sort by

216 publications mentioning mmu-mir-145b (showing top 100)

Open access articles that are associated with the species Mus musculus and mention the gene name mir-145b. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 336
Other miRNAs from this paper: mmu-mir-132, mmu-mir-145a, hsa-mir-132, hsa-mir-145
Our study provides compelling evidence that expression of miR-145 causes suppression of tumor growth through the inhibition of MUC13 expression. [score:9]
The overexpression of miR-145 resulted in the potent inhibition of MUC13 protein and its related targets, HER2, pAKT and PAK1 [10], whereas p53 expression was increased (Fig. 3A). [score:9]
This clearly suggests that miR-145 silences the MUC13 expression and regulates the expression of its critical tumor target genes that are involved in pancreatic pathogenesis. [score:8]
We have demonstrated that miR-145 regulates MUC13 expression in PanCa by directly targeting its 3′ UTR (Fig. 1C). [score:7]
We observed that MUC13 is markedly expressed as early as in PanIN lesions and progresses from PanIN I to PanIN III and its expression is inversely correlated to miR-145 expression (Fig. 6). [score:7]
Moreover, miR-145 overexpression directly targets AKT-3 in thyroid cancer [13]. [score:6]
These results strongly suggest that miR-145 negatively regulates MUC13 protein expression and its associated targets. [score:6]
We also observed that ectopic expression of miR-145 in MUC13 -expressing HPAF-II cell lines resulted in MUC13 down regulation at the protein level. [score:6]
The present work suggests that miR-145 is a tumor suppressor in pancreatic cancer and a novel regulator of MUC13 expression. [score:6]
These observations suggest that the consistent decrease in miR-145 expression and subsequent higher expression of MUC13 may play a role in the development and progression of PanCa. [score:6]
This data suggests that miR-145 downregulates MUC13 expression through a post-transcriptional mechanism. [score:6]
Cells transfected with MUT 3′ UTR were resistant to the suppressor activity of miR-145 (Fig. 1D), suggesting that by directly targeting 3′ UTR of the MUC13 transcript. [score:6]
Our study demonstrates no or faint expression of MUC13 in human normal pancreatic tissues while having high miR-145 expression. [score:5]
We experimentally tested this in HPAF-II and Capan-1 cells (which express high levels of MUC13) via transient transfection of miR-145 mimic or non -targeting control mimic (NC). [score:5]
We also investigated the effect of gemcitabine on protein expression of HER2, MUC13 and the gemcitabine target Mcl-1 expression after miR-145 transfection throughting. [score:5]
Additionally, decreased MUC13 expression by miR-145 and its effect on the related targets, HER2 and p53, were also confirmed by immunofluorescence using confocal microscopy. [score:5]
Thus, this suggests that miR-145 inhibits MUC13 and its related targets and leads to tumor regression in xenograft mice. [score:5]
These results indicated that miR-145 is an important tumor suppressor miRNA in PanCa and its replenishment in PanCa cells effectively inhibits their tumorigenic phenotypes (Fig. 2). [score:5]
Real-time PCR analysis showed 6-fold expression in miR-145 expression at 48 h after transfection over control (Data not shown). [score:5]
Recent studies showed that miR-145 targets ADAM17 and suppresses cell invasion in hepatocellular [11] and head and neck cancers [12]. [score:5]
Moreover, IHC analyses of tumor tissues revealed an inhibition of MUC13 expression in miR-145 treated tumors. [score:5]
Early pancreatic intraepithelial neoplasia (PanIN I) has shown moderate levels of MUC13 expression that is predominantly localized at the apical cell membrane and is lower in the cytoplasm, but shows higher miR-145 expression. [score:5]
MUC13 expression is correlated with miR-145 expression in clinical samples. [score:5]
The effect of miR-145 on cell growth and metastasis was studied in PanCa cells, HPAF-II and Capan-1 that possess high constitutive expression of MUC13 and lost expression of miR-145. [score:5]
To determine a correlation of MUC13 expression with miR-145 expression, human tumors and their adjacent normal tissues were used for MUC13 IHC and miR-145 ISH (Fig. 6). [score:5]
miR-145 expression is clinically correlated with MUC13 expression. [score:5]
Additionally, in the wild type MUC13 3′ UTR (WT-MUC13 3′ UTR), a mutant MUC13 3′ UTR (MUT-MUC13 3′ UTR) reporter construct was made by site-directed mutagenesis in the putative target site of miR-145 using Quickchange XL site-directed mutagenesis kit (Agilent Technologies, Santa Clara, CA). [score:5]
A very strong expression of miR-145 was observed in normal tissues adjacent to the cancerous tissues as well as in normal pancreatic tissues with less or no MUC13 expression (Fig. 6C). [score:5]
We have identified that miR-145 regulates MUC13 expression in PanCa. [score:4]
We employed luciferase assay to determine whether miR-145 targets the 3’ UTR of MUC13 mRNA, as indicated by the TargetScan. [score:4]
Additionally, a very recent study showed that miR-145 directly targets the insulin-like growth factor receptor I (IGFR-1) in human bladder cancer cells [19]. [score:4]
The results demonstrate that miR-145 -induced downregulation of MUC13 is associated with slower growth of PanCa cell lines, gemcitabine chemo-sensitivity and tumor growth reduction in pancreatic xenograft mice mo del. [score:4]
miR-145 negatively regulates the expression of MUC13. [score:4]
Our data revealed a significant dose dependent downregulation of MUC13 at the protein level but no apparent change at the transcript level in miR-145 mimic transfected cells (Fig. 1C). [score:4]
To assess whether miR-145 affects gemcitabine sensitivity in PDAC cells, we first determined the miRNA-145 expression in PanCa resistant cell lines. [score:3]
Additionally, we have presented evidence for an inverse correlation of miR-145 and MUC13 expression in human PanCa clinical specimens. [score:3]
This suggested that miR-145 has an ability to target MUC13. [score:3]
The cells treated with miR-145, in the presence of miR-145 inhibitor, had no effect on the basal protein levels (Fig. 3B). [score:3]
Additionally, it was intriguing that gemcitabine treatment resulted in inhibition of cell invasion in AsPC-1 cells that were transfected with miR-145. [score:3]
The use of miR-145 inhibitor confirmed that the cellular and molecular alterations observed were indeed due to miR-145 restoration. [score:3]
In conclusion, this finding suggests that miR-145 is a tumor suppressor in PanCa. [score:3]
Fig. 3 (A and B) Cells were transfected with miR-145 mimic, NC or miR-145 inhibitor in addition to miR-145 mimic for 48 h. Immunoblotting was performed for analysis of indicated proteins. [score:3]
We observed severe inhibition of MUC13 and HER2 levels in mice injected with miR-145 (Fig. 5B). [score:3]
The present study provides important insights into the tumor suppressor role of miR-145 in a well-known tumor-promoting network that includes MUC13. [score:3]
We co -transfected the HPAF-II cells with miR-145 or NC and a firefly luciferase reporter plasmid containing a region of full-length 3′ UTR of MUC13 mRNA harboring the miR-145 target site (position 597–603). [score:3]
miR-145 inhibits growth, clonogenicity and invasion of PanCa cells. [score:3]
miR-145 inhibits tumor growth in vivoThe antitumor effect of miR-145 was confirmed by in vivo experiments using PanCa xenograft mouse mo del. [score:3]
We observed a marked inhibition of cell invasion upon miR-145 transfection (48 h; HPAF-II: miR-145: 90.0±0.5, miR-145+inh: 30.1±3.4, NC: 0.0±2.4, P<0.01; and Capan-1: miR-145: 91.5±0.5, miR-145+inh: 10.3±4.0, NC: 0.0±2.7, P<0.01; Fig. 2C). [score:3]
Inorder to detect the expression of miR-145 in FFPE tissues of control and treated xenograft mice, in situ hybridization technique was used using Biochain kit (catalog number K2191050; Biochain IsHyb In Situ hybridization kit). [score:3]
miR-145 inhibits tumor growth in vivo. [score:3]
However, in adjacent normal tissues, MUC13 was localized at the apical membrane, and its expression was very low while miR-145 was found to be very high. [score:3]
miR-145 was found to be differentially expressed between normal and PanCa cells, including gemcitabine resistant cells, as detected by qRT-PCR (Fig. S2B). [score:3]
miR-145 suppresses proliferation and invasion of PanCa cells. [score:3]
Also, the xenograft tumors from miR-145 treated mice were analyzed for changes in MUC13 and HER2 expression. [score:3]
miR-145 inhibits MUC13 and its associated proteins in PanCa cells. [score:3]
To determine the effect of miR-145 on cell cycle, MUC13 expressing HPAF-II and AsPC-1 cells were transfected with miR-145. [score:3]
The tumor tissue samples were further analyzed for the expression of miR-145 levels, MUC13 and HER2 by in situ hybridization (ISH) and immunohistochemistry (IHC). [score:3]
It has also been demonstrated that miR-145 targets MUC1 in metastatic breast cancer [14], p70S6K1 in colon cancer [15], c-Myc in non-small cell lung cancer [16] and the transcription factor STAT1 in colon cancer [17]. [score:3]
This data suggests that miR-145, besides inhibiting MUC13 and pancreatic tumorigenesis, also sensitizes PanCa cells to gemcitabine treatment. [score:3]
We identified two miRNAs, miR-145 and miR-132 as MUC13 suppressing miRNAs (Fig. S2A). [score:3]
Fig. 5miR-145 inhibits tumor growth in vivoThe antitumor effect of miR-145 was confirmed by in vivo experiments using xenograft mo dels. [score:3]
The inhibitor of miR-145 abrogated the effects of miR-145 in these cells. [score:3]
Dual-luciferase 3′ UTR reporter assay was carried out to validate MUC13 as a direct target of miR-145. [score:3]
Data are presented as percent inhibition of clonogenic ability of miR-145 transfected cells as compared with their respective controls. [score:2]
These observations suggest that the consistent decrease in miR-145 levels may play a role in the development and progression of PanCa. [score:2]
miR-145 regulates MUC13 associated key oncogenes. [score:2]
miR-145 directly binds to the 3′ UTR of human MUC13. [score:2]
To test this, gemcitabine resistant AsPC-1 cells were transiently transfected with miR-145 and then treated with a gemcitabine-conditioned medium (100 nM) for 48 h. The matrigel invasion assay showed that miR-145 decreased the number of invading cells and that gemcitabine showed enhanced effects under miR-145 restoration, clearly suggesting that miR-145 increases gemcitabine sensitivity to inhibit PanCa cell invasion. [score:2]
Cells were transfected with miR-145 mimics, NC in presense or absence of miR-145 inhibitor (Assay id MH11480; Applied Biosystems). [score:2]
Cells were transfected with miR-145 mimics, NC in presence or absence of miR-145 inhibitor (Assay id MH11480; Applied Biosystems) and total protein was extracted from PanCa cells, followed byting as previously described [30, 33]. [score:2]
We studied the biological function and significance of the regulation of MUC13 protein levels by miR-145 in PanCa cells. [score:2]
Further, the miR-145 induced inhibition of cell migration was also performed through scratch assay. [score:2]
PanCa cells, HPAF-II, Capan-I and AsPC-1 cells were transiently transfected with mirVana miR-145 mimics (MC11480; Applied Biosystems), miR-132 mimics (Assay id MC10166; Applied Biosystems) or non -targeting control mimic (NC) (catalog number AM17111; Applied Biosystems). [score:2]
Another interesting observation is that miR-145 suppressed the clonogenic potential of HPAF-II and Capan-1 cells (70%), as determined by colony formation assays (Fig. 2B). [score:2]
This study elucidates the role of miR-145 as a novel regulator of MUC13, a finding that has not previously been reported. [score:2]
Immunofluorescence staining was performed to determine the effect of miR-145 transfection on the protein level of MUC13 and other related key oncogenic proteins. [score:1]
miR-145 increases gemcitabine sensitivity in PanCa cells. [score:1]
and in situ hybridization was used to detect MUC13 and miR-145, respectively, on the tissue microarray slides (procured from US Biomax, Inc. [score:1]
Additionally, the effect of miR-145 transfection on invasiveness was determined by using matrigel chambers (catalog number 734-1048, BD Biosciences), as discussed previously [10]. [score:1]
The values for mir-145 were examined for this condition alone, by comparing the time 7 value to others (‘time 7 vs miR-145). [score:1]
Our study provides important insights into the role of miR-145 in a well-known tumor-promoting network that involves MUC13, which may provide a route to therapeutic miRNA intervention in PanCa. [score:1]
Fig. 1(A) Identification of a putative miR-145 -binding site in the MUC13 3′ UTR region. [score:1]
HPAF-II cells were transiently co -transfected for 48 h with reporter plasmids (0.5 μg, WT or MUT) and 100 nM of miR-145 or NC mimic using Lipofectamine 2000. [score:1]
Additionally, the RNAi experiments using HPAF-II sh-MUC13 [−/−], reciprocated the observed effects that were seen through miR-145 transfection. [score:1]
For time points 19, 22, 26, and 29, mir-145 was significantly different than the control conditions, and was lower. [score:1]
Once palpable tumors developed (average volume 80 mm [3]), mice tumors were treated with miR-145 injections nine times. [score:1]
Thus, in the present study, we sought to delineate the association of alterations in miR-145 levels with MUC13 and its role in PanCa initiation and progression. [score:1]
The luciferase-UTR reporter constructs were generated by inserting the MUC13 3′ UTR carrying a putative miR-145 binding site into pmirGLO control vector (catalog number E1330; Promega). [score:1]
The antitumor effect of miR-145 was confirmed by in vivo experiments using PanCa xenograft mouse mo del. [score:1]
Fig. 6Immunohistochemistry and in situ hybridization was used to detect MUC13 and miR-145, respectively, on the tissue microarray slides (procured from US Biomax, Inc. [score:1]
Three control, six NC and six miR-145 mice groups were used (total of 15 mice). [score:1]
, Rockville, MD) in various (A) PanIN lesions (original magnifications: MUC13 60X; miR-145 20X), (B) adenocarcinoma (original magnifications 60X) and (C) adjacent normal (Adj) (original magnifications: MUC13 40X; miR-145 20X) and normal pancreatic cancer cells (original magnifications: 20X). [score:1]
