sort by

5 publications mentioning sma-mir-2a

Open access articles that are associated with the species Schistosoma mansoni and mention the gene name mir-2a. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 4
Moreover, the four novel miRNAs transcribed principally in male adults, including one miRNA (sha-miR-new_46) encoded on the same scaffold as the mir-71/mir-2 cluster (KL250488.1) with a CPM more than 20-times higher than that in the library derived from adult female worms, suggest male-specific roles for these miRNAs in gene regulation. [score:2]
Notably, among the female-biased transcripts were the three miRNAs, sha-mir-71b, sha-mir-2b and sha-mir-2c (encoded in a cluster on scaffold KL251164.1), whereas the related miRNAs sha-mir-71a and sha-mir-2a (encoded in a cluster on scaffold KL250488.1) did not show sex-biased transcription. [score:1]
These results are consistent with reports of a mir-71/mir-2 cluster duplication in S. mansoni [10, 11] and S. japonicum [14, 34] on the female-sex (W) chromosome and on one autosome (chromosome 5), and further support roles in sex-specific traits, sexual differentiation, pairing of adult worms and reproductive processes in schistosomes. [score:1]
[1 to 20 of 3 sentences]
2
[+] score: 4
Five out of the 13 known miRNAs coming from one family named as sja-miR-2, including family members from miR-2a to miR-2e. [score:1]
Blue: the largest family members of miR-2. Two conserved miRNAs named as bantam and let-7 were found in both S. japonicum and S. mansoni miRNAs. [score:1]
Blue: the largest family members of miR-2. Two conserved miRNAs named as bantam and let-7 were found in both S. japonicum and S. mansoni miRNAs. [score:1]
Besides the miR-2 family, another two miRNAs, miR-71 and miR-71b-5p, were also found from one family, which is located on two different scaffolds named as SJC_S000054 and SJC_S000102. [score:1]
[1 to 20 of 4 sentences]
3
[+] score: 3
Duplication of a gene into an autosome has been recently proposed as a way to escape such conflict (reviewed in [36]), and the mir-71/mir-2 cluster duplication appears to be an example of this. [score:1]
The mir-71/mir-2 microRNA cluster is highly conserved in invertebrates, and it has been shown that this cluster is duplicated in Platyhelminthes [25], [28]. [score:1]
This has led some authors to postulate that the mir-71/mir-2 clusters may be involved in sexual maturation in Schistosoma [25]. [score:1]
[1 to 20 of 3 sentences]
4
[+] score: 3
We observed 2 miRNAs (mir-2 and mir-71) expressed in both life cycle stages tested, 7 in adult worms only (mir-4, mir-6, mir-9, mir-32, mir-125, mir-3, mir-5) and 5 in schistosomula only (mir-20, mir-18, mir-22, mir-26, Bantam). [score:3]
[1 to 20 of 1 sentences]
5
[+] score: 3
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-21, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-9-2, mmu-mir-151, mmu-mir-10b, hsa-mir-192, mmu-mir-194-1, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-122, hsa-mir-10a, hsa-mir-10b, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-210, hsa-mir-214, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-122, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-194-1, mmu-mir-192, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-21a, mmu-mir-10a, mmu-mir-210, mmu-mir-214, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-9-1, mmu-mir-9-3, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-365a, mmu-mir-365-1, hsa-mir-365b, hsa-mir-151a, gga-let-7i, gga-let-7a-3, gga-let-7b, gga-let-7c, gga-mir-16-1, gga-mir-194, gga-mir-10b, gga-mir-199-2, gga-mir-16-2, gga-let-7g, gga-let-7d, gga-let-7f, gga-let-7a-1, gga-mir-199-1, gga-let-7a-2, gga-let-7j, gga-let-7k, gga-mir-122-1, gga-mir-122-2, gga-mir-9-2, mmu-mir-365-2, gga-mir-9-1, gga-mir-365-1, gga-mir-365-2, hsa-mir-151b, mmu-mir-744, gga-mir-21, hsa-mir-744, gga-mir-199b, gga-mir-122b, gga-mir-10a, gga-mir-16c, gga-mir-214, sma-let-7, sma-mir-71a, sma-bantam, sma-mir-10, sma-mir-3479, sma-mir-71b, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-let-7k, gga-mir-365b, sma-mir-8437, sma-mir-2162, gga-mir-9-3, gga-mir-210a, gga-mir-9-4, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3, gga-mir-9b-1, gga-mir-10c, gga-mir-210b, gga-let-7l-1, gga-let-7l-2, gga-mir-122b-1, gga-mir-9b-2, gga-mir-122b-2
miR-n1, miR-n2 and miR-2a-3p were below the detection limit (Ct = 50) in both ‘egg -positive’ and ‘egg -negative’ samples. [score:1]
Six of the nine parasite miRNA probes tested (miR-277, bantam, miR-3479-3p, miR-2a-3p, miR-n1, miR-n2) showed a statistically significant signal over noise at 8 or 12 weeks post infection (Fig. 4, p<0.05); the three miRNAs that were not reliably detected (miR-n3, miR-71a-3p, miR-2162-3p) were not analysed further. [score:1]
19959336:- 4 sma-miR-2a-3p UCACAGCCAGUAUUGAUGAAC S_mansoni. [score:1]
[1 to 20 of 3 sentences]