIR167i, gma-MIR395a, gma-MIR395b, gma-MIR395c, gma-MIR397b, gma-MIR408a, gma-MIR408b, gma-MIR408c, gma-MIR3522, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR162c, gma-MIR166i, gma-MIR166j, gma-MIR319g, gma-MIR319h, gma-MIR319i, gma-MIR319j, gma-MIR319k, gma-MIR319l, gma-MIR319m, gma-MIR482d, gma-MIR167j, gma-MIR393b, gma-MIR156p, gma-MIR156q, gma-MIR319n, gma-MIR156r, gma-MIR156s, gma-MIR166k, gma-MIR156t, gma-MIR482e, gma-MIR166l, gma-MIR395d, gma-MIR395e, gma-MIR395f, gma-MIR395g, gma-MIR166m, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR166n, gma-MIR166o, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR393c, gma-MIR393d, gma-MIR393e, gma-MIR393f, gma-MIR393g, gma-MIR393h, gma-MIR393i, gma-MIR393j, gma-MIR393k, gma-MIR395h, gma-MIR395i, gma-MIR395j, gma-MIR395k, gma-MIR395l, gma-MIR395m, gma-MIR398d, gma-MIR319o, gma-MIR319p, gma-MIR167k, gma-MIR319q, gma-MIR167l
Moreover, miR166 is responsive to dehydration stress in barley [44], and it is abundant and up-regulated in soybean seedlings under dehydration conditions.
[score:4]
Three abundant miRNA reads (miR166, miR1507, and miR3522) occupied 79.47% of expressed miRNA tags on average (Figure 2, Additional file 4 and Additional file 5).
[score:3]
Especially those present in high abundance, such as miR156, miR166, and miR167.
[score:1]
[1 to 20 of 3 sentences]
|
12 |
[+]
score:
6
Other miRNAs from this paper: ath-MIR156a, ath-MIR156b, ath-MIR156c, ath-MIR156d, ath-MIR156e, ath-MIR156f, ath-MIR166a, ath-MIR166b, ath-MIR166c, ath-MIR166d, ath-MIR166e, ath-MIR166f, ath-MIR166g, ath-MIR169a, ath-MIR171a, ath-MIR169b, ath-MIR169c, ath-MIR169d, ath-MIR169e, ath-MIR169f, ath-MIR169g, ath-MIR169h, ath-MIR169i, ath-MIR169j, ath-MIR169k, ath-MIR169l, ath-MIR169m, ath-MIR169n, ath-MIR171b, ath-MIR171c, ath-MIR395a, ath-MIR395b, ath-MIR395c, ath-MIR395d, ath-MIR395e, ath-MIR395f, ath-MIR396a, ath-MIR396b, ath-MIR399a, ath-MIR408, ath-MIR156g, ath-MIR156h, gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR166a, gma-MIR166b, gma-MIR156a, gma-MIR396a, gma-MIR396b, gma-MIR156b, gma-MIR169a, ath-MIR848, gma-MIR169b, gma-MIR169c, gma-MIR171a, gma-MIR171b, gma-MIR1527, gma-MIR1533, gma-MIR396c, pvu-MIR166a, pvu-MIR399a, gma-MIR396d, gma-MIR156f, gma-MIR169d, gma-MIR171c, gma-MIR169e, gma-MIR156g, gma-MIR396e, gma-MIR156h, gma-MIR156i, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR169f, gma-MIR169g, gma-MIR171d, gma-MIR171e, gma-MIR171f, gma-MIR171g, gma-MIR408d, ath-MIR5021, gma-MIR171h, gma-MIR171i, gma-MIR169h, gma-MIR169i, gma-MIR396f, gma-MIR396g, gma-MIR171j, gma-MIR395a, gma-MIR395b, gma-MIR395c, gma-MIR408a, gma-MIR408b, gma-MIR408c, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR166i, gma-MIR166j, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR171k, gma-MIR396h, gma-MIR396i, gma-MIR171l, ath-MIR156i, ath-MIR156j, gma-MIR399a, gma-MIR156p, gma-MIR171m, gma-MIR171n, gma-MIR156q, gma-MIR171o, gma-MIR169o, gma-MIR171p, gma-MIR169p, gma-MIR156r, gma-MIR396j, gma-MIR171q, gma-MIR156s, gma-MIR169r, gma-MIR169s, gma-MIR396k, gma-MIR166k, gma-MIR156t, gma-MIR171r, gma-MIR169t, gma-MIR171s, gma-MIR166l, gma-MIR171t, gma-MIR171u, gma-MIR395d, gma-MIR395e, gma-MIR395f, gma-MIR395g, gma-MIR166m, gma-MIR169u, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR166n, gma-MIR166o, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR169v, gma-MIR395h, gma-MIR395i, gma-MIR395j, gma-MIR395k, gma-MIR395l, gma-MIR395m, gma-MIR169w
In the present study pvu-miR166d was predicted to target kinase mRNA, which is in agreement with the reported target kinase for miR166 family in soybean [67].
[score:5]
Among these miRNAs, the miR166 family had the most number of reads.
[score:1]
[1 to 20 of 2 sentences]
|
13 |
[+]
score:
6
Other miRNAs from this paper: mtr-MIR162, mtr-MIR166a, mtr-MIR169a, mtr-MIR399b, mtr-MIR399d, mtr-MIR395a, mtr-MIR395b, mtr-MIR399c, mtr-MIR399a, mtr-MIR399e, mtr-MIR319a, mtr-MIR156a, mtr-MIR171a, gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR166a, gma-MIR166b, gma-MIR168a, gma-MIR172a, gma-MIR172b, gma-MIR319a, gma-MIR319b, gma-MIR156a, gma-MIR398a, gma-MIR398b, gma-MIR319c, gma-MIR156b, gma-MIR169a, mtr-MIR395c, mtr-MIR395d, mtr-MIR395e, mtr-MIR395f, mtr-MIR395g, mtr-MIR395h, mtr-MIR395i, mtr-MIR395j, mtr-MIR395l, mtr-MIR395m, mtr-MIR395n, mtr-MIR395o, mtr-MIR395k, mtr-MIR156b, mtr-MIR164a, mtr-MIR166b, mtr-MIR169c, mtr-MIR169d, mtr-MIR169e, mtr-MIR171b, mtr-MIR166c, mtr-MIR166d, mtr-MIR169f, mtr-MIR156c, mtr-MIR156d, mtr-MIR390, mtr-MIR399f, mtr-MIR399g, mtr-MIR399h, mtr-MIR399i, mtr-MIR399j, mtr-MIR399k, mtr-MIR166e, mtr-MIR156e, mtr-MIR319b, mtr-MIR171c, mtr-MIR398a, mtr-MIR172a, mtr-MIR398b, mtr-MIR168a, mtr-MIR169g, mtr-MIR156f, mtr-MIR399l, mtr-MIR156g, mtr-MIR399m, mtr-MIR399n, mtr-MIR399o, mtr-MIR398c, mtr-MIR164b, mtr-MIR156h, mtr-MIR166f, mtr-MIR164c, mtr-MIR164d, mtr-MIR166g, mtr-MIR171d, mtr-MIR171e, mtr-MIR169h, mtr-MIR169b, mtr-MIR156i, mtr-MIR171f, mtr-MIR399p, gma-MIR162a, gma-MIR164a, gma-MIR169b, gma-MIR169c, gma-MIR171a, gma-MIR390a, gma-MIR390b, gma-MIR171b, gma-MIR482a, gma-MIR1507a, gma-MIR1509a, gma-MIR1511, gma-MIR1512a, gma-MIR1515a, gma-MIR1521a, mtr-MIR1507, mtr-MIR1509a, gma-MIR1507b, gma-MIR2109, gma-MIR172c, gma-MIR172d, gma-MIR172e, gma-MIR1509b, mtr-MIR2118, mtr-MIR169k, mtr-MIR2111c, mtr-MIR2111d, mtr-MIR2111e, mtr-MIR2111g, mtr-MIR2111h, mtr-MIR2111i, mtr-MIR2111m, mtr-MIR2111n, mtr-MIR2111o, mtr-MIR169j, mtr-MIR1509b, mtr-MIR2111b, mtr-MIR2111j, mtr-MIR2111k, mtr-MIR399q, mtr-MIR2678, lja-MIR2111, gma-MIR482b, gma-MIR156f, gma-MIR169d, gma-MIR172f, gma-MIR171c, gma-MIR169e, gma-MIR156g, gma-MIR4416a, gma-MIR156h, gma-MIR156i, gma-MIR162b, gma-MIR164b, gma-MIR164c, gma-MIR164d, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR168b, gma-MIR169f, gma-MIR169g, gma-MIR171d, gma-MIR171e, gma-MIR171f, gma-MIR171g, gma-MIR319d, gma-MIR319e, gma-MIR319f, gma-MIR390c, gma-MIR398c, gma-MIR408d, gma-MIR2118a, gma-MIR2118b, gma-MIR482c, gma-MIR530a, gma-MIR862a, gma-MIR1507c, gma-MIR171h, gma-MIR171i, gma-MIR169h, gma-MIR1521b, gma-MIR169i, mtr-MIR5204, mtr-MIR5213, mtr-MIR482, mtr-MIR2111l, mtr-MIR2111f, mtr-MIR172b, mtr-MIR172c, mtr-MIR171h, mtr-MIR168b, mtr-MIR399r, mtr-MIR156j, gma-MIR862b, gma-MIR403a, gma-MIR403b, gma-MIR171j, gma-MIR395a, gma-MIR395b, gma-MIR395c, gma-MIR397a, gma-MIR397b, gma-MIR408a, gma-MIR408b, gma-MIR408c, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR162c, gma-MIR166i, gma-MIR166j, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR171k, gma-MIR172g, gma-MIR172h, gma-MIR172