We observed a several fold increase in the miR-145 levels following transient transfection through qRT-PCR (Fig. S1A). [score:1]
This confirmed that the molecular alterations observed were due to miR-145 restoration. [score:1]
miR-145 increases gemcitabine sensitivity in PDAC cells. [score:1]
This revealed a strong correlation between MUC13 and miR-145 in both tumor and normal tissues. [score:1]
Our investigations revealed that miR-145 is inversely correlated to MUC13 expression in PanCa cell lines (Fig. S2B) and pancreatic tumor tissues (Fig. 6). [score:1]
The levels of miR-145 were observed to be very low or absent in late stage pancreatic intraepithelial neoplasia (PanIN II and III) and at later stages of PanCa. [score:1]
The values at each time point were examined by comparing the two control conditions, control and NC (Cs) vs mir-145 (these analyses are termed ‘Time xx- A vs Cs’) Table S1. [score:1]
miR-145 is a post-transcriptional repressor of MUC13. [score:1]
Tumor volumes (V) were examined as a function of time (discrete), group (control, NC, miR-145), and interaction between them. [score:1]
The antitumor effect of miR-145 was confirmed by in vivo experiments using xenograft mo dels. [score:1]
Seven bases (597 through 603) of the MUC13 3′ UTR are perfect matches (seed sequence) for miR-145 binding. [score:1]
org/), revealed a putative 7-mer-1A binding site for miR-145 in the 3′ UTR of the MUC13 transcript which is highly conserved across several mammalian species (Fig. 1 A, B). [score:1]
The study delineates the association of alterations in miR-145 levels with MUC13 and its potential role in PDAC initiation and progression. [score:1]
Primary analyses involved the comparison (for each time point separately) between control and NC vs mir-145, performed as planned comparisons. [score:1]
miR-145 promotes cell death in PanCa cells. [score:1]
The MUC13+ cells (HPAF-II and Capan-1) were transfected with miR-145 or NC. [score:1]
MiR-145 is also known to regulate OCT4, SOX2, KLF4 and repress pluripotency in human embryonic stem cells [18]. [score:1]
100 nM synthetic miR-145 complexed with 100 μl Invivofectamine 2.0 transfection reagent (catalog number 1377501; Ambion, Austin, TX) in 50 μl PBS was delivered four times intratumorally every alternate day. [score:1]
Furthermore, in vivo studies demonstrated a tremendous reduction in tumor growth in HPAF-II xenograft mice that were injected intratumorally with miR-145. [score:1]
Then, 100 nM synthetic miR-145 complexed with 2 μl siPORT Amine transfection reagent (catalog number AM4502; Ambion, Austin, TX) [34] in 50 μl PBS was delivered for next five times intratumorally every alternate day. [score:1]
These data strongly suggest a role of miR-145 in PanCa progression. [score:1]
This suggested that miR-145 might affect gemcitabine sensitivity in PanCa cells. [score:1]
[1 to 20 of 114 sentences]
2
[+] score: 326
Other miRNAs from this paper: mmu-mir-145a, rno-mir-145
In summary, we have demonstrated that the expression of miR-145 is substantially down-regulated in both ischemia/reperfused heart and H [2]O [2] -treated cardiomyocytes and that miR-145 over -expression confers cardiac protection against oxidative stress -induced cardiomyocyte apoptosis through directly inhibiting the Bnip3 expression and the ROS generation under oxidative stress conditions. [score:13]
In our study, p53 was found to be transiently up-regulated at 15 min and 30 min following the treatment of H [2]O [2], but was subsequently decreased at 1 hour and 2 hour (figure 1C), while miR-145 was continuously down-regulated from 30 min to 8 h after H [2]O [2] treatment, indicating that besides p53, alternative mechanisms may be involved in regulating the miR-145 expression in cardiomyocytes. [score:10]
Our results demonstrated that miR-145 is substantially down-regulated in cardiomyocytes with oxidative stress, and that over -expression of miR-145 significantly inhibited the H [2]O [2] -induced cellular apoptosis, ROS production, mitochondrial structure disruption as well as the activation of key signaling proteins in mitochondrial apoptotic pathway. [score:8]
Quantitative real time PCR revealed that the expression levels of miR-145 were increased after Ad-miR145 transduction (25–100 MOIs) (A), but suppressed by miR-145 inhibitor in a dose -dependent manner (50–100 nM) (B) in cultured NRVMs. [score:7]
Transfection of miR-145 inhibitor significantly suppressed the miR-145 expression (figure 2B). [score:7]
Indeed, ectopic expression of Bnip3 significantly induced apoptosis in cardiomyocytes and this was partially inhibited when miR-145 was over-expressed. [score:7]
0044907.g002 Figure 2 Quantitative real time PCR revealed that the expression levels of miR-145 were increased after Ad-miR145 transduction (25–100 MOIs) (A), but suppressed by miR-145 inhibitor in a dose -dependent manner (50–100 nM) (B) in cultured NRVMs. [score:7]
Noticeably, over -expression of miR-145 substantially inhibited the H [2]O [2] induced cardiomyocyte apoptosis, as determined by TUNEL staining and DNA ladder ELISA, whereas transfection of miR-145 inhibitor increased the rate of H [2]O [2] -induced cardiomyocyte apoptosis (figure 3A–C). [score:7]
Indeed, over -expression of miR-145 markedly down-regulated the activity of luciferease gene fused with the Bnip3 WT-3′-UTR (luc-Bnip3 3′UTR). [score:6]
Indeed, the expression of miR-145 has been shown to be down-regulated in a variety of cancer cells as we observed here in cardiomyocytes treated with H [2]O [2] (figure 1B). [score:6]
Real-time PCR revealed that miR-145 expression was down-regulated in NRVMs treated with H [2]O [2]. [score:6]
Consistent with apoptosis detection assays, over -expression of either Bnip3 CDS or Bnip3 CDS/3′UTR triggered cytochrome C release, whereas over -expression of miR-145 suppressed the Bnip3 CDS/3′UTR -induced cytochrome C translocation (figure 4B). [score:6]
Over -expressing miR-145 Attenuated H [2]O [2] -induced Apoptosis in CardiomyocytesTo determine whether miR-145 plays a role in the regulation of H [2]O [2] -induced apoptosis in cardiomyocytes, we performed the adenovirus -mediated over -expression of miR-145. [score:6]
Since previous studies suggest a role of p53 in regulating miR-145 expression [21], we further detected the p53 expression in H [2]O [2]-treatment cardiomyocytes through western blot and found that the protein levels of p53 increased in the first 30 min following H [2]O [2] treatment, but decreased afterwards (figure 1C). [score:6]
Strikingly, we demonstrated that miR-145 over -expression markedly attenuated the production of ROS in cardiomyoctes in response to oxidative stress, suggesting that miR-145 may exert the cardioprotective effects through regulating not only the expression of Bnip3, but also the activation of it. [score:6]
MiR-145 is a tumor suppressor miRNA that has been recently implicated in the regulation of apoptosis networks in tumor cells through its ability of targeting various anti-apoptotic molecules [7]– [9]. [score:6]
Moreover, the aberrant expression of miR-145 has been shown to be associated with vascular smooth muscle cells’ response to hydrogen peroxide (H [2]O [2]) -induced oxidative stress, indicating that miR-145 may participate in the regulation of the oxidative stress-triggered apoptosis and the regulation of the mitochondrial apoptotic pathway [10]. [score:5]
Expression of MiR-145 was Down-regulated in the Heart in Response to I/R Injury. [score:5]
The miR-145 inhibitor along with control inhibitor was transfected 24 hours after adenoviruses transduction. [score:5]
MiR-145 Regulated Bnip3 Expression through Targeting its 3’UTR. [score:5]
Expression of miR-145 in cardiomyocytes either transduced with Ad-miR145 and transfected with miR-145 inhibitor. [score:5]
MiR-145 regulated Bnip3 expression through targeting the specific binding cites in the 3′UTR of Bnip3. [score:5]
48 hr after transfection, cells were then transfected with 20 nM either miR-145 inhibitor or control inhibitor per 10 [6] cells. [score:5]
The result shows that miR-145 over -expression inhibited the activation of mitochondrial apoptotic pathway. [score:5]
In tumor cells, the p53 mutation and hypermethylation of miR-145 promoter seem to primarily account for the miR-145 down-regulation [21]. [score:5]
Over -expression of miR-145 significantly decreased the activity of luciferase gene fused with Bnip3 wild-type 3′-UTR, but had no effect on the activity of luciferase fused with Bnip3 3′-UTR mutant; (C), Detection of Bnip3 expression by western blot in the whole lysates of NVRMs transduced with different dosages of Ad-miR-145 (50 and 100 MOI). [score:5]
Furthermore, the anti-apoptotic effect of miR-145 was neutralized when Bnip3, one of the predicted miR-145 targets, was over-expressed. [score:5]
MiR-145 expression was down-regulated in ischemia/reperfused heart and H [2]O [2] -treated NRVMs. [score:5]
Since oxidative stress is a common pathological factor shared by many cardiovascular diseases, such as cardiac hypertrophy, cardiomyopathy, and acute myocardial infarction [31]– [32], identification of miR-145 as a novel cardioprotective molecule may potentially enable us to develop additional therapeutic strategies for prevention and treatment of cardiovascular disease. [score:5]
Previously, miR-145 has been shown to inhibit tumor growth mostly through targeting pro-proliferative molecules such as p70S6K and c-myc [25]– [26]. [score:5]
MiR-145 inhibitor (rno-miR-145 inhibitor, Cat. [score:5]
Here, we demonstrate that miR-145 protects against the activation of mitochondria apoptotic pathway in cardiomyocytes under oxidative stress through directly targeting mitochondrial membrane protein Bnip3. [score:4]
Before, it has been reported that human Bnip3 was a direct target of miR-145 [15]. [score:4]
Nevertheless, the mechanism of the down-regulation of miR-145 by oxidative stress is unclear. [score:4]
MiR-145 suppressed expression of Bnip3 through binding to its 3′UTR. [score:4]
To determine whether miR-145 plays a role in the regulation of H [2]O [2] -induced apoptosis in cardiomyocytes, we performed the adenovirus -mediated over -expression of miR-145. [score:4]
For both DNA ladder ELISA and TUNEL assay, cultured NRVMs were transduced with Ad-LacZ or Ad-miR-145 (MOI = 100) and transfected with either 0.5 µg Bnip3 CDS or Bnip3 CDS/3′UTR or rAd-psilence empty vector per 10 [6] cells; and then transfected with 10 nM miR-145 inhibitor or control inhibitor per 10 [6] cells. [score:4]
The down-regulation of miR-145 was also noted in vascular smooth muscle cells treated with H [2]O [2] [10]. [score:4]
Likewise, in cultured cardiomyocytes treated with 50 µM H [2]O [2] for 0.5 hour to 8 hours, the miR-145 mRNA levels were significantly down-regulated (figure 1B). [score:4]
The protein level of Bnip3 also saw a marked dose -dependent down-regulation when Ad-miR-145 was transduced at different MOIs (0, 50, and 100) (Figure 6C). [score:4]
Taking together, these results suggest that Bnip3 is a direct target of miR-145 in cardiomyocytes. [score:4]
In the present study, we identified Bnip3 as a direct target of miR-145 in rat cardiomyocytes. [score:4]
However, in cardiomyocytes, we found that miR-145 modulated the mitochondrial pathway by directly targeting key intermediates in the mitochondrial apoptosis machinery (figure 4, 6C). [score:4]
Since Bnip3 is directly involved in the mitochondrial apoptotic pathway, we asked whether miR-145 could regulate the mitochondrial apoptotic pathway. [score:3]
Namely, Bnip3-CDS contained 621 bp from +1 to +621 nt, and Bnip3-CDS-3′UTR contained 1378 bp from +1 to +1378 nt (+1 designates the translation starting site of rat Bnip3), including the two putative binding sites for miR-145 which located in +1267∼+1272 nt and +1308∼+1313 nt respectively. [score:3]
MiR-145 was considered to be a tumor suppressor microRNA and was shown to suppress tumor cell proliferation and induce cell apoptosis in a variety of tumor cell lines [7]– [9] [25]. [score:3]
To examine whether Bnip3 is a direct target of miR-145, we resorted to luciferase reporter assay. [score:3]
Forced expression of Bnip3 CDS enhanced mitochondrial disruption and abrogated the protective effect of miR-145. [score:3]
As shown in figure 1A, the expression level of miR-145 was significantly decreased, by approximately 50%, in reperfused myocardial tissues. [score:3]
The result showed that the protein level of Bnip3 was suppressed by miR-145 in a dose -dependent manner. [score:3]
Indeed, H [2]O [2] treatment markedly increased the levels of cleaved caspase 3, which were only slightly decreased by miR-145 over -expression. [score:3]
As shown in Figure 5C, H [2]O [2] and Bnip3 CDS, separately or combinatorially led to a strong staining of DCFH-DA, whereas miR-145 produced a relatively dim DCFH-DA staining in cardiomyocytes treated with H [2]O [2] and co -expressing Bnip3 CDS/3′UTR (figure 5B), suggesting that miR-145 attenuated the production of ROS and Bnip3 might be at its downstream. [score:3]
Two micrograms of total RNA were reverse transcribed in a total volume of 20 µl, and real-time PCR using SYBR green fluorescence was performed (BIO-RAD) to detect miR-145 expression as previously described [20]. [score:3]
Indeed, our findings support this viewpoint by showing that the protein levels of released cytochrome C and Apaf-1 were markedly decreased by miR-145 over -expression, whereas the protein levels of cleaved caspase3 were only moderately decreased. [score:3]
These results show that the protection of miR-145 against cardiomyocytes oxidative stress is, at least in part, functionally attributed to its suppression of Bnip3. [score:3]
Over -expressing miR-145 Attenuated H [2]O [2] -induced Apoptosis in Cardiomyocytes. [score:3]
In contrast, in miR-145-over -expressing cardiomyocytes, although small vesicles were presented in mitochondria, the outer membranes of mitochondria were largely intact, the cristae were evident, and the organization of mitochondria was neat and regular (figure 5A). [score:3]
The levels of Apaf-1, cytoplasmic cytochrome C, and mitochondrial Bnip3 were significantly increased in cells treated with H [2]O [2], but markedly decreased by over -expression of miR-145 in a dose -dependent manner (figure 4A). [score:3]
