sort by

1 publications mentioning sma-mir-3479

Open access articles that are associated with the species Schistosoma mansoni and mention the gene name mir-3479. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 10
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-21, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-9-2, mmu-mir-151, mmu-mir-10b, hsa-mir-192, mmu-mir-194-1, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-122, hsa-mir-10a, hsa-mir-10b, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-210, hsa-mir-214, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-122, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-194-1, mmu-mir-192, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-21a, mmu-mir-10a, mmu-mir-210, mmu-mir-214, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-9-1, mmu-mir-9-3, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-365a, mmu-mir-365-1, hsa-mir-365b, hsa-mir-151a, gga-let-7i, gga-let-7a-3, gga-let-7b, gga-let-7c, gga-mir-16-1, gga-mir-194, gga-mir-10b, gga-mir-199-2, gga-mir-16-2, gga-let-7g, gga-let-7d, gga-let-7f, gga-let-7a-1, gga-mir-199-1, gga-let-7a-2, gga-let-7j, gga-let-7k, gga-mir-122-1, gga-mir-122-2, gga-mir-9-2, mmu-mir-365-2, gga-mir-9-1, gga-mir-365-1, gga-mir-365-2, hsa-mir-151b, mmu-mir-744, gga-mir-21, hsa-mir-744, gga-mir-199b, gga-mir-122b, gga-mir-10a, gga-mir-16c, gga-mir-214, sma-let-7, sma-mir-71a, sma-bantam, sma-mir-10, sma-mir-2a, sma-mir-71b, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-let-7k, gga-mir-365b, sma-mir-8437, sma-mir-2162, gga-mir-9-3, gga-mir-210a, gga-mir-9-4, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3, gga-mir-9b-1, gga-mir-10c, gga-mir-210b, gga-let-7l-1, gga-let-7l-2, gga-mir-122b-1, gga-mir-9b-2, gga-mir-122b-2
Fold-changes (median with interquartile range indicated) and ROC curves for bantam, miR-277 and miR-3479-3p (Piida- panel A, Chiredzi-panel B) (**p<0.01). [score:1]
Data presented using ROC curves show that the single parasite miRNAs discriminated between S. mansoni ‘egg -negative’ and ‘egg -positive’ with an area under the curve (AUC) of 0.785, 0.790, 0.768 for bantam, miR-277 and miR-3479-3p, respectively, in the individuals from Uganda (Fig. 5A) and 0.889, 0.933, 0.911 in the individuals from Zimbabwe (Fig. 5B). [score:1]
Six of the nine parasite miRNA probes tested (miR-277, bantam, miR-3479-3p, miR-2a-3p, miR-n1, miR-n2) showed a statistically significant signal over noise at 8 or 12 weeks post infection (Fig. 4, p<0.05); the three miRNAs that were not reliably detected (miR-n3, miR-71a-3p, miR-2162-3p) were not analysed further. [score:1]
36251:+ 29 sma-miR-3479-3p UAUUGCACUAACCUUCGCCUUG S_mansoni. [score:1]
However, analysis of three of the parasite-derived miRNAs (miR-277, miR-3479-3p and bantam) could detect infected individuals from low and high infection intensity sites with specificity/sensitivity values of 89%/80% and 80%/90%, respectively. [score:1]
For the cumulative analysis of miRNAs, the arithmetic mean of fold changes for miR-277, miR-3479-3p and bantam were used. [score:1]
By combining data for miR-277, miR-3479-3p and bantam we detected infection with a sensitivity of 80–90% and specificity of 80–89%. [score:1]
Notably, a study published after submission of this manuscript identified 5 miRNAs derived from S. japonicum in the plasma of infected rabbits and 3 of these are identical or homologous to those identified here: bantam, miR-3479-3p and miR-10-5p [70], providing independent validation for the presence of trematode miRNAs in the serum of infected animals. [score:1]
Dot plot comparing cumulative (bantam, miR-277 and miR-3479-3p) miRNA-score between S. mansoni egg positive and negative participants (median with interquartile range indicated) and ROC curves (Piida- panel A, Chiredzi-panel B) (**p<0.01). [score:1]
In contrast, three parasite-derived miRNAs (miR-277, bantam and miR-3479-3p) were detected in the serum of infected mice and human patients and the combined detection of these miRNAs could distinguish S. mansoni infected from uninfected individuals from low and high infection intensity areas with 89%/80% or 80%/90% specificity/sensitivity, respectively. [score:1]
[1 to 20 of 10 sentences]