i, gma-MIR172j, gma-MIR319g, gma-MIR319h, gma-MIR319i, gma-MIR319j, gma-MIR319k, gma-MIR319l, gma-MIR319m, gma-MIR482d, gma-MIR1512b, gma-MIR171l, mtr-MIR168c, mtr-MIR408, mtr-MIR2111a, gma-MIR2111a, gma-MIR1512c, gma-MIR530b, mtr-MIR171g, mtr-MIR530, gma-MIR4416b, gma-MIR399a, gma-MIR828a, gma-MIR156p, gma-MIR530c, gma-MIR828b, gma-MIR530d, gma-MIR171m, gma-MIR172k, gma-MIR171n, gma-MIR156q, gma-MIR171o, gma-MIR172l, gma-MIR169o, gma-MIR319n, gma-MIR171p, gma-MIR530e, gma-MIR169p, gma-MIR156r, gma-MIR399b, gma-MIR171q, gma-MIR156s, gma-MIR169r, gma-MIR169s, gma-MIR2111b, gma-MIR2111c, gma-MIR166k, gma-MIR2111d, gma-MIR156t, gma-MIR482e, gma-MIR399c, gma-MIR171r, gma-MIR399d, gma-MIR399e, gma-MIR169t, gma-MIR171s, gma-MIR166l, gma-MIR171t, gma-MIR2111e, gma-MIR2111f, gma-MIR171u, gma-MIR399f, gma-MIR399g, gma-MIR395d, gma-MIR395e, gma-MIR395f, gma-MIR395g, gma-MIR166m, gma-MIR169u, gma-MIR399h, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR164e, gma-MIR164f, gma-MIR164g, gma-MIR164h, gma-MIR164i, gma-MIR164j, gma-MIR164k, gma-MIR166n, gma-MIR166o, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR169v, gma-MIR390d, gma-MIR390e, gma-MIR390f, gma-MIR390g, gma-MIR395h, gma-MIR395i, gma-MIR395j, gma-MIR395k, gma-MIR395l, gma-MIR395m, gma-MIR1515b, lja-MIR171a, lja-MIR171b, lja-MIR171c, lja-MIR171d, lja-MIR172a, lja-MIR172b, lja-MIR172c, lja-MIR390a, lja-MIR390b, lja-MIR397, lja-MIR408, lja-MIR1507a, lja-MIR1507b, mtr-MIR169i, mtr-MIR172d, mtr-MIR319c, mtr-MIR319d, mtr-MIR397, mtr-MIR169l, mtr-MIR399s, mtr-MIR399t, gma-MIR398d, gma-MIR319o, gma-MIR319p, gma-MIR399i, gma-MIR319q, gma-MIR399j, gma-MIR399k, gma-MIR169w, gma-MIR399l, gma-MIR399m, gma-MIR399n, gma-MIR399o, lja-MIR164, lja-MIR398, lja-MIR168, lja-MIR395, lja-MIR1511, lja-MIR166
Arabidopsis Argonaute10 specifically sequesters miR166/165 to regulate shoot apical meristem development.
[score:3]
However, functional analyses of miRNAs remained rare and only two miRNAs, miR169, and miR166, were experimentally associated to nodule development before 2009 (Data Sheet 2; Combier et al., 2006; Boualem et al., 2008).
[score:2]
MicroRNA166 controls root and nodule development in Medicago truncatula.
[score:1]
[1 to 20 of 3 sentences]
|
14 |
[+]
score:
6
Other miRNAs from this paper: gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR160a, gma-MIR166a, gma-MIR166b, gma-MIR167a, gma-MIR167b, gma-MIR168a, gma-MIR319a, gma-MIR319b, gma-MIR156a, gma-MIR396a, gma-MIR396b, gma-MIR398a, gma-MIR398b, gma-MIR319c, gma-MIR156b, gma-MIR169a, gma-MIR159b, gma-MIR162a, gma-MIR164a, gma-MIR167c, gma-MIR169b, gma-MIR169c, gma-MIR171a, gma-MIR390a, gma-MIR390b, gma-MIR393a, gma-MIR171b, gma-MIR482a, gma-MIR1507a, gma-MIR1509a, gma-MIR1510a, gma-MIR1511, gma-MIR1512a, gma-MIR1516a, gma-MIR1520d, gma-MIR1520a, gma-MIR1520b, gma-MIR1520c, gma-MIR167d, gma-MIR396c, gma-MIR1507b, gma-MIR1510b, gma-MIR2119, gma-MIR167e, gma-MIR167f, gma-MIR1509b, gma-MIR1520e, gma-MIR1520f, gma-MIR1520g, gma-MIR4387c, gma-MIR1520h, gma-MIR1520i, gma-MIR396d, gma-MIR1520j, gma-MIR4365, gma-MIR4387b, gma-MIR482b, gma-MIR1520k, gma-MIR1520l, gma-MIR1520m, gma-MIR1520n, gma-MIR1520o, gma-MIR4387a, gma-MIR4387d, gma-MIR167g, gma-MIR1520r, gma-MIR156f, gma-MIR1520p, gma-MIR169d, gma-MIR1520q, gma-MIR171c, gma-MIR169e, gma-MIR4413a, gma-MIR156g, gma-MIR396e, gma-MIR156h, gma-MIR156i, gma-MIR160b, gma-MIR160c, gma-MIR160d, gma-MIR160e, gma-MIR162b, gma-MIR164b, gma-MIR164c, gma-MIR164d, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR168b, gma-MIR169f, gma-MIR169g, gma-MIR171d, gma-MIR171e, gma-MIR171f, gma-MIR171g, gma-MIR319d, gma-MIR319e, gma-MIR319f, gma-MIR390c, gma-MIR398c, gma-MIR408d, gma-MIR2118a, gma-MIR2118b, gma-MIR482c, gma-MIR862a, gma-MIR1507c, gma-MIR4996, gma-MIR171h, gma-MIR171i, gma-MIR1516b, gma-MIR169h, gma-MIR167h, gma-MIR5039, gma-MIR169i, gma-MIR396f, gma-MIR5041, gma-MIR396g, gma-MIR167i, gma-MIR862b, gma-MIR5372, gma-MIR5374, gma-MIR5376, gma-MIR171j, gma-MIR397a, gma-MIR397b, gma-MIR408a, gma-MIR408b, gma-MIR408c, gma-MIR3522, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR162c, gma-MIR166i, gma-MIR166j, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR171k, gma-MIR319g, gma-MIR319h, gma-MIR319i, gma-MIR319j, gma-MIR319k, gma-MIR319l, gma-MIR319m, gma-MIR396h, gma-MIR396i, gma-MIR482d, gma-MIR1512b, gma-MIR4413b, gma-MIR167j, gma-MIR171l, gma-MIR5668, gma-MIR5671a, gma-MIR1512c, gma-MIR4387e, gma-MIR393b, gma-MIR1516c, gma-MIR156p, gma-MIR171m, gma-MIR171n, gma-MIR156q, gma-MIR171o, gma-MIR169o, gma-MIR319n, gma-MIR171p, gma-MIR169p, gma-MIR156r, gma-MIR396j, gma-MIR171q, gma-MIR156s, gma-MIR169r, gma-MIR169s, gma-MIR396k, gma-MIR166k, gma-MIR156t, gma-MIR482e, gma-MIR171r, gma-MIR169t, gma-MIR171s, gma-MIR166l, gma-MIR171t, gma-MIR171u, gma-MIR166m, gma-MIR169u, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR160f, gma-MIR164e, gma-MIR164f, gma-MIR164g, gma-MIR164h, gma-MIR164i, gma-MIR164j, gma-MIR164k, gma-MIR166n, gma-MIR166o, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR169v, gma-MIR390d, gma-MIR390e, gma-MIR390f, gma-MIR390g, gma-MIR393c, gma-MIR393d, gma-MIR393e, gma-MIR393f, gma-MIR393g, gma-MIR393h, gma-MIR393i, gma-MIR393j, gma-MIR393k, gma-MIR1516d, gma-MIR398d, gma-MIR5671b, gma-MIR319o, gma-MIR319p, gma-MIR167k, gma-MIR319q, gma-MIR167l, gma-MIR169w
Soy_1, soy_2 and soy_3 were members of MIR166, targets of the three miRNA candidates were HD-ZIP transcript factor which were conserved with other miRNA members.
[score:3]
Most of the top 30 abundant miRNAs were conserved miRNAs such as, members of MIR156, MIR166 and MIR168, while three legume specific miRNAs, miR1507, miR1509 and miR1510 were highly abundant in all four libraries.
[score:1]
Mtr-miR166, Mtr-miR169 of M. truncatula and three soybean miRNAs, Gma-miR482, Gma-miR1511, Gma-miR1512 have been functionally analysed and associated to rhizobial symbiosis [25], [26], [27].
[score:1]
All the three miRNAs were members of MIR166, which conserved in both monocots and dicots.
[score:1]
[1 to 20 of 4 sentences]
|
15 |
[+]
score:
5
Other miRNAs from this paper: gma-MIR166a, gma-MIR166b, gma-MIR390a, gma-MIR390b, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR390c, gma-MIR166i, gma-MIR166j, gma-MIR166k, gma-MIR166l, gma-MIR166m, gma-MIR166n, gma-MIR166o, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR390d, gma-MIR390e, gma-MIR390f, gma-MIR390g
Indeed, miRNA166 and miRNA166* have been isolated in soybean, and the expression of miRNA166* was observed in the peripheral region of the SAM [92].