In contrast, over -expression of miR-145 barely affected the activity of luciferase gene fused with the Bnip3 3′-UTR mutant (luc-Bnip3 3′UTR-MU) (figure 6B). [score:3]
In fact, cardiomyocytes express a high level of endogenous miR-145 (Ct value ∼12, data not shown) and transduction of cardiomyocytes with Ad-miR145 further increased the level of miR-145 in a dose -dependent manner (figure 2A). [score:3]
MiR-145 Protected Against Mitochondrial Structure Disruption and Inhibited ROS Production. [score:2]
Taking together, these results suggest that miR-145 plays a protective role against the oxidative stress -induced cardiomyocyte apoptosis and this regulation of miR-145 is linked with Bnip3. [score:2]
Together, these data support an essential role of miR-145 in the regulation of the mitochondrial machinery through modulating the levels of molecules upstream of caspase activation [8]. [score:2]
MiR-145 inhibited H [2]O [2] -induced apoptosis in cultured NRVMs. [score:2]
MiR-145 modulated the expression levels of key apoptosis mediators. [score:2]
These results support that miR-145 regulated cardiomyocyte apoptosis through modulating the mitochondrial apoptotic pathway. [score:2]
Thus, it would be interesting to investigate whether a change of methylation status in miR-145 promoter or an aberrant processing of pre-miR145 may account for the miR-145 down-regulation in cardiomyocytes in response to oxidative stress. [score:2]
p53 has been identified to positively regulate miR-145 maturation [28]. [score:2]
Coincidently, in urothelial cancer cell line, miR-145 also induces a caspase3-independent cell death [8], in a similar way to the caspase-independent apoptosis mediated by Bnip3 [15]. [score:1]
Cardiomyocytes were transduced with Ad-miR145 or Ad-LacZ at 50 or 100 MOI and treated with 50 µM H [2]O [2] or vehicle as indicated. [score:1]
Adenoviruses harboring a 441–base pair DNA fragment encompassing the hsa-mir-145 gene (Ad-miR-145) were generated using the AdMax (Microbix) systems according to the manufacturers’ recommendations. [score:1]
AF243515), the fire luciferase cDNA fused with rat Bnip3 mRNA 3′UTR containing the two seed sequences for miR-145 (308 bp, +1012 to +1319 nt) and 3′UTR without the seed sequence (198 bp, +1012 to +1209 nt) were amplified separately from the genomic DNA of neonatal rat ventricle myocytes (NRVM) and cloned into the pGL3-promoter luciferase reporter vector (Promega, Madison, USA). [score:1]
0044907.g005 Figure 5For both electron transmission microscopy and ROS staining, NRVMs were transduced with Ad-miR-145 or Ad-LacZ (MOI = 100) and transfected with either 1 µg Bnip3 CDS or Bnip3 CDS/3′UTR or rAd-psilence empty vector per 10 [6] cells, and then treated with 50 µM H [2]O [2] for 2 h. (A), under electron transmission microscopy, it was shown that miR-145 attenuated H [2]O [2] -induced mitochondrial structural disruption (swelling, rupture and loss of cristae). [score:1]
For both electron transmission microscopy and ROS staining, NRVMs were transduced with Ad-miR-145 or Ad-LacZ (MOI = 100) and transfected with either 1 µg Bnip3 CDS or Bnip3 CDS/3′UTR or rAd-psilence empty vector per 10 [6] cells, and then treated with 50 µM H [2]O [2] for 2 h. (A), under electron transmission microscopy, it was shown that miR-145 attenuated H [2]O [2] -induced mitochondrial structural disruption (swelling, rupture and loss of cristae). [score:1]
To investigate whether miR-145 expression is altered during myocardial I/R injury, Stem-loop real-time PCR was used to detect the miR-145 mRNA levels in ischemia/reperfused myocardial tissues. [score:1]
The functional significance of miR-145 in the heart, however, has not been explored thus far. [score:1]
0044907.g006 Figure 6 (A), a representative illustration of the putative binding sites for miR-145 in rat Bnip3 3′-UTR. [score:1]
Sequence analysis of rat BNIP-3′UTR revealed two putative miR-145 binding sites located at 1267–1272 nt and 1308–1313 nt, which is highly conserved in both Homo sapiens and Rattus norvegicus (figure 6A). [score:1]
The result shows that miR-145 protected against H [2]O [2] -induced cardiomyocytes apoptosis, which was significantly enhanced by Bnip3. [score:1]
Preconfluent H9c2 cells, in 12-well plates, were transduced with Ad-LacZ and Ad-miR-145 at indicated MOIs for 24 h, then cells were transfected with 300 ng of firefly luciferase reporter plasmid (pGL3-Luc-Bnip3 -3′UTR or pGL3-Luc-Bnip3 -3′UTR MU) and 20 ng of Renilla luciferase reporter plasmid pRL-RSV (Promega) using Lipofectamine 2000 transfection reagent (Invitrogen). [score:1]
Considering that Apaf-1 functions as a linker between cytochrome C and caspase proteins [30], our results suggest there exist non-caspase signaling pathways linking cytochrome C and Apaf-1 to the DNA degradation and miR-145 -mediated protection against cardiac apoptosis may be through these alternative pathways. [score:1]
Accordingly, we constructed two reporter plasmids by cloning the rat Bnip3 3′UTR containing or without the two miR-145 putative binding sites (1267–1272 nt and 1308–1313 nt) (designated as WT and mutant, respectively) into the 3′UTR of pGL3 vector. [score:1]
Quantitative real-time PCR was performed to evaluate the miR-145 levels in cultured cardiomyocytes either transduced with Ad-miR145 or transfected with miR-145 inhibitor. [score:1]
Generation of miR-145 Adenovirus. [score:1]
The miR-145 adenovirus used in this study contained human miR-145 gene (has-miR-145), whose mature miRNA sequence is identical to that of rat miR-145 (rno-miR-145). [score:1]
In the present study, we demonstrated that miR-145 exerted a potent protective effect against the oxidative stress -induced apoptosis in cardiomyocytes (figure 3A–C). [score:1]
The panels show that miR-145 reduced H [2]O [2]-triggered ROS production, which was promoted by Bnip3. [score:1]
The result shows that miR-145 protected against Bnip3 -induced cytochrome C release. [score:1]
However, little is known about whether miR-145 is associated with cardiomyocyte apoptosis under oxidative stress or how it interferes with the mitochondrial apoptotic pathway. [score:1]
For TUNEL staining, cells were cultured in chambers (Milipore, Billerica, USA) at a density of 10 [5] cells/chamber and transduced with Ad-miR-145 or Ad-LacZ. [score:1]
[1 to 20 of 90 sentences]
3
[+] score: 299
Other miRNAs from this paper: mmu-mir-145a, mmu-mir-143, mmu-mir-21a, mmu-mir-21b, mmu-mir-21c
The latter is supported by the following observations: (a) miR-21 is up-regulated, whereas miR-145 is down-regulated in colon cancer CR-HCT-116 cells, highly enriched in CSCs/CSLCs; (b) forced expression of miR-21 through transfection of mature miR-21 in colon cancer HCT-116 cells decreases the expression of miR-145; (c) knock-down of miR-21 by anti-miR-21 increases miR-145 in CR colon cancer cells. [score:12]
The growth inhibition was associated with decreased proliferation of CSCs and induction of their differentiation, as evidenced by reduction in expression of CD44 and induction of CK20 following upregulation of miR-145 or down-regulation of miR-21. [score:11]
In support of this, we found that whereas forced expression of miR-145 in colon cancer cells greatly inhibits CSCs and tumor growth, up-regulation of miR-21 causes an opposite phenomenon. [score:8]
Figure 1Over -expression of miR-145 in colon cancer HCT-116 cells by stably transfected pCMV/miR-145 downregulates miR-21 and induces differentiation, inhibits stemness and produces no visible tumors in SCID mice. [score:8]
Figure 2Chemo-resistance, overexpression of miR-21 and colonosphere formation in colon cancer HCT-116 cells, all of which are associated with increased miR-21 levels, lead to down-regulation of miR-145, and miR-145 and miR-21 negatively regulate each other in chemo-resistant (CR) colon cancer cells. [score:7]
In contrast to miR-21, miR-145 is a p53 regulated tumor suppressor, whose down-regulation has been found in colorectal and other cancers [14, 15]. [score:7]
Forced expression of miR-21 in k-Ras downregulated CR-HT-29 cells resulted in 1-fold increase in miR-145 (Figure  5D). [score:6]
Herein, it is suggested that miR-21 represses miR-145 transcription by stimulating Ras activity that causes RREB1 to repress miR-145 transcription, and that miR-145 inhibits miR-21 transcription through knockdown target Ras (K-RAS) and decreased AP1, the main transcription factor of miR-21. [score:6]
We observed that the expression of tumor suppressive miR-145 in CR HCT-116 cells was decreased by 62% and in miR-21 -overexpressing HCT-116 cells by 90%, when compared with their corresponding parental or empty vector control cells (Figure  2A and B). [score:6]
Our current data show that miR-21 also regulates the expression of the tumor suppressor miR-145. [score:6]
These observations are in contrast to those depicted in Figure  2D, where are show that in cell with intact k-Ras, downregulation of miR-21 produced 6-fold augmentation of miR-145, forced expression of miR-145 resulted in 70% reduction in miR-21. [score:6]
β-actin was used as a loading control, (C) Representative photographs showing colonospheres formed by the cells from miR-145 expressing clones, derived from HCT-116 cells, stably transfected with pCMV-miR-145 plasmid or the corresponding vector (top panel), histogram showing the number of colonspheres formed by miR-145 over -expressing HCT-116 cells, compared to the corresponding vector -transfected control cells (bottom panel, * P < 0.001), (D) while administration of miR-145 over -expressing HCT-116 cells produces no visible tumors in SCID mice, the vector -transfected HCT-116 cells (control) induces large tumors in SCID mice. [score:6]
k-Ras appears to play critical role in the regulation of this process, as evidenced by the fact that the absence of k-Ras in CR colon cancer cells increases miR-145 expression, suppresses miR-21, and interrupts the cooperation between miR-21 and miR-145. [score:6]
k-Ras appears to play critical role in regulation of this process, as evidenced by the fact that the absence of k-Ras in CR colon cancer cells increases miR-145 expression, suppresses miR-21, and interrupts the negative cooperation between miR-21 and miR-145. [score:6]
To further determine whether and to what extent forced expression of miR145 or down-regulation of miR-21 by anti-miR21 would affect the tumorigenic potential of colon cancer cells, SCID mice were subcutaneously injected either with ~ 2.5 × 10 [5] CR HCT-116 or CR HT-29 cells suspended in 100 μl Matrigel. [score:6]
In addition, we observed downregulation of pluripotency factors Oct4, Sox2, Nanog as well as miR-21 following overexpression of miR-145 in colon cancer cells. [score:6]
We observed that the expression of CD44 (colon CSC marker), β-catenin (stem cell growth regulator) and SOX2 (a miR-145 target) was 39%, 356% and 1600% higher, respectively, whereas the levels of PDCD4 and CK20 were 40% and 95% lower in CR HT-29 xenografts, when compared with the values from xenografts of parental HT-29 cells (Figure  3). [score:5]
This inference is further supported by our in vivo experiments which demonstrate that increase of miR-145 or inhibition of miR-21 by injecting PEI mediated chemically engineered modified single-stranded RNA or analogues complementary to miRNA which are efficient, specific and long-lasting replacements or silencers of endogenous miRNAs in mice [24, 31] leads to suppression of xenograft growth in SCID mice. [score:5]
miR-145 also inhibits colon cancer cells’ proliferation and sensitizes them to 5-fluorouracil by targeting oncogenic FLI1 [27]. [score:5]
These results indicate that overespression of miR-21 is associated with downregulation of miR-145 and vice versa in colon cancer cells and that both miR-21 and miR-145 are involved in regulating the growth of colonospheres, enriched in CSCs. [score:5]
Over -expression of miR-145 induces differentiation, inhibits stemness and xenograft tumors in SCID mice. [score:5]
Herein, we report that stable over expression of miR-145 in colon cancer HCT-116 or HT-29 cells or in the corresponding CR colon cancer cells significantly induces differentiation and inhibits their growth in vitro. [score:5]
To determine the putative functional properties of miR-145 in the development of colorectal tumor and its relation to miR21 expression, pCMV/miR145 plasmid (Origene, Rockville, MD) was stably transfected in HCT-116 cells. [score:4]
These reports support our data and further demonstrate the mechanism by which miR-21 negatively regulates tumor suppressor miR-145. [score:4]
We found the expression of miR-21 to be greatly increased and miR-145 decreased in CR colon cancer cells that are highly enriched in CSC, indicating a role for these miRNAs in regulating CSCs. [score:4]
These results indicate that miR-21 negatively regulates the expression of miR-145 in colon cancer cells. [score:4]
Pleuripotency factors Sox2, Nanog and Oct4 are the direct targets of miR-145. [score:4]
Spizzo R Nicoloso MS Lupini L Lu Y Fogarty J Rossi S miR-145 participates with TP53 in a death-promoting regulatory loop and targets estrogen receptor-alpha in human breast cancer cellsCell Death Differ. [score:4]
Down-regulation of miR-145 has been found in multiple tumors including colon, breast, prostate, pancreas etc. [score:4]
Moreover, miR-145 negatively regulates junctional cell adhesion molecule (JAM-A), fascin and MUC1 and suppresses breast cancer cell motility and invasiveness [25, 26]. [score:4]
revealed that the levels of Sox2, the target of miR-145 were decreased by 34% and the expression of cytokeratin-20 (CK-20), the differentiation marker was increased by 67%, compared to the vector -transfected controls (Figure  1B). [score:4]
Our current data further suggest that the tumor suppressor miR-145, oncomiR miR-21 and their networks are critically involved in regulating these events. [score:4]
In fact, miR-145 has been well documented as a tumor suppressor gene because it negatively regulates multiple oncogenes such as Myc, K-Ras, IRS-1, ERK5 [15, 24]. [score:4]
The tumorigenic potential of parental and CR-HT-29 cells in SCID mice was inhibited by administration of miR-145 or anti-miR-21. [score:3]
These observations suggest that k-Ras mediates the negative feedback between the tumor suppressor miR-145 and oncomiR miR-21 in CR colon cancer cells. [score:3]
Tumorigenic potential of the miR-145 overexpressing cells was analyzed by generating xenograft tumors in SCID mice. [score:3]
We then determined the effectiveness of miR-145 in suppressing the growth of colon cancer xenografts in SCID mice. [score:3]
Down-regulation of k-Ras in CR HT-29 cells, that caused a 45% increase in miR-145, produced a 35% reduction in miR-21, when compared with the corresponding controls (Figure  5C). [score:3]
Number of spheroids formed as well as the frequency to form spheroids by miR-145 expressing HCT-116 cells was found to be about 88% lower than those formed by the vector -transfected control cells (p <0.001) (Figure  1C and Table  1). [score:3]
Generation of miR-145 over -expressing HCT-116 cells. [score:3]
Collectively, the current data suggest a negative feedback between the tumor suppressor miR-145 and oncomiR miR-21 in CR colon cancer cells. [score:3]
Our current observations suggest that dysregulation of miR-21 and miR-145 plays a central role in the growth of CSCs in chemo-resistant colon tumors by regulating a network of genes that are critically involved in tumor progression, metastasis, and relapse of colorectal cancer. [score:3]
At the end of the experiment, a small portion of the tumors from CR-HT-29 cells and those treated with (PEI)/miRNA-145 or vehicle complex was used for RNA extraction and analyzed for the expression of various markers of CSC growth and differentiation by real time PCR. [score:3]
But, increasing the levels of miR-145 in k-ras downregulated CR-HT-29 cells resulted in no significant reduction in miR-21, compared with corresponding control (Figure  5D). [score:3]
Further, the average diameter of spheroids, obtained from miR-145 overexpressing cells, was found to be smaller than the controls (Table  1 and Figure  1C). [score:3]
Restoration of miRs level by increasing miR-145 or decreasing miR-21 can dislodge Ras mediated feedback between miR-145 and miR-21 and inhibit tumor growth. [score:3]
Briefly, single cell suspension obtained from adherent miR-145 -expressing HCT-116 and vector -transfected (control) HCT-116 cells were plated at concentrations of 200, 20 and 2 cells per 100 μl SCM (24 well for each dilution) in 96-well plates and incubated for 5 days. [score:3]
miR-145 and, anti-miR-21 inhibit tumorigenic potential of chemo-resistant (CR) colon cancer HT-29 cells in SCID mice. [score:3]
This was associated with decreased expression of CD44, β-catenin, Sox-2 and induction of CK-20 indicating that administration of miR-145 or antagomir-21 decreases CSC proliferation and induces differentiation. [score:3]
To determine the tumorigenic potential of miR-145 overexpressing HCT-116 cells, SCID mice were subcutaneously (s. c. ) injected with ∼ 2.5 × 10 [5] HCT-116 cells that were stably transfected with pCMV/miR-145 or pCMV (control). [score:3]
The levels of miR-145 and miR-21 were manipulated by transfection of mature, antago-miRs or pCMV/miR-145 expression plasmid. [score:3]
After 2 days of transfection, the cells were collected and analyzed for protein expression of k-Ras using western blot and for quantitation of miRNA-21 and miR-145 by qRT-PCR according to our standard protocol. [score:3]
To determine whether and to what extent miR-145 over -expression affects the sphere forming properties of colon cancer cells, HCT-116 cells stably transfected with pCMV/miR-145 or pCMV vector (control) were subjected to an extreme limiting dilution analysis (ELDA). [score:3]
These results indicate that administration of miR-145 greatly decreases CSC proliferation and induces differentiation leading to suppression of tumor growth in SCID mice. [score:3]
In addition, administration of mature miR-145 or antagomir-21 (anti-sense miR-21) greatly suppresses the growth of colon cancer cell xenografts in SCID mice. [score:3]
The next set of experiments was carried out to determine whether miR-145 may regulate stemness of colon cancer cells. [score:2]
Our current observations suggest that miR-21, miR-145, and their networks play critical roles in regulating CSCs growth and/or differentiation in the colon cancer and progression of chemo-resistance. [score:2]
In the miR-145 positive feedback loop, miR145 increases its transcription via knock-down Ras and RREB1, the transcription repressor of miR-145. [score:2]
In vitro studies further demonstrate that miR-21 negatively regulates miR-145 and vice versa. [score:2]
We also report that miR-21 negatively regulates miR-145 and vice versa. [score:2]
miR-145 and miR-21 cooperation plays a role in regulating cancer stem cell proliferation and differentiation. [score:2]
In contrast, miR-21 was decreased by 50% in miR-145 overexpressing cells, compared to the vector -transfected control cells (Figure  1A). [score:2]
In addition, we observed that while the levels of miR-145 were decreased by ~70% in colonospheres formed by the parental HCT-116 cells, the expression of miR-21 was increased by ~180% in these colonospheres, when compared with the corresponding parental HCT-116 cells (Figure  2C). [score:2]
The expression of CD44, β-catenin and SOX2 was decreased by 45%, 34% and 36%, and PDCD4 and CK20 was increased significantly by 10% and over 4000%, respectively, in CR-HT-29 xenografts from (PEI)/miRNA-145 complex -treated xenograft, compared to those fromed by vehicle- treated (control) CR HT-29 cells (Figure  4B). [score:2]
As determined by qRT-PCR (real time PCR) analysis, the expression of miR-145 was found to be 4-fold higher in the miR-145 positive cells, compared to empty vector (Figure  1A). [score:2]
The results revealed that treatment with (PEI)/miRNA-145 complex significantly suppressed tumor growth, compared with the vehicle -treated controls (Figure  4A). [score:2]
In the next set of experiments we tested whether there is a cooperation between miR-145 and miR-21 and how this cooperation may regulate cancer stem cell proliferation and differentiation. [score:2]
miR-145 is a p53-regulated gene. [score:2]
medium prior to adding the complexes containing 100 pmol of scrambled (control), k-Ras siRNA (Integrated DNA Technologies, Coralville, IA) or/and pre-miR-145, pre-miR-21. [score:1]
Self-renewing/regeneration abilities of the spheres, derived from pCMV and miR-145 stably transfected HCT-116 cells, were analyzed for secondary colonospheres formation in the following manner. [score:1]
These data further suggest that a negative feedback exists between miR-21 and miR-145. [score:1]
Once palpable tumors were formed, SCID mice bearing xenografts were treated with PEI/miRNA-145, PEI/anti-miRNA-21 complexes or PEI/control once a week by i. p. injection of 0.45 nmol (6 μg) for 3 weeks [24]. [score:1]
The relative level of miR-145 in the tumor of SCID mice injected with miR-145 was about 50% higher than the control tumor (Figure  4A; lower panel). [score:1]
Once palpable tumors were developed (~3 weeks), Polyethylenimines (PEI)/miRNA-145 complex treatment (i. p. ; weekly) was initiated. [score:1]
The ability of miR-145 -overexpressing and parental HCT-116 cells to form spheres in suspension was evaluated as described previously [18]. [score:1]
Upper panel shows intact xenograft tumor after treatment with PEI/miR-145 or the corresponding controls, and the lower panel shows the relative levels of miR-145 in the tumor after treatment with PEI/miR-145 or the corresponding controls. [score:1]
Following transfection of anti-miR21 in CR-HT-29 cells, there was a marked 6-fold increase of miR-145 (Figure  2D). [score:1]
Each cell line was subjected to RT-PCR analysis to evaluate miR-145 expression. [score:1]
We observed that while the HCT-116 pCMV empty vector -transfected (control) cells formed palpable tumor within 3 weeks of injection, no tumor could be detected with HCT-116 pCMV/miR-145 cells even after 6 weeks (Figure  1D). [score:1]
To determine whether and to what extent miR-145 or anti-miR-21 would affect the tumorigenic potential, xenografts in SCID mice formed by colon cancer parental HT-29 or CR-HT-29 cells were first analyzed for the presence of markers of CSCs/CSLCs and their growth and differentiation. [score:1]
pCMV-miR-145 plasmid carrying pre-microRNA-145 and 250–300 nts up and down-stream flanking sequence (Origene, Nockville, MD) or empty vector DNA alone (pCMV) was transfected into HCT-116 cells by Lipofectamine™ 2000 reagent according to the manufacturer's instructions (Invitrogen Corp, CA). [score:1]
In view of these reports together with our current observations prompted us to hypothesize that the negative feedback between miR-21 and miR-145 mediated by Ras signaling pathway plays a crucial role in the induction of CSC proliferation or/and differentiation in CR colon cancer cells, as depicted in Figure  5A. [score:1]
Briefly, primary colonospheres were generated by incubating the limited number of pCMV and miR-145 stably transfected HCT-116 cells at a concentration of 1000 cells per 500 μL in serum-free stem cell medium (SCM) containing DMEM/F12 (1:1) supplemented with B27 (Life Technologies, Gaithersburg, MD), 20 ng/ml EGF (Sigma, St Louis, MO), 10 ng/ml fibroblast growth factor (Sigma), and antibiotic-anti-mycotic in 24-well plates (Corning Inc, Lowell, MA) for 10 days. [score:1]
On the other hand, miR-21 can be decreased by elevating the levels of miR-145 through transfection of mature miR-145 in parental and CR colon cancer cells. [score:1]
Transfection of miR-145, miR-21, anti-miR-21 or k-Ras siRNA in colon cancer cells. [score:1]
Figure 5The feedback circuits between miR-21 and miR-145. [score:1]
Quantitation of miRNA-21 and miR-145. [score:1]
p53 can induce its transcription and enhance the post-transcriptional maturation of miR-143/miR-145 cluster [15, 20] in response to DNA damage by interacting with the Drosha processing complex [21]. [score:1]
[1 to 20 of 88 sentences]
4
[+] score: 294
Consistent with the important role of Sox9 in regulating chondrogenesis, our results indicate that over -expression of miR-145 via pre-mR-145 precursor resulted in inhibition of C3H10T1/2 mesenchymal stem cells chondrogenic differentiation, as reflected by a decrease in the expression of Sox9 at the post-transcriptional level and a decrease in the mRNA expression of early chondrogenic markers including Col2a1, Col9a2, Col11a1 and Agc1. [score:10]
Importantly, over -expression or suppression of miR-145 resulted in inhibiting or promoting chondrogenic differentiation, respectively. [score:7]
Taken together, miR-145 represents a key regulator for suppressing the chondrogenic phenotype in C3H10T1/2 cells by its ability to directly target Sox9 and probably be responsive to TGF-β3. [score:7]
It reveals that miR-145 repressed Sox9 expression via its binding with imperfect complementation to the Sox9 mRNA 3′-UTR through translational inhibition. [score:7]
The attenuation of miR-145 expression positively regulates its direct target gene Sox9, and results in promoting chondrogenic differentiation of mesenchymal stem cell line. [score:7]
Both in over -expression and suppression of miR-145 experiments, we found Sox9 differential expressed at the post-transcriptional level but not at the mRNA level. [score:7]
Accordingly, miR-145 may regulate the process of chondrogenic differentiation by suppressing other target genes besides Sox9. [score:6]
Through dual-luciferase reporter gene assay and gain- or loss-of-function experiments, we demonstrated that miR-145 can target and suppress the expression of SRY-related high mobility group-Box gene 9 (Sox9). [score:6]
In this study we identified that miR-145 can suppress TGF-β3 -induced chondrogenic differentiation of MSCs by directly targeting Sox9, the key transcription factor for chondrogenesis, at the post-transcriptional level. [score:6]
0021679.g001 Figure 1Down-regulated expression of miR-145 in murine MSCs induced by TGF-β3 was identified by qRT-PCR at different stage of chondrogenic differentiation (0 d, 7 d, 14 d). [score:6]
Down-regulated expression of miR-145 in murine MSCs induced by TGF-β3 was identified by qRT-PCR at different stage of chondrogenic differentiation (0 d, 7 d, 14 d). [score:6]
Our luciferase reporter analysis showed that both exogenous miR-145 and anti-miR145 inhibitor regulated expression of luciferase when miR-145 MREs from Sox9 3′-UTR was fused to the luciferase and the effect lost when the scrambled MREs sequence was used. [score:6]
Thus, these data demonstrate miR-145 inhibits Sox9 protein expression but not mRNA levels in mesenchymal stem cell line at early stage of chondrogenic differentiation. [score:5]
Over -expression of mir-145 inhibits early chondrogenic differentiation of C3H10T1/2 cells. [score:5]
Co-transfection of pre-miR-145 with wild-type pMIR-MRE resulted in a suppression of luciferase gene expression, but co-transfection of pre-miR-145 and mutant pMIR-MUT did not (Figure 2B). [score:5]
Inhibition of endogenous miR-145 expression in C3H10T1/2 cells by transfection of anti-miR-145, under the same induction conditions as above, resulted in enhancing chondrogenic differentiation as shown by a significant increase in chondrogenesis markers at mRNA level (Figure 5A) and alcian blue staining intensity (Figure 5B). [score:5]
Using Pictar and Targetscan online software for prediction, we found several potential target genes of miR-145 closely related with chondrogenesis, specifically transcription factor Sox9 which is the primary determinant during the early stages of chondrogenesis. [score:5]
Subsequently, we performed bioinformatic analyses to predict the target genes of miR-145 using Pictar [35] and Targetscan [36]. [score:5]
In contrast, inhibition of miR-145 enhanced chondrogenic differentiation as evidenced by the remarkably increased expression of Col2a1, Col9a2, Col11a1, Agc1 and COMP mRNAs. [score:5]
These results reveal that miR-145 over -expression inhibits early chondrogenic differentiation. [score:5]
The micromass pellets which were treated with either pre-miR-145 or anti-miR-145 inhibitor were induced to chondrocytes for 24 h. Subsequently, all micromass pellets were trypsinized by 0.25% trypsin and directly counted using a hemacytometer. [score:4]