[score:3]
AGO10 is the closet member to AGO1, AtAGO10 has been shown to have a role in SAM development in addition to organ polarity by repressing miRNA166/165 [90, 91].
[score:2]
[1 to 20 of 2 sentences]
|
16 |
[+]
score:
4
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR162a, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR393a, osa-MIR394, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR162b, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR393b, osa-MIR172d, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, osa-MIR396e, gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR159a, gma-MIR166a, gma-MIR166b, gma-MIR167a, gma-MIR167b, gma-MIR168a, gma-MIR172a, gma-MIR172b, gma-MIR156a, gma-MIR396a, gma-MIR396b, gma-MIR156b, gma-MIR169a, osa-MIR169r, gma-MIR159b, gma-MIR159c, gma-MIR162a, gma-MIR164a, gma-MIR167c, gma-MIR169b, gma-MIR169c, gma-MIR393a, gma-MIR482a, osa-MIR396f, gma-MIR167d, gma-MIR396c, gma-MIR167e, gma-MIR167f, gma-MIR172c, gma-MIR172d, gma-MIR172e, osa-MIR2118a, osa-MIR2118b, osa-MIR2118c, osa-MIR2118d, osa-MIR2118e, osa-MIR2118f, osa-MIR2118g, osa-MIR2118h, osa-MIR2118i, osa-MIR2118j, osa-MIR2118k, osa-MIR2118l, osa-MIR2118m, osa-MIR2118n, osa-MIR2118o, osa-MIR2118p, osa-MIR2118q, osa-MIR2118r, osa-MIR396g, osa-MIR396h, osa-MIR396d, ahy-MIR156a, ahy-MIR156b, ahy-MIR156c, ahy-MIR159, ahy-MIR167, ahy-MIR394, gma-MIR396d, gma-MIR482b, gma-MIR167g, gma-MIR156f, gma-MIR169d, gma-MIR172f, gma-MIR169e, gma-MIR394b, gma-MIR156g, gma-MIR159d, gma-MIR394a, gma-MIR396e, gma-MIR156h, gma-MIR156i, gma-MIR162b, gma-MIR164b, gma-MIR164c, gma-MIR164d, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR169f, gma-MIR169g, gma-MIR394c, gma-MIR2118a, gma-MIR2118b, gma-MIR482c, gma-MIR169h, gma-MIR167h, gma-MIR169i, gma-MIR396f, gma-MIR396g, gma-MIR167i, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR159e, gma-MIR159f, gma-MIR162c, gma-MIR166i, gma-MIR166j, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR172g, gma-MIR172h, gma-MIR172i, gma-MIR172j, gma-MIR396h, gma-MIR396i, gma-MIR482d, gma-MIR167j, gma-MIR393b, gma-MIR156p, gma-MIR172k, gma-MIR156q, gma-MIR172l, gma-MIR169o, gma-MIR394d, gma-MIR169p, gma-MIR156r, gma-MIR396j, gma-MIR156s, gma-MIR169r, gma-MIR169s, gma-MIR396k, gma-MIR166k, gma-MIR156t, gma-MIR482e, gma-MIR394e, gma-MIR169t, gma-MIR166l, gma-MIR394f, gma-MIR166m, gma-MIR169u, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR164e, gma-MIR164f, gma-MIR164g, gma-MIR164h, gma-MIR164i, gma-MIR164j, gma-MIR164k, gma-MIR166n, gma-MIR166o, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR169v, gma-MIR393c, gma-MIR393d, gma-MIR393e, gma-MIR393f, gma-MIR393g, gma-MIR393h, gma-MIR393i, gma-MIR393j, gma-MIR393k, gma-MIR394g, gma-MIR167k, gma-MIR167l, gma-MIR169w
This was also the case for some other miRNA families, such as ahy-miR164 (from 1 read to 4,116 reads) and ahy-miR166 (from 1 read to 9577 reads).
[score:1]
For example, miR156/157, miR159/319, miR166, miR169, and miR394 have been found in 51, 45, 41, 40, and 40 plant species, respectively [34, 38, 41].
[score:1]
Of the 22 miRNA families, three miRNA families (miR156/157, miR166, and miR167) were predicted [34, 38, 41] using a comparative genomics -based strategy [38].
[score:1]
miRNAs of moderate abundance included ahy-miR157d, ahy-miR164a, ahy-miR166a, ahy-miR166 g, ahy-miR166a, ahy-miR167f, and ahy-miR172a were detected 2,000-10,000 times in the library.
[score:1]
[1 to 20 of 4 sentences]
|
17 |
[+]
score:
4
Other miRNAs from this paper: gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR160a, gma-MIR166a, gma-MIR166b, gma-MIR156a, gma-MIR396b, gma-MIR156b, gma-MIR390a, gma-MIR390b, gma-MIR393a, gma-MIR482a, gma-MIR1508a, gma-MIR1510a, gma-MIR1512a, gma-MIR1514a, gma-MIR1514b, gma-MIR1515a, gma-MIR1522, gma-MIR1530, gma-MIR1508b, gma-MIR1510b, gma-MIR2108b, gma-MIR1520j, gma-MIR482b, gma-MIR4388, gma-MIR156f, gma-MIR1520p, gma-MIR156g, gma-MIR394a, gma-MIR156h, gma-MIR156i, gma-MIR160b, gma-MIR160c, gma-MIR160d, gma-MIR160e, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR390c, gma-MIR2118a, gma-MIR2118b, gma-MIR482c, gma-MIR1508c, gma-MIR4992, gma-MIR5041, gma-MIR395b, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR166i, gma-MIR166j, gma-MIR482d, gma-MIR1512b, gma-MIR1512c, gma-MIR5769, gma-MIR393b, gma-MIR399a, gma-MIR828a, gma-MIR156p, gma-MIR828b, gma-MIR156q, gma-MIR156r, gma-MIR399b, gma-MIR156s, gma-MIR166k, gma-MIR156t, gma-MIR482e, gma-MIR399c, gma-MIR399d, gma-MIR399e, gma-MIR166l, gma-MIR399f, gma-MIR399g, gma-MIR166m, gma-MIR399h, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR160f, gma-MIR166n, gma-MIR166o, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR390d, gma-MIR390e, gma-MIR390f, gma-MIR390g, gma-MIR393c, gma-MIR393d, gma-MIR393e, gma-MIR393f, gma-MIR393g, gma-MIR393h, gma-MIR393i, gma-MIR393j, gma-MIR393k, gma-MIR1515b, gma-MIR399i, gma-MIR399j, gma-MIR399k, gma-MIR399l, gma-MIR399m, gma-MIR399n, gma-MIR399o
Additionally, A. thaliana transgenic plants overexpressing eTMs of miR160 and miR166 showed altered plant development, suggesting that these eTMs could be endogenously functional (Wu et al., 2013).
[score:4]
[1 to 20 of 1 sentences]
|
18 |
[+]
score:
4
Other miRNAs from this paper: ath-MIR166a, ath-MIR166b, ath-MIR166c, ath-MIR166d, ath-MIR166e, ath-MIR166f, ath-MIR166g, ath-MIR390a, ath-MIR390b, sbi-MIR166d, sbi-MIR166c, sbi-MIR166b, sbi-MIR166a, sbi-MIR166e, sbi-MIR166f, gma-MIR166a, gma-MIR166b, sbi-MIR166g, gma-MIR390a, gma-MIR390b, gma-MIR1515a, sbi-MIR166h, sbi-MIR166i, sbi-MIR166j, sbi-MIR166k, sbi-MIR390, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR390c, gma-MIR166i, gma-MIR166j, gma-MIR166k, gma-MIR166l, gma-MIR166m, gma-MIR166n, gma-MIR166o, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR390d, gma-MIR390e, gma-MIR390f, gma-MIR390g, gma-MIR1515b
In Arabidopsis, AGO10 has been shown to regulate the function of miR166/165 [28, 29].
[score:2]
AGO10 specifically sequesters miR166/165 from AGO1, which is essential for shoot apical meristem development [28, 29].
[score:2]
[1 to 20 of 2 sentences]
|
19 |
[+]
score:
3
Other miRNAs from this paper: ath-MIR165a, ath-MIR165b, ath-MIR166a, ath-MIR166b, ath-MIR166c, ath-MIR166d, ath-MIR166e, ath-MIR166f, ath-MIR166g, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR166k, osa-MIR166l, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR166m, osa-MIR166j, zma-MIR166a, zma-MIR166h, zma-MIR166e, zma-MIR166i, zma-MIR166f, zma-MIR166g, zma-MIR166b, zma-MIR166c, zma-MIR166d, mtr-MIR166a, gma-MIR166a, gma-MIR166b, zma-MIR166k, zma-MIR166j, zma-MIR166l, zma-MIR166m, ptc-MIR166a, ptc-MIR166b, ptc-MIR166c, ptc-MIR166d, ptc-MIR166e, ptc-MIR166f, ptc-MIR166g, ptc-MIR166h, ptc-MIR166i, ptc-MIR166j, ptc-MIR166k, ptc-MIR166l, ptc-MIR166m, ptc-MIR166n, ptc-MIR166o, ptc-MIR166p, ptc-MIR166q, mtr-MIR166b, mtr-MIR166c, mtr-MIR166d, mtr-MIR166e, mtr-MIR166f, mtr-MIR166g, vvi-MIR166a, vvi-MIR166b, vvi-MIR166c, vvi-MIR166d, vvi-MIR166e, vvi-MIR166f, vvi-MIR166g, vvi-MIR166h, zma-MIR166n, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR166i, gma-MIR166j, gma-MIR166k, gma-MIR166l, gma-MIR166m, gma-MIR166n, gma-MIR166o, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u
Prigge and Clark [73], and Floyd and Bowman [75] have previously suggested that HD-Zip III sequences across all land plants produce transcripts that could be targeted by miRNA165 and miRNA166.