These data indicate miR-145 can suppress expression of transcripts containing an exact miR-145 -binding site by our luciferase reporter assay. [score:4]
MSCs ready for miR-145 expression analysis were directly induced to chondrogenic differentiation. [score:4]
MiR-145 inhibits Sox9 expression at early stage of chondrogenic differentiation. [score:4]
It suggest that the effect of miR-145 regulating chondrogenic differentiation depends on Sox9 -mediated the promotion of its target genes associated with cartilage, such as Col2a1, Agc1 and COMP, etc. [score:4]
Although miR-145 has been known to be involved in vascular pathogenesis via maintaining the differentiation status of smooth muscle cells (SMCs) and regulation of embryonic stem (ES) cells self-renewal program [27], [48], we have identified another complementary function to inhibit Sox9 -mediated chondrogenesis. [score:4]
Noticeably, we found Sox9 was the potential target gene regulated by miR-145. [score:4]
Furthermore, down-regulation of miR-145 may act as positive effect on chondrogenic differentiation. [score:4]
To investigate whether miR-145 inhibition that leads to an increase in Sox-9 protein expression affects cell proliferation, we assessed the proliferation of C3H10T1/2 cells by direct cell counting. [score:4]
These results suggest that miR-145 may regulate Sox9 expression by binding the MREs within the Sox9 3′-UTR and prompt us to investigate whether miR-145 effects chondrogenesis via targeting Sox9. [score:4]
The chondrogenic differentiation medium composed of dexamethasone, ascorbate, ITS+ Supplement, sodium pyruvate, proline and TGF-β3 was replaced every 2 d. To validate the expression pattern of miR-145, which emerged in the microarray results, qRT-PCR was performed. [score:3]
Our results showed that miR-145 has not effected the mRNA expression of C/EBPβ and C/EBPδ after induction of chondrogenic differentiation (Figure 6). [score:3]
Suppression of mir-145 enhances early chondrogenic differentiation of C3H10T1/2 cells. [score:3]
MiR-145 is down-regulated during TGF-β3 -induced murine MSCs chondrogenic differentiation. [score:3]
Here, we show that miR-145 has a complementary role in suppressing chondrogenic differentiation of the murine embryonic mesenchymal cell line C3H10T1/2 cells. [score:3]
However, treatment of C3H10T1/2 cells with either pre-miR-145 or anti-miR-145 inhibitor did not significantly effect the cell proliferation (Figure 7). [score:3]
In the dose -dependent experiment to explore the efficiency of miR-145 inhibition, 2.5 pmol, 5 pmol, 10 pmol of pre-miR-145 were used, respectively. [score:3]
The results of qRT-PCR and alcian blue staining have shown that modulation of miR-145 effected the expression of genes and GAGs related to chondrocyte after induced for 7 d. However, the same effect did not last for 14 d (Figure 4, 5). [score:3]
Taken together, our data suggest that miR-145 could target Sox9 by binding the MREs within the Sox9 mRNA 3′-UTR. [score:3]
To demonstrate whether miR-145 acts as attenuator of Sox9 protein expression, we transfected C3H10T1/2 mesenchymal stem cells with either pre-miR-145 or anti-miR-145 for 24 h, and then exposed the transfected cells to the chondrogenic differentiation medium primarily consisting of TGF-β3. [score:3]
In addition we found that anti-miR-145 could overcome the suppression effect when it was co -transfected with pMIR-MRE and pre-miR-145. [score:3]
Differential expression of miR-145 during chondrogenic differentiation of murine MSCs. [score:3]
According to the primary role of Sox9 in the process of MSCs differentiation into chondrocytes, we hypothesized that Sox9 may be inhibited by miR-145, which prevents MSCs from differentiating into chondrocytes. [score:3]
The similar differential expression patterns of miR-145 had been described in previous studies. [score:3]
After we co -transfected this reporter plasmid into HEK293 cells with pre-miR-145 or its control pre-miR, we found that luciferase expression significantly decreased in the HEK293 cells transfected with pre-miR-145 (Figure 2B). [score:3]
After induction of chondrogenic differentiation by medium containing TGF-β3 for 1 d and 7 d, qRT-PCR analysis of C3H10T1/2 cells transfected with pre-miR-145 showed a significant decrease in the mRNA expression levels of chondrogenesis markers including Col2a1, Agc1, COMP, Col9a2 and Col11a1 (Figure 4A). [score:3]
As expected for the mechanisms of miRNAs regulation, measured by western blot assay, Sox9 protein level was notably decreased in the cells of miR-145 over -expression and increased in the cells of miR-145 suppression at 1 d and 7 d but not at 14 d by TGF-β3 treatment (Figure 3A). [score:3]
Target sequences for a consensus miR-145 -binding site (PT), two copies of the endogenous MREs sequence in the Sox9 mRNA 3′-UTR (MRE) and corresponding two copies of the MREs with a scrambled MREs sequence (MUT) were synthesized (Invitrogen) and cloned into the SpeI/ HindIII site of the pMIR-REPORT Firefly Luciferase reporter vector (Ambion) using standard DNA techniques. [score:3]
The relative expression level of miR-145 in untreated MSCs (0 d) was set to one, as control. [score:3]
Our microarray and qRT-PCR data demonstrate the gradually decreased expression of mature miR-145 during TGF-β3 -induced chondrogenic differentiation of murine MSCs. [score:3]
The miRNAs transfected into cells were purchased from Ambion, including pre-miR-145 precursor, anti-miR-145 inhibitor and their respective negative controls. [score:3]
After TGF-β3 treatment, the decrease in expression of miR-145 allows for the positive effect on chondrogenesis of Sox9, therefore facilitating chondrogenic differentiation. [score:3]
The expression of miR-145 significantly decreased during chondrogenic differentiation. [score:3]
Mir-145 directly targets Sox9. [score:3]
Furthermore, mir-145 has no effect on expression of C/EBPβ and C/EBPδ at mRNA levels in the chondrogenic differentiation. [score:3]
Collectively, our data demonstrate that miR-145 act as a key negative regulator of early chondrogenic differentiation. [score:2]
Thus qRT-PCR assay was performed to validate the expression pattern of miR-145 in this study. [score:2]
MiR-145 inhibits early chondrogenic differentiation. [score:2]
Because the condensation and proliferation of mesenchymal cells is the initial step of chondrogenesis and skelotogenesis, we used directly counting cells numbers from micromass pellets to detect the proliferation of C3H10T1/2 cells which were transfected with pre-miR-145 or anti-miR-145, respectively. [score:2]
To determine if miR-145 targets Sox9, we applied the luciferase report gene assay using the pMIR-REPORT Luciferase reporter. [score:2]
To investigate whether the regulation effect of miR-145 mediated by Sox9 is specific to chondrogenesis, we measured the mRNA expression level of other Sox9 non cartilage target genes. [score:2]
Mir-145 has no influence on mRNA expression of C/EBPβ and C/EBPδ. [score:2]
Our findings indicate that miR-145 plays a key role in chondrogenesis and may provide a novel mechanism in miRNA -mediated regulation of chondrogenic differentiation of MSCs. [score:2]
Additionally, compared with the expression level in human cartilage chondrocytes, miR-145 is also decreased in dedifferentiation of chondrocytes as validated by microarray and qRT-PCR analysis [47]. [score:2]
Therefore, with the combination of our microarray and qRT-PCR data, miR-145 emerged as a candidate with significant potential to participate in the regulation of chondrogenic differentiation. [score:2]
On basis of current results, we only demonstrate miR-145 can regulate chondrogenesis at early stage. [score:2]
Mir-145 represses the expression of Sox9 at protein level in early stage of chondrogenic differentiation. [score:2]
Thus, miR-145 may regulate chondrogenesis by repressing not only Sox9 but also other genes. [score:2]
It suggests that the effect which miR-145 regulate chondrogenic differentiation of MSCs mediated by Sox9 in response to TGF-β3 is a specific influence on genes associated with chondrogenesis. [score:2]
MiR-145 targets Sox9 by binding 3′-UTR of Sox9 mRNA. [score:2]
C3H10T1/2 cells were transfected with anti-miR-145 or its control respectively. [score:1]
In conclusion, our studies demonstrate that miR-145 is decreased during TGF-β3 -induced chondrogenic differentiation of murine MSCs. [score:1]
C3H10T1/2 cells were transfected with pre-miR-145 or its control respectively. [score:1]
However, the effect of anti-miR-145 was abolished when pMIR-MUT was used instead of pMIR-MRE (Figure 2D). [score:1]
However, we can not find the certain evidence that miR-145 would effect on the terminal differentiation of chondrogenesis by a long-time effect (for 14 d). [score:1]
The cell lysates from micromass cultures of C3H10T1/2 cells transfected with pre-miR-145 or anti-miR-145 were extracted with lysis buffer containing 50 mM Tris (pH 7.6), 150 mM NaCl, 1% TritonX-100, 1% deoxycholate, 0.1% SDS, 1 mM PMSF and 0.2% Aprotinin (Sigma). [score:1]
Unexpectedly, there is no significant difference between pre-miR-145 or anti-miR-145 treatment pellets and their control treatment pellets. [score:1]
0021679.g002 Figure 2(A) A schematic shows that the 5′ end of miR-145 contains a sequence complementary to the specific miRNA binding site within the 3′-UTR of Sox9 mRNA. [score:1]
Before chondrogenic differentiation, C3H10T1/2 cells ready for gain- or loss-of-function analysis, were transfected with pre-miR-145, anti-miR-145 or their negative controls. [score:1]
0021679.g003 Figure 3 (A) C3H10T1/2 cells were transfected with pre-miR-145, anti-miR-145 or their control individually. [score:1]
Other studies have identified the function of miR-145 involved in various oncogenic pathways [24], [25], [26], the differentiation of embryonic stem (ES) cells [27] and smooth muscle cells (SMCs) fate decisions [28], [29], [30]. [score:1]
The results suggest that miR-145 has a specific influence on genes associated with chondrogenesis in response to TGF-β3. [score:1]
The culture medium was replaced every 2–3 d. To demonstrate the functional relevance of miR-145, pre-miR-145 (a final concentration of 50 nM), anti-miR-145 (a final concentration of 150 nM) or their negative controls were transfected, respectively, into C3H10T1/2 cells in 6-well pellets (10 [5] cell per well) with 5 µl siPORT NeoFX transfection agent (Ambion) following the manufacturer's instructions. [score:1]
Pre-miR-145 or its negative control was co -transfected with pMIR-MRE into HEK293 cells. [score:1]
C3H10T1/2 cells were transfected with pre-miR145, anti-miR-145 or its control, respectively. [score:1]
The results confirmed that miR-145 gradually decreased in MSCs, which were induced by TGF-β3 (Figure 1). [score:1]
Our results suggest that miR-145 acts as a key mediator to antagonize early chondrogenic differentiation via attenuating the effect of transcription factor Sox9. [score:1]
0021679.g004 Figure 4C3H10T1/2 cells were transfected with pre-miR-145 or its control respectively. [score:1]
0021679.g005 Figure 5C3H10T1/2 cells were transfected with anti-miR-145 or its control respectively. [score:1]
To explore whether miR-145 has an effect on chondrogenic differentiation, we transfected either pre-miR-145 or anti-miR-145 into C3H10T1/2 cells. [score:1]
Moreover, alcian blue staining intensity were decreased following pre-miR-145 treatment for 3 d and 7 d (Figure 4B). [score:1]
Pre-miR-145 (a final concentration of 50 nM), anti-miR-145 (a final concentration of 50 nM), their negative controls and non -transfected controls were transfected into C3H10T1/2 cells in 6-well pellets, respectively. [score:1]
Firstly, we constructed a reporter vector containing a consensus miR-145 -binding site within the 3′-UTR (pMIR-PT, Table 1) as a positive control. [score:1]
The Sox9 3′-UTR contains one putative miR-145 seed site which is bound with imperfect complementation (Figure 2A). [score:1]
0021679.g007 Figure 7. C3H10T1/2 cells were transfected with pre-miR145, anti-miR-145 or its control, respectively. [score:1]
0021679.g006 Figure 6.C3H10T1/2 cells were transfected with pre-miR145, anti-miR-145 or its control, respectively. [score:1]
Computational algorithms predicted that miR-145 would bind to the Sox9 3′-UTR with imperfect complementation, suggesting that it may not result in Sox9 mRNA cleavage. [score:1]
In this study, to determine the roles of miRNAs in chondrogenic differentiation of MSCs, we focused on characterization of miR-145 whose expression level was gradually decreased during TGF-β3 -induced chondrogenic differentiation of murine MSCs [23]. [score:1]
[1 to 20 of 98 sentences]
5
[+] score: 287
miR-143 downregulates the expression of c-Myc, cyclin D1 and c-jun through inhibiting ERK5 expression, and upregulates miR-145, probably by elevating the common transcript of endogenous pri-miR-143/pri-miR-145. [score:13]
Forced Expression of miR-143 Induced miR-145 Expression in the Small Intestine Tumors of Apc [Min/+] Mice and Suppressed the Tumor DevelopmentTo express miR-143 ubiquitously in whole body, we made a construct which carried ∼300 bp human pri-miR-143 fragment under the CAG regulatory unit, composed of CMV enhancer and chicken β-actin promoter, and injected it into the fertilized mice eggs [17] (Fig. 1A). [score:11]
Since Sachdeva et al. recently revealed that miR-145 when activated by p53 directly suppressed c-Myc expression, it is likely that miR-143 and miR-145 complement each other to downregulate c-Myc expression in our experimental systems [24]. [score:11]
The data of our transfection experiments, together with these previous studies, suggest that miR-143 probably inhibits tumor development by downregulating c-Myc expression in cooperation with miR-145 in our transgenic mice. [score:9]
As shown in Fig. 5B (3 [rd] panel), miR-145 mimic inhibited p72 expression, while neither miR-143 mimic nor siRNA for ERK5 seemed to have significant effect, which data demonstrate that the downregulation of p72 in the small intestine tumors of Tg/APC may be mainly elicited by miR-145. [score:8]
Effect of miR-143 and miR-145 converge on the repression of c-Myc, leading to the decrease of p68 expression, while miR-145 directly inhibits p72 expression. [score:8]
Forced Expression of miR-143 Induced miR-145 Expression in the Small Intestine Tumors of Apc [Min/+] Mice and Suppressed the Tumor Development. [score:8]