[score:3]
[1 to 20 of 1 sentences]
|
20 |
[+]
score:
3
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR160e, osa-MIR160f, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR172d, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR159a, gma-MIR160a, gma-MIR166a, gma-MIR166b, gma-MIR167a, gma-MIR167b, gma-MIR172a, gma-MIR172b, gma-MIR156a, gma-MIR156b, gma-MIR169a, osa-MIR169r, gma-MIR159b, gma-MIR159c, gma-MIR164a, gma-MIR167c, gma-MIR169b, gma-MIR169c, gma-MIR1520d, gma-MIR1520a, gma-MIR1520b, gma-MIR1520c, gma-MIR167d, gma-MIR167e, gma-MIR167f, gma-MIR172c, gma-MIR172d, gma-MIR172e, gma-MIR1520e, gma-MIR1520f, gma-MIR1520g, gma-MIR1520h, gma-MIR1520i, gma-MIR1520j, gma-MIR1520k, gma-MIR1520l, gma-MIR1520m, gma-MIR1520n, gma-MIR1520o, gma-MIR167g, gma-MIR1520r, gma-MIR156f, gma-MIR1520p, gma-MIR4406, gma-MIR169d, gma-MIR1520q, gma-MIR172f, gma-MIR169e, gma-MIR156g, gma-MIR159d, gma-MIR156h, gma-MIR156i, gma-MIR160b, gma-MIR160c, gma-MIR160d, gma-MIR160e, gma-MIR164b, gma-MIR164c, gma-MIR164d, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR169f, gma-MIR169g, gma-MIR169h, gma-MIR167h, gma-MIR169i, gma-MIR167i, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR159e, gma-MIR159f, gma-MIR166i, gma-MIR166j, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR172g, gma-MIR172h, gma-MIR172i, gma-MIR172j, gma-MIR167j, gma-MIR156p, gma-MIR172k, gma-MIR156q, gma-MIR172l, gma-MIR169o, gma-MIR169p, gma-MIR156r, gma-MIR156s, gma-MIR169r, gma-MIR169s, gma-MIR166k, gma-MIR156t, gma-MIR169t, gma-MIR166l, gma-MIR166m, gma-MIR169u, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR160f, gma-MIR164e, gma-MIR164f, gma-MIR164g, gma-MIR164h, gma-MIR164i, gma-MIR164j, gma-MIR164k, gma-MIR166n, gma-MIR166o, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR169v, gma-MIR167k, gma-MIR167l, gma-MIR169w
We identified a number of HD-ZIP transcription factors as targets for gma-miR166 in our degradome libraries.
[score:3]
[1 to 20 of 1 sentences]
|
21 |
[+]
score:
3
Other miRNAs from this paper: gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR160a, gma-MIR166a, gma-MIR166b, gma-MIR167a, gma-MIR167b, gma-MIR172a, gma-MIR172b, gma-MIR156a, gma-MIR396a, gma-MIR396b, gma-MIR398a, gma-MIR398b, gma-MIR156b, gma-MIR167c, gma-MIR390a, gma-MIR390b, gma-MIR393a, gma-MIR482a, gma-MIR1511, gma-MIR1512a, gma-MIR1515a, gma-MIR167d, gma-MIR396c, gma-MIR167e, gma-MIR167f, gma-MIR172c, gma-MIR172d, gma-MIR172e, gma-MIR396d, gma-MIR482b, gma-MIR167g, gma-MIR156f, gma-MIR172f, gma-MIR156g, gma-MIR396e, gma-MIR156h, gma-MIR156i, gma-MIR160b, gma-MIR160c, gma-MIR160d, gma-MIR160e, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR390c, gma-MIR398c, gma-MIR482c, gma-MIR167h, gma-MIR396f, gma-MIR396g, gma-MIR167i, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR166i, gma-MIR166j, gma-MIR172g, gma-MIR172h, gma-MIR172i, gma-MIR172j, gma-MIR319l, gma-MIR396h, gma-MIR396i, gma-MIR482d, gma-MIR1512b, gma-MIR167j, gma-MIR2111a, gma-MIR1512c, gma-MIR393b, gma-MIR399a, gma-MIR156p, gma-MIR172k, gma-MIR156q, gma-MIR172l, gma-MIR156r, gma-MIR399b, gma-MIR396j, gma-MIR156s, gma-MIR396k, gma-MIR2111b, gma-MIR2111c, gma-MIR166k, gma-MIR2111d, gma-MIR156t, gma-MIR482e, gma-MIR399c, gma-MIR399d, gma-MIR399e, gma-MIR166l, gma-MIR2111e, gma-MIR2111f, gma-MIR399f, gma-MIR399g, gma-MIR166m, gma-MIR399h, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR160f, gma-MIR166n, gma-MIR166o, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR390d, gma-MIR390e, gma-MIR390f, gma-MIR390g, gma-MIR393c, gma-MIR393d, gma-MIR393e, gma-MIR393f, gma-MIR393g, gma-MIR393h, gma-MIR393i, gma-MIR393j, gma-MIR393k, gma-MIR1515b, gma-MIR398d, gma-MIR399i, gma-MIR167k, gma-MIR167l, gma-MIR399j, gma-MIR399k, gma-MIR399l, gma-MIR399m, gma-MIR399n, gma-MIR399o
Balanced activity of microRNA166/165 and its target transcripts from the class III homeodomain-leucine zipper family regulates root growth in Arabidopsis thaliana.
[score:3]
[1 to 20 of 1 sentences]
|
22 |
[+]
score:
2
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR156k, osa-MIR156l, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR167j, osa-MIR166m, osa-MIR166j, zma-MIR156d, zma-MIR156f, zma-MIR156g, zma-MIR156b, zma-MIR156c, zma-MIR156e, zma-MIR156a, zma-MIR156h, zma-MIR156i, zma-MIR167a, zma-MIR167b, zma-MIR167d, zma-MIR167c, zma-MIR166a, zma-MIR166h, zma-MIR166e, zma-MIR166i, zma-MIR166f, zma-MIR166g, zma-MIR166b, zma-MIR166c, zma-MIR166d, gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR166a, gma-MIR166b, gma-MIR167a, gma-MIR167b, gma-MIR168a, gma-MIR156a, gma-MIR156b, zma-MIR156j, zma-MIR166k, zma-MIR166j, zma-MIR167e, zma-MIR167f, zma-MIR167g, zma-MIR167h, zma-MIR167i, zma-MIR168a, zma-MIR168b, zma-MIR166l, zma-MIR166m, zma-MIR156k, osa-MIR535, gma-MIR167c, gma-MIR1507a, gma-MIR167d, gma-MIR1507b, gma-MIR167e, gma-MIR167f, zma-MIR156l, zma-MIR166n, zma-MIR167j, gma-MIR167g, gma-MIR156f, gma-MIR156g, gma-MIR156h, gma-MIR156i, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR168b, gma-MIR1507c, gma-MIR167h, gma-MIR167i, gma-MIR3522, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR166i, gma-MIR166j, gma-MIR167j, gma-MIR156p, gma-MIR156q, gma-MIR156r, gma-MIR156s, gma-MIR166k, gma-MIR156t, gma-MIR166l, gma-MIR166m, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR166n, gma-MIR166o, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR167k, gma-MIR167l
Nipponbare) was probed for corn miR168 sequence (Panel A); soybean miR168 sequence (Panel B), or miR166 (Panel C).
[score:1]
The plant miRNAs used in the search include miR156, miR166, miR167, miR168, miR535 and miR3522.