These findings suggest that miR-143 and miR-145 might act in concert to inhibit both ERK5/c-Myc and p68/p72/β-catenin signaling, and thereby suppress the expression of cyclin D1, c-jun and c-Myc itself. [score:7]
Moreover, Suzuki et al. reported that the processing of pri-miR-143 and pri-miR-145 required the interaction of the tumor suppressor p53 and the Drosha complex through the association with p68/p72 in colon cancer cells, suggesting that the full expression of miR-143 and miR-145 might be involved in tumor suppressing signaling driven by p53 [14]. [score:7]
These data implied that failure of suppression of p68 expression by mimics of miR-143 and miR-145 in colon cancer cells might be due to insufficient c-Myc inhibition. [score:7]
We also present that the expression of c-Myc and p72 is downregulated by miR-143/miR-145 and miR-145, respectively, in a human colon cancer cell lines, DLD-1 and Lovo cells. [score:6]
Michael et al. initially reported that the expression of miR-143 and miR-145 was downregulated in many colorectal neoplasms, suggesting their potential action as tumorsuppresors [4]. [score:6]
Indeed, this notion was supported by the following studies, which revealed that the downregulation of miR-143 and miR-145 could be involved in B-cell malignancy [5] and that colon tumor cell proliferation was suppressed by transfection with miR-143 [6]. [score:6]
Figure 3B indicated that both of pri-miR-143 and pri-miR-145 expression was upregulated in the small intestine tumors of Tg/APC. [score:6]
Our results suggested the downregulation of p72 by miR-145 through binding to its 3′UTR might be at least one of the molecular basis for the decrease of its expression in the transgenic small intestine tumors. [score:6]
These results implied that the downregulation of p72 observed in the transgenic small intestine tumors could be at least in part a direct effect of miR-145. [score:5]
Here, we present that forced expression of miR-143, which is in vivo processed from pri-miRNA, induces miR-145 expression and represses the small intestine tumor formation in Apc [Min/+] mice. [score:5]
c-Myc expression was not significantly suppressed by either miR-143 or miR-145 mimic when individually transfected. [score:5]
Thus, the forced expression of miR-143 in the small intestine tumors may induce the transcription of a bicistronic pri-miR-143/miR-145 to promote the expression of miR-145, and possibly miR-143. [score:5]
As far as we examined, none of miR-143 and miR-145 mimics significantly inhibited p68 expression in DLD-1 cells and Lovo cells (Fig. 5B, 4 [th] panel, Fig. S3B, 3 [rd] panel). [score:5]
Analysis by TargetScan indicated that there existed one possible binding site of miR-145 in the 3′untranslated region (3′UTR) of p72 of many animal species. [score:5]
These data suggested that forced expression of miR-143 should be sufficient for ERK5 repression, but that miR-145 induction might be a crucial event for full inhibition of cyclin D1, c-jun and c-Myc through retardation of 68/p72/β-catenin signaling. [score:5]
However as most of these studies used synthetic miR-143 and miR-145 mimics, their expression was transient and usually far beyond the level normally expressed in living organisms. [score:5]
To examine whether miR-143 induces the miR-145 expression in human colon tumor cells, we introduced miR-143 mimic into DLD-1 cells and Lovo cells, and analyzed the miR-145 expression by qRT-PCR. [score:5]
miR-145 also suppressed the expression of p78 in Lovo cells (Fig. S3B, 2 [nd] panel). [score:5]
In summary, miR-143 and miR-145 likely work together to inhibit at least two signaling pathways involving ERK5/c-Myc and p68/p72/β-catenin in the intestine tumors of Apc [Min/+] mice, and thereby suppress their common downstream effectors. [score:5]
This synergistic effect of miR-143 and miR-145 on c-Myc downregulation was also observed in another human colon cancer cell line, Lovo (Fig. S3B, 1 [st] panel). [score:4]
Thus, miR-145 might directly bind the mRNA of p72 and restrain the expression of p72. [score:4]
The expression of mouse pri-miR-143 and pri-miR-145 of the small intestine tumors from Tg/APC (gray bars, n = 5) and their non-transgenic littermates (W/APC) (open bars, n = 4) was examined. [score:3]
Unexpectedly, the expression of miR-145 of transgenic small intestine tumors also increased in proportion to that of miR-143 (Fig. 3A). [score:3]
Hence, additional events other than miR-143 expression seemed necessary for substantial induction of miR-145 in colon cancer cells. [score:3]
D) Schematic depiction of pGL3-Promoter plasmids fused to the 3′UTR fragment of p72 containing a potential target site of miR-145 and its mutant. [score:3]
A) Polyacrylamide Northern blot analysis of expression of miR-143 and miR-145 of gut tumors. [score:3]
These data implicated that suppression of c-Myc might be at least partly involved in the elevation of miR-145 and probably of miR-143 in the transgenic intestine tumors. [score:3]
As shown in Figure S4A, the expression level of miR-145, as well as normal organs (Fig. 1B), was almost comparable between the transgenic mice and their littermates. [score:3]
The expression of mouse pri-miR-143 and pri-miR-145 of tumors from Tg/APC (gray bars, n = 3) and their non-transgenic littermates (W/APC) (open bars, n = 3) was examined in the same way as B). [score:3]
Figure 5F showed that c-Myc siRNA enhanced the expression of miR-145 to some extent in both cells. [score:3]
Possible Involvement of c-Myc in the Elevation of miR-145 Expression. [score:3]
miR-143 and miR-145 have emerged as tumor suppressing miRNAs, particularly for colon cancers. [score:3]
Complementary pairs of miR-145 and its target within the seed sequence are shown as vertical bars. [score:3]
In contrast, we detected only little enhancement of miR-145 in Tg/APC colon tumors even though one of the tumors examined strongly expressed miR-143 (see Fig. 3A #13). [score:3]
Thus, it is possible that p68 and c-Myc might form a positive feedback loop, which suggests that miR-143 and miR-145 might inhibit p68 in part through the repression of c-Myc. [score:3]
To examine whether the upregulation of miR-145 in Tg/APC tumors was due to the increase of pri-miRNA, we performed qRT-PCR analysis of the mouse endogenous pri-miR-143 and pri-miR-145 with two sets of primers covering each pre-miRNA region. [score:3]
The reporter assay shows that p72 could be a direct target of miR-145. [score:3]
0042137.g003 Figure 3 A) Polyacrylamide Northern blot analysis of expression of miR-143 and miR-145 of gut tumors. [score:3]
Hence, given qRT-PCR analysis of pri-miR-143/145 and Western blot analysis of transgenic tumors, forced -expression of miR-143 might trigger c-Myc/pri-miR-145 signal more easily in the small intestine tumors than in the colon tumors. [score:3]
Indeed, although miR-143 was strongly expressed in one colon tumor of transgenic mice, the induction of miR-145 was poor (Fig. 3A #13). [score:3]
E) % inhibition of luciferase reporter activity of the wild and mutant transfectants by miR-145 mimic is shown. [score:3]
Repression of p68/p72 may impair β-catenin signaling to repress the expression of c-Myc, cyclin D1 and c-jun, and concurrently retard the processing of pri-miR-143/miR-145 to prevent the overproduction of miR-143 and miR-145. [score:3]
Next, we examined the effect of miR-143, miR-145 or siRNA for ERK5 on c-Myc expression in DLD-1 cells. [score:3]
Hence, we examined the effect of miR-143 and miR-145 on p68/p72 expression in DLD-1 cells. [score:3]
Consistent with the transgenic intestine tumors, the expression of pri-miR-145 of c-Myc siRNA-introduced cells was increased (Fig 5H). [score:3]
Indeed, the p68/p72 knockout mice study demonstrated that p68/p72 were required for the processing of pri-miRNAs of a subset of miRNAs, such as miR-145 and miR-16 [13]. [score:2]
To test this idea, we constructed a fusion gene of luciferase reporter gene and the p72 3′UTR harboring one miR-145 target sequence, and subjected it to reporter assays. [score:2]
Since KRAS mutation is not a usual event in tumors of Apc [Min/+] mice [9], [10], the induction of miR-145 by miR-143 in our transgenic mice would be dependent on a molecular mechanism distinct from KRAS-RREB1 signaling. [score:2]
Nonetheless, our study with their report indicates that regulatory circuits between miR-143 and miR-145 might exert anti-tumor effect in a variety of neoplasms in living animals. [score:2]
To examine whether the regulation of miR-145 by c-Myc occurred at the transcriptional level, we performed qRT-PCR analysis of pri-miR-145. [score:2]
Other investigators recently reported that a positive feedback circuit between miR-143 and miR-145 could work through suppressing KRAS-RREB1 signaling in pancreatic cancer cells, although they did not mention the cross-regulation at the mature miRNA levels [36]. [score:2]
Fig. 5E demonstrated that miR-145 mimic decreased reporter activity of vector with the wild 3′UTR of p72 by 73% of that of the mutated 3′UTR. [score:1]
F) qRT-PCR of miR-145 (F), miR-143 (G) and pri-miR-145 (H) in DLD-1 cells and Lovo cells. [score:1]
The complex of p53, p68 and p72 with DGCR8 and Drosha reinforces the processing of pri-miR-143/pri-miR-145. [score:1]
For luciferase reporter assay, the 3′UTR fragments of the mouse p68 and p72 containing possible target sites for miR-145, miR-26a, miR-34a or miR-206 were amplified from genomic DNA of a C57BL/6 mouse by PCR using specific primers containing an XhoI site at the 5′end. [score:1]
There was, however, no obvious enhancement of miR-145 (data not shown). [score:1]
C) qRT-PCR analysis of the mouse endogenous pri-miR-143 and pri-miR-145 of the colon tumors. [score:1]
To construct CAG/EGFP, the insert fragment of pMXs-puro-EGFP -miR-145/miR-143 [39] was subcloned into XhoI site of pCAGGS vector, and pri-miR-145 fragment was excised by ClaI and NotI. [score:1]
miRNA mimics of miR-143, miR-145, miR-34a and miR-26a were purchased from Qiagen GmbH (Hilden, Germany), and miR-206 mimic was obtained from Ambion. [score:1]
The membrane was hybridized with the probes for miR-143(1 [st] panel), miR-145 (2 [nd] panel) and 5S rRNA (3 [rd] panel). [score:1]
B) Quantitative Real-Time PCR (qRT-PCR) analysis of the mouse endogenous pri-miR-143 and pri-miR-145. [score:1]
DEAD-box RNA helicase subunits p68/p72, which are components of Microprocessor, promote the processing of pri-miR-143 and pri-miR-145 [13], [14]. [score:1]
0042137.g006 Figure 6 The complex of p53, p68 and p72 with DGCR8 and Drosha reinforces the processing of pri-miR-143/pri-miR-145. [score:1]
Whereas miR-145 was induced in the small intestine tumors in Tg/APC, the molecular mechanisms remain to be obscure. [score:1]
10 p mol of each miRNA mimic was transfected for a combination of miR-143 and miR-145. [score:1]
The expression of mature miR-143 and miR-145 was assayed with the Taqman MicroRNA Assays (Applied Biosystems) specific for hsa-miR-143 (P/N: 4395360) and hsa-miR-145 (P/N: 4395389), respectively. [score:1]
On the other hand, neither of pri-miR-143 nor pri-miR-145 significantly increased in the transgenic colon tumors (Figure 3C). [score:1]
Hence, the failure of miR-145 induction in transgenic colon tumors seemed to occur at the transcriptional level. [score:1]
The membrane was hybridized with the probes for miR-143(upper panel), miR-145 (middle panel) and 5S rRNA (lower panel). [score:1]
Interestingly, endogenous miR-145 is also increased in these tumors. [score:1]
miR-143 and miR-145 were transcribed as a bicistronic unit, a common pri-miRNA, in DGCR8 -null embryo bodies [18]. [score:1]
Thus, the induction of endogenous miR-145 appears to work preferentially in the small intestine polyps. [score:1]
[1 to 20 of 79 sentences]
6
[+] score: 280
In our present study, we identified and verified that FSCN1 was a direct target of miR-145 using luciferase reporter assay, which was further confirmed by the findings that ectopic expression of miR-145 could inhibit the FSCN1 expression at both the mRNA and protein level, the expression of miR-145 was inversely correlated with FSCN1 expression in the clinical NPC samples. [score:13]
Our findings demonstrated that miR-145 function as a tumor suppressor in NPC development and progression via targeting FSCN1, which could sever as a potential novel therapeutic target for patients with NPC. [score:8]
Our findings demonstrated that miR-145 function as a tumor suppressor in NPC development and progression through targeting FSCN1, suggesting that miR-145/ FSCN1 pathway may sever as a potential novel therapeutic target for patients with NPC. [score:8]
Overexpression of miR-145 inhibited NPC cell migration and invasion in vitro, and suppressed the formation of lung metastatic nodes in vivo. [score:7]
Taken together, these findings demonstrated that miR-145 could negatively regulate the expression of FSCN1 by directly targeting the FSCN1 3′ UTR. [score:7]
These findings demonstrate for the first time that miR-145 can inhibit NPC migration, invasion and metastasis through targeting its target gene FSCN1. [score:7]
To further explore the mechanism by which miR-145 inhibit invasion and metastasis, we used three publicly databases (TargetScan, DIANA, and miRanda) to identify potential targets of miR-145, and selected FSCN1 for further analysis. [score:7]
A series of studies have reported that miR-145 is frequently decreased in many malignancies, including breast, colon, liver, prostate, and gastric cancers, and functions as a tumor suppressor by inhibiting tumor cell growth, invasion, metastasis, and tumorigenesis, regulating cell apoptosis, cell cycle, and epithelial to mesenchymal transition [22– 28]. [score:6]
Recent findings have shown that miR-145 is frequently downregulated in human cancers, and functions as a tumor suppressor [22– 28]. [score:6]
We identified and verified that FSCN1 was a direct functional target of miR-145, and involved in regulating NPC cell migration and invasion. [score:5]
Furthermore, FSCN1 was identified and verified as a direct target of miR-145, and involved in regulating NPC cell migration and invasion. [score:5]
MicroRNA-145 suppresses cell invasion and metastasis by directly targeting mucin 1. Cancer Res. [score:5]
Ectopic overexpression of miR-145 significantly inhibited the migratory and invasive ability of SUNE-1 and CNE-2 cells. [score:5]
The feature of miR-145 acting as a tumor suppressor suggests it can serve as a novel therapeutic target for cancer therapy. [score:5]
The expression of miR-145 was inversely correlated with FSCN1 expression in the clinical NPC samples (Fig 6E, p<0.05). [score:5]
Furthermore, quantitative RT-PCR and showed that overexpressing of miR-145 remarkably reduced the mRNA and protein expression of FSCN1 (Fig 6C and 6D, p<0.05). [score:5]
Several target genes of miR-145, including mucin 1 (MUC1), DNA Fragmentation Factor-45 (DFF45), catenin δ-1, histone deacetylase 2 (HDAC2), v-ets avian erythroblastosis virus e26 oncogene homolog (ERG), N-cadherin (CDH2), and POU class 5 homeobox 1 (OCT4), have been verified [22– 28], and on the basis of these observations, miR-145 has been acknowledged as a tumor suppressor. [score:5]
Furthermore, fascin actin-bundling protein 1 (FSCN1) was verified as a target of miR-145, and silencing FSCN1 with small RNA interfering RNA could suppress NPC cell migration and invasion. [score:5]
Inhibition of miR-145 promotes NPC cell migration and invasion in vitro To investigate whether inhibition of miR-145 affects the migratory and invasive ability of NPC cells, we transiently transfected SUNE-1 and CNE-2 cells with miR-145 inhibitor or negative control, and performeds. [score:5]
Moreover, we also determined the expression levels of miR-145 in 18 freshly-frozen biopsy NPC and 14 normal nasopharyngeal epithelial tissue samples, and found that miR-145 expression was obviously reduced in NPC tissues than in normal tissue samples (Fig 1B, p<0.05). [score:5]
All together, the present study demonstrates that miR-145 functions as a tumor suppressor and has a suppressive role in the processes of NPC metastasis. [score:5]
The wound healing, Transwell migration and invasion, three-dimension spheroid invasion, and experimental lung metastasis assays demonstrated that miR-145 could significantly inhibit NPC cell migration and invasion in vitro, suppress the formation of lung metastatic nodes in vivo. [score:4]
FSCN1 is a direct target of miR-145. [score:4]
Based on our recent microarray analysis, we found that miR-145 was obviously downregulated in nasopharyngeal carcinoma (NPC) tissues. [score:4]
The sequence of wild-type FSCN1 3′UTR containing putative binding sites of miR-145 was synthesized and cloned into Firely luciferase -expressing vector psiCHECK (Promega), and then mutant 3′UTR plasmid was created by site-directed mutagenesis at the four miR-145 binding sites. [score:4]
Recently, we found that miR-145 was significantly downregulated in paraffin-embedded NPC samples based on microarray analysis. [score:4]
MiR-145 suppresses lung metastasis in vivo To explore the function of miR-145 in NPC metastasis in vivo, a SUNE-1 cell line stably overexpressing miR-145 was constructed using retroviral -mediated transfection, and then used to conduct an experimental metastasis assay through injecting it into the tail vein of nude mice. [score:4]
Based on our previous microarray analysis, we discovered that miR-145 was significantly downregulated in archived NPC tissues [13]. [score:4]
Firstly, quantitative RT-PCR confirmed that miR-145 was obviously downregulated in NPC cell lines and freshly frozen tissues. [score:4]
It was also reported that miR-145 could induce colon cancer cell apoptosis, regulate cell cycle distribution, and inhibit cell growth, migration, and invasion [23– 24]. [score:4]
Based on our recent microarray analysis, we discovered that miR-145 was significantly downregulated in NPC tissues. [score:4]
Moreover, fascin actin-bundling protein 1 (FSCN1) was verified as a direct functional target of miR-145. [score:4]
miR-145 suppresses NPC cell migration in vitro. [score:3]
In addition, we analyzed the correlation between miR-145 and FSCN1 expression in another cohort of 18 freshly-frozen NPC samples by quantitative RT-PCR. [score:3]
These results demonstrated that inhibition of miR-145 could promote the migratory and invasive ability of NPC cells. [score:3]
Inhibition of miR-145 promotes NPC cell migration and invasion in vitro. [score:3]
These observations demonstrated that miR-145 could obviously inhibit NPC cell metastasis, suggesting miR-145 functions as a negative modulator of metastasis. [score:3]
In addition, stably overexpressing of miR-145 in SUNE-1 cells could remarkably restrain the formation of metastatic nodes in the lungs of mice. [score:3]
Inhibition of miR-145 promotes NPC cell migration and invasion in vitro. [score:3]
The miR-145 mimics, miR-145 inhibitor, small interfering RNA for FSCN1 (siFSCN1), and their respective controls were purchased from GenePharma. [score:3]
miR-145 suppresses NPC cell invasion in vitro. [score:3]
MiR-145 was reported to suppress breast cancer cell invasion and metastasis, and regulate its epithelial to mesenchymal transition [22, 28]. [score:3]
However, the effect and mechanisms of miR-145 dysregulation involved in NPC development and progression remain unknown. [score:3]
To investigate whether inhibition of miR-145 affects the migratory and invasive ability of NPC cells, we transiently transfected SUNE-1 and CNE-2 cells with miR-145 inhibitor or negative control, and performeds. [score:3]
To further elucidate the significance of miR-145 in NPC, we detected the expression levels of miR-145 in a panel of human NPC cell lines and the immortalized human nasopharyngeal epithelial cell line NP69. [score:3]
Furthermore, it was found that miR-145 could inhibit cell proliferation, tumor growth, invasion, and metastasis in liver, prostate and gastric cancers [25– 27]. [score:3]
These results indicated that miR-145 could significantly inhibit the migration ability of NPC cells in vitro. [score:3]
More interesting, FSCN1 has been verified as the target of miR-145 in bladder cancer, esophageal squamous cell carcinoma, and prostate cancer [31– 33]. [score:3]
Taken together, these observations demonstrated that the dysregulation of miR-145 plays important roles in the development and progression of NPC, especially in the processes of metastasis. [score:3]
In our recent microarray analysis, we also found that the expression of miR-145 was significantly decreased in archived NPC tissue samples [13]. [score:3]
0122228.g004 Fig 4Inhibition of miR-145 promotes NPC cell migration and invasion in vitro. [score:3]
Quantitative RT-PCR was used to detect miR-145 expression in NPC cell lines and clinical samples. [score:3]
0122228.g001 Fig 1(A) Expression of miR-145 was examined in six NPC cell lines and an immortalized human nasopharyngeal epithelial cell line NP69. [score:3]
H&E staining verified that both the size and number of lung micrometastatic nodes was remarkably smaller in mice injected with SUNE-1 cells stably overexpressing miR-145 than control mice (Fig 5C and 5D, p<0.05). [score:3]
These findings suggested that miR-145 could significantly suppress the invasive ability of NPC cells in vitro. [score:3]
miR-145 suppresses lung metastasis in vivo. [score:3]
These observations suggested that FSCN1 was a functional target of miR-145, which involving in NPC cell migration and invasion. [score:3]
, quantitative RT-PCR, and were used to verify the target of miR-145. [score:3]
1 × 10 [6] SUNE-1 cells stably overexpressing miR-145 or control cells were suspended in 200 μl PBS, and then intravenously injected into nude mice through tail vein. [score:3]
As shown in Fig 5A and 5B, there were fewer metastatic nodes formed on the lungs of mice injected with SUNE-1 cells stably overexpressing miR-145 (p<0.05). [score:3]
MiR-145 suppresses NPC cell migration in vitro. [score:2]
We first cloned the wild-type or mutant miR-145 target sequences of the FSCN1 3′ UTR into luciferase reporter vectors, and did luciferase reporter gene assay. [score:2]
To explore the function of miR-145 in NPC metastasis in vivo, a SUNE-1 cell line stably overexpressing miR-145 was constructed using retroviral -mediated transfection, and then used to conduct an experimental metastasis assay through injecting it into the tail vein of nude mice. [score:2]
Transwell invasion assay indicated that inhibition of miR-145 also significantly promoted the invasive ability of SUNE-1 and CNE-2 cells (Fig 4B, both p<0.05). [score:2]
MiR-145 suppresses NPC cell invasion in vitro. [score:2]
The three-dimension spheroid invasion assay indicated that overexpression of miR-145 significantly reduced the invasive ability of both NPC cells (Fig 3B). [score:2]
MiR-145 suppresses lung metastasis in vivo. [score:2]
Subsequently, cells were transfected with the psiCHECK-FSCN1 wild-type or mutant reporter plasmid and miR-145 mimics or miRNA control, tighter with the control vector pRL-TK (Promega) using Lipofectamine 2000 reagent (Invitrogen). [score:1]
The sequence of pri-miR-145 was synthesized from human genomic DNA using PCR, and cloned into retroviral vector pMSCV-puromycin with Bgl II and EcoR I (New England Biolab). [score:1]
In our present study, we found that miR-145 was also frequently decreased in NPC cell lines and freshly frozen tissue samples. [score:1]
Co-transfection with miR-145 mimics obviously reduced the luciferase activity of the wild-type reporter gene, but not the mutant reporter gene (Fig 6B, p<0.05). [score:1]
miR-145 is decreased in NPC cell lines and clinical samples. [score:1]
It would be meaningful and helpful to explore whether miR-145 may function as a therapeutic agent for patients with NPC. [score:1]
As shown in Fig 6A, there were four putative miR-145 binding sites in the 3′ UTR of FSCN1 mRNA. [score:1]
Here, we firstly provide evidences that miR-145, serving as a novel anti-metastasis factor, plays important roles in preventing the progression and metastasis of NPC. [score:1]
MiR-145 suppresses NPC cell invasion in vitro To further test whether miR-145 affects the invasive ability of NPC cells, we transiently transfected SUNE-1 and CNE-2 cells with miR-145 mimics or miRNA controls, and conducted Transwell invasion assay and three-dimension spheroid invasion assay. [score:1]
[1 to 20 of 76 sentences]
7
[+] score: 251
In cells overexpressed both FSCN1 and miR-145, the anti-EMT effect of miR-145 as evidenced by upregulation of E-cadherin, downregulation of N-cadherin and vimentin (Figure 4C), and attenuation of migration and invasion (Figure 4D) was largely reversed by ectopic expression of FSCN1. [score:11]
miR-145 has been downregulated in many cancers [15– 19], functioning as tumor suppressor to inhibit tumor cell growth and survival, induce cell apoptosis and cell cycle arrest, and attenuate tumor cell migration and invasion via targeting various molecules [16– 18, 20– 23]. [score:10]
Figure 6 20(S)-Rg3 down-regulated DNMT3A to demethylate pre-miR-145 and thus upregulated mature miR-145 that targeted FSCN1 and finally blocked EMT to attenuate cell migration and invasion. [score:9]
Transfection of miR-145 inhibitor (Supplementary Figure 2) into 20(S)-Rg3 -treated cells (Figure 1C) reversed 20(S)-Rg3-rendered E-cadherin upregulation and N-cadherin and vimentin downregulation (Figure 1D, Supplementary Figure 3). [score:9]
20(S)-Rg3 down-regulated DNMT3A to demethylate pre-miR-145 and thus upregulated mature miR-145 that targeted FSCN1 and finally blocked EMT to attenuate cell migration and invasion. [score:9]
Figure 3 (A) qRT-PCR showed that ectopic expression of miR-145 had negligible effect on DNMT3A expression in DNMT3A -overexpressed cells. [score:7]
Ectopic expression of miR-145 in DNMT3A -overexpressed cells (Figure 3A) did not in turn affect DNMT3A expression (Figure 3B), but blunted the EMT-inducible activity of DNMT3A as shown by restoration of E-cadherin, loss of N-cadherin and vimentin (Figure 3C), and attenuation of cell motility and invasion (Figure 3D). [score:7]
In this study, we found that miR-145 was under control of DNMT3A -mediated DNA methylation, and 20(S)-Rg3 inhibited DNMT3A expression to demethylate pre-miR-145 and thus increase miR-145 expression. [score:7]
20(S)-Rg3 upregulated miR-145 via suppressing DNMT3A -mediated methylation of pre-miR-145. [score:6]
20(S)-Rg3 upregulated miR-145 via suppressing DNMT3A to demethylate pre-miR-145 gene. [score:6]
DNMT3A plasmid was transfected into 20(S)-Rg3 -treated cells to restore the expression of DNMT3A (Figure 2C), which reversed the 20(S)-Rg3-triggered upregulation of miR-145 (Figure 2D). [score:6]
miR-145 directly targeted FSCNI to inhibit EMT. [score:6]
These results indicated that 20(S)-Rg3 enhanced miR-145 via inhibiting DNMT3A expression and thus relieved the methylation restrain on pre-miR-145 transcription. [score:5]
Inhibition of miR-145 also blocked the inhibitory effect of 20(S)-Rg3 on the migration and invasion of both S KOV3 and 3AO cells (Figure 1E). [score:5]
Additionally, western blot analysis showed that miR-145 overexpression diminished FSCN1 expression level (Figure 4B). [score:5]
In conclusion, we found that 20(S)-Rg3 reversed EMT to inhibit ovarian cancer cells migration and invasion via antagonizing DNMT3A -mediated methylation of pre-miR-145 to promote inhibition of miR-145 on FSCN1. [score:5]
We provided evidence that miR-145 inhibited EMT by suppressing FSCN1, however, the detailed mechanism about function of FSCN1 in EMT occurrence still necessitated further elucidation. [score:5]
We first predicted putative target genes of miR-145 by searching the TargetScan database (release 5.1, http://www. [score:5]
Meanwhile, overexpression of miR-145 largely inhibited migration and invasion of both S KOV3 and 3AO cells (Figure 1H). [score:5]
The promotion of miR-145 by 20(S)-Rg3 directly targeted FSCN1 to reverse EMT in vitro and vivo. [score:4]
These results not only uncovered the novel anti-cancer mechanism of 20(S)-Rg3, but also revealed the regulatory pathway for miR-145 expression. [score:4]
Since miR-145 was reported downregulated in ovarian cancer cells and involved in EMT in many types of cancer, we explored the effect of 20(S)-Rg3 on miR-145. [score:4]
20(S)-Rg3 reversed EMT via upregulating miR-145. [score:4]
These results showed that 20(S)-Rg3 upregulated miR-145 to reverse EMT in ovarian cancer cells. [score:4]
These data indicated the direct suppressive effect of miR-145 on FSCN1. [score:4]