[score:1]
[1 to 20 of 2 sentences]
|
23 |
[+]
score:
2
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR162a, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR171a, osa-MIR394, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR160e, osa-MIR160f, osa-MIR162b, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR408, osa-MIR172d, osa-MIR171i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, osa-MIR396e, gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR159a, gma-MIR160a, gma-MIR166a, gma-MIR166b, gma-MIR167a, gma-MIR167b, gma-MIR172a, gma-MIR172b, gma-MIR156a, gma-MIR396a, gma-MIR396b, gma-MIR156b, gma-MIR169a, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR169r, gma-MIR159b, gma-MIR159c, gma-MIR162a, gma-MIR164a, gma-MIR167c, gma-MIR169b, gma-MIR169c, gma-MIR171a, gma-MIR171b, gma-MIR482a, sly-MIR160a, sly-MIR166a, sly-MIR166b, sly-MIR167a, sly-MIR169a, sly-MIR169b, sly-MIR169c, sly-MIR169d, sly-MIR171a, sly-MIR171b, sly-MIR171c, sly-MIR171d, sly-MIR395a, sly-MIR395b, sly-MIR156a, sly-MIR156b, sly-MIR156c, sly-MIR159, sly-MIR162, sly-MIR172a, sly-MIR172b, osa-MIR396f, gma-MIR167d, gma-MIR396c, mdm-MIR482a, gma-MIR167e, gma-MIR167f, gma-MIR172c, gma-MIR172d, gma-MIR172e, osa-MIR396g, osa-MIR396h, osa-MIR396d, osa-MIR395x, osa-MIR395y, gma-MIR396d, gma-MIR482b, gma-MIR167g, gma-MIR156f, gma-MIR169d, gma-MIR172f, gma-MIR171c, gma-MIR169e, gma-MIR394b, gma-MIR156g, gma-MIR159d, gma-MIR394a, gma-MIR396e, gma-MIR156h, gma-MIR156i, gma-MIR160b, gma-MIR160c, gma-MIR160d, gma-MIR160e, gma-MIR162b, gma-MIR164b, gma-MIR164c, gma-MIR164d, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR169f, gma-MIR169g, gma-MIR171d, gma-MIR171e, gma-MIR171f, gma-MIR171g, gma-MIR394c, gma-MIR408d, gma-MIR482c, gma-MIR171h, gma-MIR171i, gma-MIR169h, gma-MIR167h, gma-MIR169i, gma-MIR396f, gma-MIR396g, gma-MIR167i, sly-MIR482e, sly-MIR482a, gma-MIR171j, gma-MIR395a, gma-MIR395b, gma-MIR395c, gma-MIR408a, gma-MIR408b, gma-MIR408c, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR159e, gma-MIR159f, gma-MIR162c, gma-MIR166i, gma-MIR166j, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR171k, gma-MIR172g, gma-MIR172h, gma-MIR172i, gma-MIR172j, gma-MIR396h, gma-MIR396i, gma-MIR482d, gma-MIR167j, gma-MIR171l, gma-MIR156p, gma-MIR171m, gma-MIR172k, gma-MIR171n, gma-MIR156q, gma-MIR171o, gma-MIR172l, gma-MIR169o, gma-MIR171p, gma-MIR394d, gma-MIR169p, gma-MIR156r, gma-MIR396j, gma-MIR171q, gma-MIR156s, gma-MIR169r, gma-MIR169s, gma-MIR396k, gma-MIR166k, gma-MIR156t, gma-MIR482e, gma-MIR171r, gma-MIR394e, gma-MIR169t, gma-MIR171s, gma-MIR166l, gma-MIR171t, gma-MIR394f, gma-MIR171u, gma-MIR395d, gma-MIR395e, gma-MIR395f, gma-MIR395g, gma-MIR166m, gma-MIR169u, sly-MIR482b, sly-MIR482c, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR160f, gma-MIR164e, gma-MIR164f, gma-MIR164g, gma-MIR164h, gma-MIR164i, gma-MIR164j, gma-MIR164k, gma-MIR166n, gma-MIR166o, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR169v, gma-MIR394g, gma-MIR395h, gma-MIR395i, gma-MIR395j, gma-MIR395k, gma-MIR395l, gma-MIR395m, mdm-MIR156a, mdm-MIR156b, mdm-MIR156c, mdm-MIR156d, mdm-MIR156e, mdm-MIR156f, mdm-MIR156g, mdm-MIR156h, mdm-MIR156i, mdm-MIR156j, mdm-MIR156k, mdm-MIR156l, mdm-MIR156m, mdm-MIR156n, mdm-MIR156o, mdm-MIR156p, mdm-MIR156q, mdm-MIR156r, mdm-MIR156s, mdm-MIR156t, mdm-MIR156u, mdm-MIR156v, mdm-MIR156w, mdm-MIR156x, mdm-MIR156y, mdm-MIR156z, mdm-MIR156aa, mdm-MIR156ab, mdm-MIR156ac, mdm-MIR156ad, mdm-MIR156ae, mdm-MIR159a, mdm-MIR159b, mdm-MIR160a, mdm-MIR160b, mdm-MIR160c, mdm-MIR160d, mdm-MIR160e, mdm-MIR162a, mdm-MIR162b, mdm-MIR164a, mdm-MIR164b, mdm-MIR164c, mdm-MIR164d, mdm-MIR164e, mdm-MIR164f, mdm-MIR166a, mdm-MIR166b, mdm-MIR166c, mdm-MIR166d, mdm-MIR166e, mdm-MIR166f, mdm-MIR166g, mdm-MIR166h, mdm-MIR166i, mdm-MIR167a, mdm-MIR167b, mdm-MIR167c, mdm-MIR167d, mdm-MIR167e, mdm-MIR167f, mdm-MIR167g, mdm-MIR167h, mdm-MIR167i, mdm-MIR167j, mdm-MIR169a, mdm-MIR169b, mdm-MIR169c, mdm-MIR169d, mdm-MIR171a, mdm-MIR171b, mdm-MIR171c, mdm-MIR171d, mdm-MIR171e, mdm-MIR171f, mdm-MIR171g, mdm-MIR171h, mdm-MIR171i, mdm-MIR171j, mdm-MIR171k, mdm-MIR171l, mdm-MIR171m, mdm-MIR171n, mdm-MIR172a, mdm-MIR172b, mdm-MIR172c, mdm-MIR172d, mdm-MIR172e, mdm-MIR172f, mdm-MIR172g, mdm-MIR172h, mdm-MIR172i, mdm-MIR172j, mdm-MIR172k, mdm-MIR172l, mdm-MIR172m, mdm-MIR172n, mdm-MIR172o, mdm-MIR394a, mdm-MIR394b, mdm-MIR395a, mdm-MIR395b, mdm-MIR395c, mdm-MIR395d, mdm-MIR395e, mdm-MIR395f, mdm-MIR395g, mdm-MIR395h, mdm-MIR395i, mdm-MIR396a, mdm-MIR396b, mdm-MIR396c, mdm-MIR396d, mdm-MIR396e, mdm-MIR396f, mdm-MIR396g, mdm-MIR408a, mdm-MIR482b, mdm-MIR482c, mdm-MIR408b, mdm-MIR408c, mdm-MIR408d, mdm-MIR482d, mdm-MIR159c, mdm-MIR171o, mdm-MIR169e, mdm-MIR169f, sly-MIR164a, sly-MIR164b, sly-MIR394, sly-MIR166c, sly-MIR156d, sly-MIR156e, sly-MIR396a, sly-MIR167b, sly-MIR482d, sly-MIR169e, sly-MIR396b, sly-MIR171e, gma-MIR167k, gma-MIR167l, gma-MIR169w, sly-MIR172c, sly-MIR408, sly-MIR172d, sly-MIR169f, sly-MIR171f, mdm-MIR159d, mdm-MIR159e, mdm-MIR159f, mdm-MIR166j, mdm-MIR395j, mdm-MIR169g, mdm-MIR169h, mdm-MIR169i, mdm-MIR169j, mdm-MIR171p, mdm-MIR395k, mdm-MIR171q, mdm-MIR169k, mdm-MIR169l, mdm-MIR169m, mdm-MIR169n, mdm-MIR172p, mdm-MIR395l, mdm-MIR169o
As indicated in Table 2, 19/21 replicated miRNAs (90%) were present in two copies, with two exceptions: miR166 (three copies) and miR395 (four copies).
[score:1]
miR396, miR166, miR172, miR169 and miR395 were also present at multiple loci in date palm, and these miRNAs had the highest average copy number in the other plant species.
[score:1]
[1 to 20 of 2 sentences]
|
24 |
[+]
score:
2
Other miRNAs from this paper: gma-MIR166a, gma-MIR166b, gma-MIR319a, gma-MIR319b, gma-MIR319c, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR319d, gma-MIR319e, gma-MIR319f, gma-MIR166i, gma-MIR166j, gma-MIR319g, gma-MIR319h, gma-MIR319i, gma-MIR319j, gma-MIR319k, gma-MIR319l, gma-MIR319m, gma-MIR319n, gma-MIR166k, gma-MIR166l, gma-MIR166m, gma-MIR166n, gma-MIR166o, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR319o, gma-MIR319p, gma-MIR319q
Further analysis revealed that Glyma04g38430.1 and Glyma05g32980.1 were miR166 genes; Glyma05g37200.1 produced miR319; and Glyma02g02440.1 and Glyma05g03670.1 generated small RNAs randomly from both sense and antisense strands (Additional file 7).
[score:1]
Of these five transcripts, two were miR166 pre-miRNA and one was miR319 pre-miRNA.
[score:1]
[1 to 20 of 2 sentences]
|
25 |
[+]
score:
2
Other miRNAs from this paper: gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR159a, gma-MIR166a, gma-MIR166b, gma-MIR172a, gma-MIR172b, gma-MIR319a, gma-MIR319b, gma-MIR156a, gma-MIR396a, gma-MIR396b, gma-MIR319c, gma-MIR156b, gma-MIR169a, gma-MIR159b, gma-MIR159c, gma-MIR169b, gma-MIR169c, gma-MIR482a, gma-MIR1507a, gma-MIR1510a, gma-MIR1513a, gma-MIR1520d, gma-MIR396c, gma-MIR1507b, gma-MIR1510b, gma-MIR172c, gma-MIR172d, gma-MIR172e, gma-MIR396d, gma-MIR482b, gma-MIR156f, gma-MIR169d, gma-MIR172f, gma-MIR169e, gma-MIR156g, gma-MIR159d, gma-MIR396e, gma-MIR156h, gma-MIR156i, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR169f, gma-MIR169g, gma-MIR319d, gma-MIR319e, gma-MIR319f, gma-MIR408d, gma-MIR2118a, gma-MIR2118b, gma-MIR482c, gma-MIR1513b, gma-MIR169h, gma-MIR169i, gma-MIR396f, gma-MIR396g, gma-MIR395a, gma-MIR395b, gma-MIR395c, gma-MIR397a, gma-MIR397b, gma-MIR408a, gma-MIR408b, gma-MIR408c, gma-MIR3522, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR159e, gma-MIR159f, gma-MIR166i, gma-MIR166j, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR172g, gma-MIR172h, gma-MIR172i, gma-MIR172j, gma-MIR319g, gma-MIR319h, gma-MIR319i, gma-MIR319j, gma-MIR319k, gma-MIR319l, gma-MIR319m, gma-MIR396h, gma-MIR396i, gma-MIR482d, gma-MIR1513c, gma-MIR4415b, gma-MIR156p, gma-MIR172k, gma-MIR156q, gma-MIR172l, gma-MIR169o, gma-MIR319n, gma-MIR169p, gma-MIR156r, gma-MIR396j, gma-MIR156s, gma-MIR169r, gma-MIR169s, gma-MIR396k, gma-MIR166k, gma-MIR156t, gma-MIR482e, gma-MIR169t, gma-MIR166l, gma-MIR395d, gma-MIR395e, gma-MIR395f, gma-MIR395g, gma-MIR166m, gma-MIR169u, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR166n, gma-MIR166o, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR169v, gma-MIR395h, gma-MIR395i, gma-MIR395j, gma-MIR395k, gma-MIR395l, gma-MIR395m, gma-MIR319o, gma-MIR319p, gma-MIR319q, gma-MIR169w
Interestingly, in family MIR166, we found three new members with sense and antisense miRNAs.
[score:1]
A set of five different miRNAs (MIR166- 5p, MIR169f- 3p, MIR1513c, MIR397ab and MIR- Seq13) presented the same behavior during the water deficit stress.
[score:1]
[1 to 20 of 2 sentences]
|
26 |
[+]
score:
2
Other miRNAs from this paper: gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR159a, gma-MIR160a, gma-MIR166a, gma-MIR166b, gma-MIR167a, gma-MIR167b, gma-MIR156a, gma-MIR396a, gma-MIR396b, gma-MIR156b, gma-MIR169a, gma-MIR159b, gma-MIR159c, gma-MIR164a, gma-MIR167c, gma-MIR169b, gma-MIR169c, gma-MIR171a, gma-MIR171b, gma-MIR1507a, gma-MIR1508a, gma-MIR1509a, gma-MIR1510a, gma-MIR1523a, gma-MIR1528, gma-MIR1535a, gma-MIR167d, gma-MIR396c, gma-MIR1507b, gma-MIR1508b, gma-MIR1510b, gma-MIR167e, gma-MIR167f, gma-MIR172c, gma-MIR1509b, gma-MIR396d, gma-MIR4366, gma-MIR4382, gma-MIR4389, gma-MIR167g, gma-MIR156f, gma-MIR169d, gma-MIR4411, gma-MIR171c, gma-MIR169e, gma-MIR4412, gma-MIR4413a, gma-MIR156g, gma-MIR159d, gma-MIR4416a, gma-MIR396e, gma-MIR156h, gma-MIR156i, gma-MIR160b, gma-MIR160c, gma-MIR160d, gma-MIR160e, gma-MIR164b, gma-MIR164c, gma-MIR164d, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR169f, gma-MIR169g, gma-MIR171d, gma-MIR171e, gma-MIR171f, gma-MIR171g, gma-MIR408d, gma-MIR1507c, gma-MIR1508c, gma-MIR1535b, gma-MIR4996, gma-MIR1523b, gma-MIR171h, gma-MIR171i, gma-MIR169h, gma-MIR167h, gma-MIR169i, gma-MIR396f, gma-MIR396g, gma-MIR167i, gma-MIR5374, gma-MIR171j, gma-MIR395a, gma-MIR395b, gma-MIR395c, gma-MIR397a, gma-MIR397b, gma-MIR408a, gma-MIR408b, gma-MIR408c, gma-MIR3522, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR159e, gma-MIR159f, gma-MIR166i, gma-MIR166j, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR171k, gma-MIR396h, gma-MIR396i, gma-MIR4413b, gma-MIR167j, gma-MIR171l, gma-MIR5667, gma-MIR5761a, gma-MIR4416c, gma-MIR5761b, gma-MIR4416b, gma-MIR156p, gma-MIR171m, gma-MIR171n, gma-MIR156q, gma-MIR171o, gma-MIR169o, gma-MIR171p, gma-MIR169p, gma-MIR156r, gma-MIR396j, gma-MIR171q, gma-MIR156s, gma-MIR169r, gma-MIR169s, gma-MIR396k, gma-MIR166k, gma-MIR156t, gma-MIR171r, gma-MIR169t, gma-MIR171s, gma-MIR166l, gma-MIR171t, gma-MIR171u, gma-MIR395d, gma-MIR395e, gma-MIR395f, gma-MIR395g, gma-MIR166m, gma-MIR169u, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR160f, gma-MIR164e, gma-MIR164f, gma-MIR164g, gma-MIR164h, gma-MIR164i, gma-MIR164j, gma-MIR164k, gma-MIR166n, gma-MIR166o, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR169v, gma-MIR395h, gma-MIR395i, gma-MIR395j, gma-MIR395k, gma-MIR395l, gma-MIR395m, gma-MIR167k, gma-MIR167l, gma-MIR169w
The classical conserved miRNAs, including miR156, miR164 and miR166, were detected in vegetable soybean consistent with previous studies in grain soybean 22 37.
[score:1]
Some identified miRNA families such as miR156, miR160, miR164, miR166, miR396, and miR397 are highly conserved in many plant species, such as Arabidopsis thaliana, Oryza sativa, and Zea mays.
[score:1]
[1 to 20 of 2 sentences]
|
27 |
[+]
score:
1
Other miRNAs from this paper: gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR159a, gma-MIR166a, gma-MIR166b, gma-MIR168a, gma-MIR156a, gma-MIR396a, gma-MIR396b, gma-MIR398a, gma-MIR398b, gma-MIR156b, gma-MIR169a, gma-MIR159b, gma-MIR159c, gma-MIR169b, gma-MIR169c, gma-MIR171a, gma-MIR390a, gma-MIR390b, gma-MIR393a, gma-MIR171b, gma-MIR1507a, gma-MIR1509a, gma-MIR1510a, gma-MIR1515a, gma-MIR396c, gma-MIR1507b, gma-MIR1510b, gma-MIR1509b, gma-MIR396d, gma-MIR156f, gma-MIR169d, gma-MIR171c, gma-MIR169e, gma-MIR156g, gma-MIR159d, gma-MIR396e, gma-MIR156h, gma-MIR156i, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR168b, gma-MIR169f, gma-MIR169g, gma-MIR171d, gma-MIR171e, gma-MIR171f, gma-MIR171g, gma-MIR390c, gma-MIR398c, gma-MIR2118a, gma-MIR2118b, gma-MIR862a, gma-MIR1507c, gma-MIR171h, gma-MIR171i, gma-MIR169h, gma-MIR169i, gma-MIR396f, gma-MIR396g, gma-MIR171j, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR159e, gma-MIR159f, gma-MIR166i, gma-MIR166j, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR171k, gma-MIR396h, gma-MIR396i, gma-MIR171l, gma-MIR2111a, gma-MIR393b, gma-MIR399a, gma-MIR828a, gma-MIR156p, gma-MIR828b, gma-MIR171m, gma-MIR171n, gma-MIR156q, gma-MIR171o, gma-MIR169o, gma-MIR171p, gma-MIR169p, gma-MIR156r, gma-MIR399b, gma-MIR396j, gma-MIR171q, gma-MIR156s, gma-MIR169r, gma-MIR169s, gma-MIR396k, gma-MIR2111b, gma-MIR2111c, gma-MIR166k, gma-MIR2111d, gma-MIR156t, gma-MIR399c, gma-MIR171r, gma-MIR399d, gma-MIR399e, gma-MIR169t, gma-MIR171s, gma-MIR166l, gma-MIR171t, gma-MIR2111e, gma-MIR2111f, gma-MIR171u, gma-MIR399f, gma-MIR399g, gma-MIR166m, gma-MIR169u, gma-MIR399h, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR166n, gma-MIR166o, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR169v, gma-MIR390d, gma-MIR390e, gma-MIR390f, gma-MIR390g, gma-MIR393c, gma-MIR393d, gma-MIR393e, gma-MIR393f, gma-MIR393g, gma-MIR393h, gma-MIR393i, gma-MIR393j, gma-MIR393k, gma-MIR1515b, gma-MIR398d, gma-MIR399i, gma-MIR399j, gma-MIR399k, gma-MIR169w, gma-MIR399l, gma-MIR399m, gma-MIR399n, gma-MIR399o
The highest read abundance (31,416 RPM and 20,776 RPM) was detected for gma-miR159, and was 2–25-fold greater than other relatively abundant miRNA families, including gma-miR396, gma-156, miR168, and miR166, whose total abundance ranged from 1,000 to 15,000 RPM (Table S2).
[score:1]
[1 to 20 of 1 sentences]
|
28 |
[+]
score:
1
Other miRNAs from this paper: gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR166a, gma-MIR166b, gma-MIR167a, gma-MIR167b, gma-MIR172a, gma-MIR156a, gma-MIR396a, gma-MIR156b, gma-MIR169a, gma-MIR167c, gma-MIR390a, gma-MIR390b, gma-MIR482a, gma-MIR1507a, gma-MIR1508a, gma-MIR1510a, gma-MIR167d, gma-MIR1507b, gma-MIR1508b, gma-MIR1510b, gma-MIR167e, gma-MIR167f, gma-MIR482b, gma-MIR167g, gma-MIR156f, gma-MIR4413a, gma-MIR156g, gma-MIR156h, gma-MIR156i, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR168b, gma-MIR390c, gma-MIR394c, gma-MIR482c, gma-MIR1507c, gma-MIR167h, gma-MIR167i, gma-MIR408c, gma-MIR3522, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR166i, gma-MIR166j, gma-MIR482d, gma-MIR4413b, gma-MIR167j, gma-MIR1512c, gma-MIR828a, gma-MIR156p, gma-MIR828b, gma-MIR156q, gma-MIR156r, gma-MIR156s, gma-MIR166k, gma-MIR156t, gma-MIR482e, gma-MIR166l, gma-MIR166m, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR166n, gma-MIR166o, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR390d, gma-MIR390e, gma-MIR390f, gma-MIR390g, gma-MIR167k, gma-MIR167l
Interestingly, another miRNA166 sequence, gma-miR166a-5p (#11), mapping at the 5’ end of the precursor RNA stem loop, accumulated at very low levels in all the tissues, in contrast with the high level accumulation of the gma-miR166a-3p derived from the 3’ end of the same RNA precursor (#10 in Table 2).
[score:1]
[1 to 20 of 1 sentences]
|
29 |
[+]
score:
1
Other miRNAs from this paper: gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR159a, gma-MIR160a, gma-MIR166a, gma-MIR166b, gma-MIR319a, gma-MIR156a, gma-MIR396a, gma-MIR396b, gma-MIR156b, gma-MIR159b, gma-MIR159c, gma-MIR162a, gma-MIR164a, gma-MIR393a, gma-MIR1518, gma-MIR1520d, gma-MIR1521a, gma-MIR396c, gma-MIR2119, gma-MIR172c, gma-MIR172d, gma-MIR172e, gma-MIR4380a, gma-MIR396d, gma-MIR4378a, gma-MIR4380b, gma-MIR156f, gma-MIR4407, gma-MIR4413a, gma-MIR156g, gma-MIR159d, gma-MIR396e, gma-MIR156h, gma-MIR156i, gma-MIR160b, gma-MIR160c, gma-MIR160d, gma-MIR160e, gma-MIR162b, gma-MIR164b, gma-MIR164c, gma-MIR164d, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR396f, gma-MIR396g, gma-MIR397a, gma-MIR397b, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR159e, gma-MIR159f, gma-MIR162c, gma-MIR166i, gma-MIR166j, gma-MIR396h, gma-MIR396i, gma-MIR1512b, gma-MIR4413b, gma-MIR5674a, gma-MIR5770a, gma-MIR4416c, gma-MIR5770b, gma-MIR399a, gma-MIR156p, gma-MIR156q, gma-MIR156r, gma-MIR399b, gma-MIR396j, gma-MIR156s, gma-MIR396k, gma-MIR166k, gma-MIR156t, gma-MIR399c, gma-MIR399d, gma-MIR399e, gma-MIR169t, gma-MIR166l, gma-MIR399f, gma-MIR399g, gma-MIR166m, gma-MIR5674b, gma-MIR399h, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR160f, gma-MIR164e, gma-MIR164f, gma-MIR164g, gma-MIR164h, gma-MIR164i, gma-MIR164j, gma-MIR164k, gma-MIR166n, gma-MIR166o, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR9747, gma-MIR399i, gma-MIR9763, gma-MIR5770c, gma-MIR399j, gma-MIR399k, gma-MIR399l, gma-MIR399m, gma-MIR399n, gma-MIR399o
Among these miRNA families, MIR156 had 24 members, followed by MIR166 with 21 members, but most families had fewer than 10 members (Additional file 1: Table S3, Additional file 2: Figure S2).
[score:1]
[1 to 20 of 1 sentences]
|
30 |
[+]
score:
1
Other miRNAs from this paper: gma-MIR159a, gma-MIR166a, gma-MIR166b, gma-MIR396a, gma-MIR396b, gma-MIR156b, gma-MIR159b, gma-MIR159c, gma-MIR1520d, gma-MIR396c, gma-MIR396d, gma-MIR159d, gma-MIR396e, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR396f, gma-MIR396g, gma-MIR159e, gma-MIR159f, gma-MIR166i, gma-MIR166j, gma-MIR396h, gma-MIR396i, gma-MIR396j, gma-MIR396k, gma-MIR166k, gma-MIR166l, gma-MIR166m, gma-MIR166n, gma-MIR166o, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u
Implications of miR166 and miR159 induction to the basal response mechanisms of an andigena potato (Solanum tuberosum subsp.
[score:1]
[1 to 20 of 1 sentences]
|
31 |
[+]
score:
1
Other miRNAs from this paper: gma-MIR159a, gma-MIR166a, gma-MIR166b, gma-MIR396a, gma-MIR396b, gma-MIR398a, gma-MIR398b, gma-MIR169a, gma-MIR159b, gma-MIR159c, gma-MIR169b, gma-MIR169c, gma-MIR171a, gma-MIR393a, gma-MIR171b, gma-MIR482a, gma-MIR1507a, gma-MIR1509a, gma-MIR1510a, gma-MIR1512a, gma-MIR1518, gma-MIR396c, gma-MIR1507b, gma-MIR1510b, gma-MIR2109, gma-MIR2119, gma-MIR1509b, gma-MIR396d, gma-MIR482b, gma-MIR169d, gma-MIR171c, gma-MIR169e, gma-MIR159d, gma-MIR396e, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR169f, gma-MIR169g, gma-MIR171d, gma-MIR171e, gma-MIR171f, gma-MIR171g, gma-MIR398c, gma-MIR408d, gma-MIR2118a, gma-MIR2118b, gma-MIR482c, gma-MIR1507c, gma-MIR4996, gma-MIR171h, gma-MIR171i, gma-MIR169h, gma-MIR169i, gma-MIR396f, gma-MIR396g, gma-MIR5037c, gma-MIR171j, gma-MIR397a, gma-MIR397b, gma-MIR408a, gma-MIR408b, gma-MIR408c, gma-MIR3522, gma-MIR159e, gma-MIR159f, gma-MIR166i, gma-MIR166j, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR171k, gma-MIR396h, gma-MIR396i, gma-MIR482d, gma-MIR1512b, gma-MIR171l, gma-MIR1512c, gma-MIR393b, gma-MIR399a, gma-MIR171m, gma-MIR171n, gma-MIR171o, gma-MIR169o, gma-MIR171p, gma-MIR169p, gma-MIR399b, gma-MIR396j, gma-MIR171q, gma-MIR169r, gma-MIR169s, gma-MIR396k, gma-MIR166k, gma-MIR482e, gma-MIR399c, gma-MIR171r, gma-MIR399d, gma-MIR399e, gma-MIR169t, gma-MIR171s, gma-MIR166l, gma-MIR171t, gma-MIR171u, gma-MIR399f, gma-MIR399g, gma-MIR166m, gma-MIR169u, gma-MIR399h, gma-MIR166n, gma-MIR166o, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR169v, gma-MIR393c, gma-MIR393d, gma-MIR393e, gma-MIR393f, gma-MIR393g, gma-MIR393h, gma-MIR393i, gma-MIR393j, gma-MIR393k, gma-MIR398d, gma-MIR9727, gma-MIR9750, gma-MIR399i, gma-MIR399j, gma-MIR399k, gma-MIR169w, gma-MIR399l, gma-MIR399m, gma-MIR399n, gma-MIR399o
The most abundant family was gma-miR1507ab in all libraries, followed by members of miR166, miR1510, and miR3522.
[score:1]
[1 to 20 of 1 sentences]
|
32 |
[+]
score:
1
Other miRNAs from this paper: gma-MIR166a, gma-MIR166b, gma-MIR167a, gma-MIR167b, gma-MIR167c, gma-MIR167d, gma-MIR167e, gma-MIR167f, gma-MIR167g, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR167h, gma-MIR167i, gma-MIR166i, gma-MIR166j, gma-MIR167j, gma-MIR166k, gma-MIR166l, gma-MIR166m, gma-MIR166n, gma-MIR166o, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, mdm-MIR166a, mdm-MIR166b, mdm-MIR166c, mdm-MIR166d, mdm-MIR166e, mdm-MIR166f, mdm-MIR166g, mdm-MIR166h, mdm-MIR166i, mdm-MIR167a, mdm-MIR167b, mdm-MIR167c, mdm-MIR167d, mdm-MIR167e, mdm-MIR167f, mdm-MIR167g, mdm-MIR167h, mdm-MIR167i, mdm-MIR167j, gma-MIR167k, gma-MIR167l, mdm-MIR166j
Unlike the miR166 sequences, where sequences were intermingled in Multiple Sequence Alignment (MSA) 45, the miR167 sequences from different species (as specified in Table 1) taken for our studies are aligned at a distinct position (Fig. 1).
[score:1]
[1 to 20 of 1 sentences]
|
33 |
[+]
score:
1
Other miRNAs from this paper: gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR160a, gma-MIR166a, gma-MIR166b, gma-MIR167a, gma-MIR167b, gma-MIR168a, gma-MIR319a, gma-MIR319b, gma-MIR156a, gma-MIR396a, gma-MIR396b, gma-MIR398a, gma-MIR398b, gma-MIR319c, gma-MIR156b, gma-MIR164a, gma-MIR167c, gma-MIR171a, gma-MIR390a, gma-MIR390b, gma-MIR393a, gma-MIR171b, gma-MIR167d, gma-MIR396c, gma-MIR167e, gma-MIR167f, gma-MIR1509b, gma-MIR396d, gma-MIR167g, gma-MIR156f, gma-MIR4403, gma-MIR171c, gma-MIR156g, gma-MIR396e, gma-MIR156h, gma-MIR156i, gma-MIR160b, gma-MIR160c, gma-MIR160d, gma-MIR160e, gma-MIR164b, gma-MIR164c, gma-MIR164d, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR168b, gma-MIR171d, gma-MIR171e, gma-MIR171f, gma-MIR171g, gma-MIR319d, gma-MIR319e, gma-MIR319f, gma-MIR390c, gma-MIR398c, gma-MIR408d, gma-MIR1535b, gma-MIR4996, gma-MIR171h, gma-MIR171i, gma-MIR167h, gma-MIR396f, gma-MIR396g, gma-MIR167i, gma-MIR5037b, gma-MIR171j, gma-MIR397a, gma-MIR397b, gma-MIR408a, gma-MIR408b, gma-MIR408c, gma-MIR3522, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR166i, gma-MIR166j, gma-MIR169m, gma-MIR171k, gma-MIR319g, gma-MIR319h, gma-MIR319i, gma-MIR319j, gma-MIR319k, gma-MIR319l, gma-MIR319m, gma-MIR396h, gma-MIR396i, gma-MIR167j, gma-MIR171l, gma-MIR393b, gma-MIR156p, gma-MIR171m, gma-MIR171n, gma-MIR156q, gma-MIR171o, gma-MIR319n, gma-MIR171p, gma-MIR156r, gma-MIR396j, gma-MIR171q, gma-MIR156s, gma-MIR396k, gma-MIR166k, gma-MIR156t, gma-MIR171r, gma-MIR171s, gma-MIR166l, gma-MIR171t, gma-MIR171u, gma-MIR166m, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR160f, gma-MIR164e, gma-MIR164f, gma-MIR164g, gma-MIR164h, gma-MIR164i, gma-MIR164j, gma-MIR164k, gma-MIR166n, gma-MIR166o, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR390d, gma-MIR390e, gma-MIR390f, gma-MIR390g, gma-MIR393c, gma-MIR393d, gma-MIR393e, gma-MIR393f, gma-MIR393g, gma-MIR393h, gma-MIR393i, gma-MIR393j, gma-MIR393k, gma-MIR6300, gma-MIR398d, gma-MIR319o, gma-MIR319p, gma-MIR167k, gma-MIR319q, gma-MIR167l
Ding et al. [25] verified that miR166, miR171, miR390, miR156 and miR168 responded to Cd stress in rice, and Zhou et al. [26] reported that miR396, miR397, miR398 and miR408 were related to Cd exposure in Brassica.
[score:1]
[1 to 20 of 1 sentences]
|
34 |
[+]
score:
1
Other miRNAs from this paper: gma-MIR166a, gma-MIR166b, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR166i, gma-MIR166j, gma-MIR166k, gma-MIR166l, gma-MIR166m, gma-MIR166n, gma-MIR166o, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u
Li X. Xie X. Li J. Cui Y. Hou Y. Zhai L. Wang X. Fu Y. Liu R. Bian S. Conservation and diversification of the miR166 family in soybean and potential roles of newly identified miR166sBMC Plant Biol.
[score:1]
[1 to 20 of 1 sentences]
|
35 |
[+]
score:
1
Other miRNAs from this paper: gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR159a, gma-MIR160a, gma-MIR166a, gma-MIR166b, gma-MIR167a, gma-MIR167b, gma-MIR156a, gma-MIR156b, gma-MIR169a, gma-MIR159b, gma-MIR159c, gma-MIR164a, gma-MIR167c, gma-MIR169b, gma-MIR169c, gma-MIR390a, gma-MIR390b, gma-MIR393a, gma-MIR1508a, gma-MIR1510a, gma-MIR1515a, gma-MIR167d, gma-MIR1508b, gma-MIR1510b, gma-MIR2109, gma-MIR167e, gma-MIR167f, gma-MIR167g, gma-MIR156f, gma-MIR169d, gma-MIR169e, gma-MIR4412, gma-MIR4413a, gma-MIR156g, gma-MIR159d, gma-MIR4416a, gma-MIR156h, gma-MIR156i, gma-MIR160b, gma-MIR160c, gma-MIR160d, gma-MIR160e, gma-MIR164b, gma-MIR164c, gma-MIR164d, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR169f, gma-MIR169g, gma-MIR390c, gma-MIR2118a, gma-MIR2118b, gma-MIR1508c, gma-MIR169h, gma-MIR167h, gma-MIR169i, gma-MIR167i, gma-MIR395a, gma-MIR395b, gma-MIR395c, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR159e, gma-MIR159f, gma-MIR166i, gma-MIR166j, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR4413b, gma-MIR167j, gma-MIR393b, gma-MIR4416b, gma-MIR828a, gma-MIR156p, gma-MIR828b, gma-MIR156q, gma-MIR169o, gma-MIR169p, gma-MIR156r, gma-MIR156s, gma-MIR169r, gma-MIR169s, gma-MIR166k, gma-MIR156t, gma-MIR169t, gma-MIR166l, gma-MIR395d, gma-MIR395e, gma-MIR395f, gma-MIR395g, gma-MIR166m, gma-MIR169u, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR160f, gma-MIR164e, gma-MIR164f, gma-MIR164g, gma-MIR164h, gma-MIR164i, gma-MIR164j, gma-MIR164k, gma-MIR166n, gma-MIR166o, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR169v, gma-MIR390d, gma-MIR390e, gma-MIR390f, gma-MIR390g, gma-MIR393c, gma-MIR393d, gma-MIR393e, gma-MIR393f, gma-MIR393g, gma-MIR393h, gma-MIR393i, gma-MIR393j, gma-MIR393k, gma-MIR395h, gma-MIR395i, gma-MIR395j, gma-MIR395k, gma-MIR395l, gma-MIR395m, gma-MIR1515b, gma-MIR167k, gma-MIR167l, gma-MIR169w
They ranged in size from 1 member (e. g. gma-miR828) to 19 members (e. g. miR166) with an average of 7 members per family.
[score:1]
[1 to 20 of 1 sentences]
|
36 |
[+]
score:
1
Other miRNAs from this paper: gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR159a, gma-MIR160a, gma-MIR166a, gma-MIR166b, gma-MIR167a, gma-MIR167b, gma-MIR168a, gma-MIR172a, gma-MIR172b, gma-MIR319a, gma-MIR319b, gma-MIR156a, gma-MIR396a, gma-MIR396b, gma-MIR398a, gma-MIR398b, gma-MIR319c, gma-MIR156b, gma-MIR169a, gma-MIR159b, gma-MIR159c, gma-MIR162a, gma-MIR164a, gma-MIR167c, gma-MIR169b, gma-MIR169c, gma-MIR390a, gma-MIR390b, gma-MIR393a, gma-MIR167d, gma-MIR396c, gma-MIR167e, gma-MIR167f, gma-MIR172c, gma-MIR172d, gma-MIR172e, gma-MIR396d, gma-MIR391, gma-MIR167g, gma-MIR156f, gma-MIR169d, gma-MIR172f, gma-MIR169e, gma-MIR394b, gma-MIR156g, gma-MIR159d, gma-MIR394a, gma-MIR396e, gma-MIR156h, gma-MIR156i, gma-MIR160b, gma-MIR160c, gma-MIR160d, gma-MIR160e, gma-MIR162b, gma-MIR164b, gma-MIR164c, gma-MIR164d, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR168b, gma-MIR169f, gma-MIR169g, gma-MIR319d, gma-MIR319e, gma-MIR319f, gma-MIR390c, gma-MIR394c, gma-MIR398c, gma-MIR408d, gma-MIR169h, gma-MIR167h, gma-MIR169i, gma-MIR396f, gma-MIR396g, gma-MIR167i, gma-MIR403a, gma-MIR403b, gma-MIR395a, gma-MIR395b, gma-MIR395c, gma-MIR397a, gma-MIR397b, gma-MIR408a, gma-MIR408b, gma-MIR408c, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR159e, gma-MIR159f, gma-MIR162c, gma-MIR166i, gma-MIR166j, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR172g, gma-MIR172h, gma-MIR172i, gma-MIR172j, gma-MIR319g, gma-MIR319h, gma-MIR319i, gma-MIR319j, gma-MIR319k, gma-MIR319l, gma-MIR319m, gma-MIR396h, gma-MIR396i, gma-MIR167j, gma-MIR393b, gma-MIR399a, gma-MIR828a, gma-MIR156p, gma-MIR828b, gma-MIR172k, gma-MIR156q, gma-MIR172l, gma-MIR169o, gma-MIR319n, gma-MIR394d, gma-MIR169p, gma-MIR156r, gma-MIR399b, gma-MIR396j, gma-MIR156s, gma-MIR169r, gma-MIR169s, gma-MIR396k, gma-MIR166k, gma-MIR156t, gma-MIR399c, gma-MIR394e, gma-MIR399d, gma-MIR399e, gma-MIR169t, gma-MIR166l, gma-MIR394f, gma-MIR399f, gma-MIR399g, gma-MIR395d, gma-MIR395e, gma-MIR395f, gma-MIR395g, gma-MIR166m, gma-MIR169u, gma-MIR399h, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR160f, gma-MIR164e, gma-MIR164f, gma-MIR164g, gma-MIR164h, gma-MIR164i, gma-MIR164j, gma-MIR164k, gma-MIR166n, gma-MIR166o, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR169v, gma-MIR390d, gma-MIR390e, gma-MIR390f, gma-MIR390g, gma-MIR393c, gma-MIR393d, gma-MIR393e, gma-MIR393f, gma-MIR393g, gma-MIR393h, gma-MIR393i, gma-MIR393j, gma-MIR393k, gma-MIR394g, gma-MIR395h, gma-MIR395i, gma-MIR395j, gma-MIR395k, gma-MIR395l, gma-MIR395m, gma-MIR398d, gma-MIR319o, gma-MIR319p, gma-MIR399i, gma-MIR167k, gma-MIR319q, gma-MIR167l, gma-MIR399j, gma-MIR399k, gma-MIR169w, gma-MIR399l, gma-MIR399m, gma-MIR399n, gma-MIR399o
We also found five families (miR159, miR160, miR164, miR166 and miR168) conserved in gymnosperms and two (miR396 and miR408) in Selaginella.
[score:1]
[1 to 20 of 1 sentences]
|