We then examined the inhibitory effect of miR-145 on the intraperitoneal dissemination of ovarian cancer. [score:3]
miR-145-up S KOV3 cells (transfected by miR-145 -expressing lentivirus) or negative control cells (NC) were subcutaneously inoculated into nude mice. [score:3]
In the present study, we discovered that 20(S)-Rg3 enhanced miR-145 expression by downmodulating DNMT3A to attenuate the methylation level in the promoter region of miR-145 precursor gene. [score:3]
miR-145 inhibited ovarian cancer EMT in vivo. [score:3]
Next we explored the target of miR-145 to block EMT. [score:3]
Taken together, our data suggested that miR-145 blocked EMT by targeting FSCN1 in ovarian cancer cells. [score:3]
To generate mutant 3′-UTR fragment of miR-145 target gene, we adopted the two-step PCR method as reported previously. [score:3]
Decreased expression and anti-tumor function of miR-145 have been observed in several cancers [41, 42]. [score:3]
miR-145 mimic (inhibitor) and negative control were purchased from Ribo-Bio Co. [score:3]
We next overexpressed miR-145 to examine its effect on EMT of ovarian cancer cells. [score:3]
In parallel, MSP results showed that overexpression of DNMT3A increased the methylation level in the promoter region of pre-miR-145 in 20(S)-Rg3 -treated S KOV3 and 3AO cells (Figure 2E). [score:3]
miR-145 inhibited DNMT3A-promoted EMT. [score:3]
These results showed that DNMT3A induced EMT via inhibiting miR-145. [score:3]
These data reproduced the suppressive action of miR-145 on ovarian cancer cell in vivo. [score:3]
miR-145 inhibited ovarian cancer EMT in vivoTo determine the effect of miR-145 on ovarian cancer progression in vivo, the primary tumor growth in nude mice were examined. [score:3]
FSCN1 [47] is a newly identified miR-145 target in a few cancers. [score:3]
S KOV3 and 3AO cells were seeded into 6-well plates to reach 40%–50% confluency after 24 h and then transiently transfected with 60 nM miR-145 mimic (S KOV3) or 100 nM miR-145 inhibitor or negative control using the X-treme GENE siRNA Transfection Reagent (Roche, Indianapolis, IN, USA). [score:3]
In the present study, we showed that DNMT3A induced EMT via decreasing miR-145 expression. [score:3]
miR-145 overexpression (Figure 1F) increased E-cadherin while decreased N-cadherin and vimentin (Figure 1G). [score:3]
The wild-type 3′-UTR sequence of the target gene carrying a putative miR-145 binding site was amplified by PCR. [score:3]
Here we provided the evidence that overexpression of FSCN1 was sufficient to confer EMT to ovarian cancer cells, and its aberrant elevation in ovarian cancer tissues was possibly benefited from miR-145 diminution. [score:3]
The mechanistic studies about miR-145 inhibition on cancer progression have initially focused on its roles in cell apoptosis, cell cycle and cell proliferation [43, 44]. [score:3]
In both S KOV3 and 3AO cells, 20(S)-Rg3 stimulated miR-145 expression (Figure 1B). [score:3]
S KOV3 cells were infected with miR-145 -expressing lentivirus GV209-miR145 (GENECHEM, Shanghai, China) or negative control lentivirus GV209 (GENECHEM, Shanghai, China). [score:3]
The luciferase reporter assay showed that luciferase activity was significantly inhibited in cells co -transfected with miR-145 mimic and FSCN1 WT-3′ UTR vector, while no changes of luciferase activity were detected in cells transfected with miR-145 mimic and luciferase reporter plasmids containing the mutant seeding sequence (Figure 4A). [score:2]
However, to our knowledge, there have been no reports about the methylation regulation of miR-145 in ovarian cancer. [score:2]
miR-145 was normalized to small nuclear U6, while DNMT3A normalized to β-actin. [score:1]
Here, we first reported that the pathway composed of DNMT3A, miR-145, and FSCN1 was implicated in the anti-EMT mechanism of 20(S)-Rg3 (Figure 6), and that the methylation repression of miR-145 by DNMT3A played an important role in EMT occurrence. [score:1]
Since DNA hypermethylation has been connected to miR-145 deregulation in prostate cancer [27], we compared the methylation status of miR-145 precursor gene in 20(S)-Rg3 -treated cells relative to non -treated cells. [score:1]
Mice in miR-145-up group lost less body weight than NC group. [score:1]
Tumors in spleen fascia and diaphragm of miR-145-up mice were substantially smaller in size than those in NC mice, and immunohistochemistry analysis of metastatic tumor showed the tumors were from the intraperitoneal dissemination (Figure 5F). [score:1]
Since the role of FSCN1 in EMT was not fully explored, we investigated whether FSCN1 mediated the inhibitory effect of miR-145 on EMT. [score:1]
No differences in body weight were observed between NC and miR-145-up groups. [score:1]
The MSP results illustrated that the methylation level in the promoter region of pre-miR-145 promoter was decreased in 20(S)-Rg3 -treated S KOV3 and 3AO cells (Figure 2A). [score:1]
And less metastatic tumor nodules and ascites were developed in miR-145-up group (Figure 5E). [score:1]
The xenografts in miR-145-up group were obviously smaller in size than those in NC group. [score:1]
The initial assessment of potential CpG islands in the 2000 bp upstream genomic sequence encoding pre-miR-145 found no CpG islands but some CG sites. [score:1]
To determine the effect of miR-145 on ovarian cancer progression in vivo, the primary tumor growth in nude mice were examined. [score:1]
Lately, miR-145 has been inversely connected to cancer cell motility and invasiveness, and the mechanism may partly be attributed to its anti-EMT effect [45, 46]. [score:1]
NC or miR-145-up S KOV3 cells were inoculated into the abdomen of nude mice. [score:1]
During the 28-day observation, the average body weigh was higher in miR-145-up group than NC group, which became significant since day 22 (Figure 5D). [score:1]
We further studied the role of miR-145 in DNMT3A-promoted EMT. [score:1]
miR-145 blocked DNMT3A -induced EMT. [score:1]
Specifically, although 4 conserved miR-145 seeding sequences were predicted to exist in the 3′-UTR of FSCN1, only one of them was experimentally confirmed as an actual binding site which was cloned into a luciferase reporter plasmid in our study [28]. [score:1]
Some microRNAs including miR-145, miR-200, and miR-29b, to name a few, have been suggested as EMT repressors in various types of cancer [11– 14]. [score:1]
When reached 80%-90% confluency, cells were co -transfected with pRL-TK vector (20 ng), wild-type (WT-3′ UTR) or mutant (MUT-3′ UTR) reporter vectors (180 ng), along with miR-145 mimic or negative control at a final concentration of 20 nM using the X-treme GENE siRNA Transfection Reagent. [score:1]
Nevertheless, the correlation of miR-145-FSCN1 with EMT has not been compellingly proven in the published data. [score:1]
Figure 2 (A) MSP showed that the methylation level in the pre-miR-145 promoter of S KOV3 and 3AO cells was decreased by 20(S)-Rg3. [score:1]
3′-UTRs of FSCN1 containing the wild-type or mutant putative miR-145 binding site were cloned into a luciferase reporter plasmid, respectively. [score:1]
[1 to 20 of 74 sentences]
8
[+] score: 240
The following additional data are available with the online version of this paper: a table listing sequence information on predicted miR-145 target sites in the mouse Fli1 3' UTR (Additional data file 1); a table listing the statistics on enrichment of miRNA in glomerulus and lungs (Additional data file 2); a figure showing expression levels of miR-145 in BJ-hTERT cells after transfection with miR-145 mimic or inhibitor, and expression levels of miR-145 and Fli1 in BJ-hTERT cells and endothelial cells, respectively (Additional data file 3). [score:9]
Since miRNAs can induce both translational repression and target mRNA degradation, we performed qRT-PCR to assess the expression of Fli1 mRNA after introduction of Pre-miR-145 or Pre-miR negative control. [score:7]
Fli1 is a target of miR-145miRNA target prediction software was used to identify possible targets for miR-145. [score:7]
miRNA target prediction software was used to identify possible targets for miR-145. [score:5]
miR-126, miR-24 and miR-23a are selectively expressed in microvascular endothelial cells in vivo, whereas miR-145 is expressed in pericytes. [score:5]
Translational repression without mRNA degradation has been described for numerous miRNAs, and our findings are consistent with a previous report suggesting that miR-145 is primarily a repressor of translation [34]. [score:5]
We conclude that miR-145 is selectively expressed in microvessel pericytes whereas the remaining miRNAs are expressed in ECs. [score:5]
Expression levels of miR-145 in BJ-hTERT cells after transfection with miR-145 mimic or inhibitor, and of miR-145 and Fli1 in BJ-hTERT cells and endothelial cells, respectively. [score:5]
Click here for file Expression levels of miR-145 in BJ-hTERT cells after transfection with miR-145 mimic or inhibitor, and of miR-145 and Fli1 in BJ-hTERT cells and endothelial cells, respectively. [score:5]
miR-145 was specifically expressed in pericytes, whereas the others were expressed in ECs. [score:5]
An empty reporter vector, lacking a cloned target site in the 3' UTR, was not affected by miR-145 overexpression. [score:5]
There was, however, no detectable expression of miR-145 in pericytes in the heart, where the expression was confined to arterioles and larger vessels (Figure 4h). [score:5]
In the same publication miR-145 is shown to selectively target genes that regulate the actin cytoskeleton, which is intimately coupled to cell migration. [score:4]
The primary role of miR-145 may be to maintain cytoskeleton homeostasis, and perturbed expression levels of miR-145, in either direction, may disturb this balance and negatively affect the cells' ability to remo del the actin cytoskeleton. [score:4]
We demonstrated that the Ets factor Fli1 is a regulatory target of miR-145 and that perturbed levels of miR-145 reduced cell migration. [score:4]
Many additional target genes that affect actin dynamics were predicted, which further supports a role for miR-145 in regulation of cell motility. [score:4]
Several other miRNAs also appeared as promising candidates for selective vascular expression, including miR-145, miR-30d, miR-23b and miR-24 (within the dashed lines in Figure 1b). [score:3]
We identified miR-145, miR-126, miR-24 and miR-23a as enriched in microvessels, and showed that microvascular expression of miR-145 is due to its presence in pericytes. [score:3]
In brain parenchyma, miR-145 showed staining in solitary scattered cells, consistent with expression in pericytes (Figure 4f). [score:3]
These results gave further support to the idea that microvascular miR-145 expression is derived primarily from pericytes. [score:3]
miR-145 has previously been shown to be selectively expressed in smooth muscle cells [39- 41]. [score:3]
miR-145, in contrast, was predominantly expressed in the leftover fractions. [score:3]
Fli1 is a target of miR-145. [score:3]
To test the hypothesis that miR-145 is expressed by pericytes, CD31+ fragments were purified from the brains of Pdgfb retention-motif mutant mice (Pdgfb ret/ ret) that lack a stretch of basic amino acids in the carboxyl terminus of PDGF-B. These mice display defective pericyte investment of microvessels [23]. [score:3]
Click here for file Sequence information on predicted miR-145 target sites in the mouse Fli1 3' UTR. [score:3]
Fli1 also scored favorably using picTar [32] and TargetScan [33], the latter identifying four evolutionarily conserved miR-145 binding sites in the Fli1 3' UTR (Figure 5a). [score:3]
Figure 4Pericyte expression of miR-145. [score:3]
The pericyte marker Pdgfrb showed a similar pattern with strong enrichment in CD31+ fragments from adult tissues but not in embryonic vascular fragments (Figures 2 and 3), which suggests that miR-145 could be expressed by pericytes. [score:3]
miR-145 was expressed in scattered NG2 -positive cells tightly associated with the smallest caliber capillaries in the brain and kidney. [score:3]
Forced expression of pre-miR-145 also reduced neointimal formation after arterial injury [41]. [score:3]
Human foreskin fibroblasts (BJ-hTERT) were transfected with Pre-miR-145 or Pre-miR negative control in gain-of-function experiments and with Anti-miR-145 or Anti-miR-control in loss-of-function experiments (expression levels of miR-145 in BJ-hTERT cells are presented in). [score:3]
We did not, however, detect miR-145 in pericytes in the heart, where expression was confined to larger arterioles. [score:3]
Considering that, it is intriguing that the endothelial and hematopoietic transcription factor Fli1 was identified as a target of miR-145. [score:3]
Expression of miR-145 was also reduced in mutant microvessels (P = 0.008), whereas no notable differences were observed for the other miRNAs. [score:3]
The miRNAs identified in the present study - miR-145, miR-30D, miR-24, miR-23a and miR-23b - are therefore possible targets in future therapeutic strategies. [score:3]
Here, we show that miR-145 is expressed in microvascular pericytes. [score:3]
Furthermore, expression of miR-145 was reduced in vascular fragments isolated from Pdgfb [ret/ret ]mice and enriched in NG2+ cells isolated from embryoid bodies. [score:3]
miR-145, miR-126, miR-24, and miR-23a were selectively expressed in microvascular fragments isolated from a range of tissues. [score:3]
In particular, miR-145 showed consistent and high differential expression in microvessels (24-, 7-, 75- and 18-fold for brain, muscle, skin and kidney, respectively). [score:3]
This did not affect Fli1 levels (data not shown), which is consistent with low endogenous expression of miR-145 in this cell type (Additional data file 3). [score:3]
miR-145 is selectively expressed by pericytes. [score:3]
In situ hybridization and analysis of Pdgfb retention motif mutant mice demonstrated predominant expression of miR-145 in pericytes. [score:3]
miR-145 targets the hematopoietic transcription factor Fli1 and blocks migration in response to growth factor gradients. [score:3]
Sequence information on predicted miR-145 target sites in the mouse Fli1 3' UTR. [score:3]
Two single base mutations were introduced in each of the seed regions of predicted target sites 2 to 4. Constructs were cotransfected with either synthetic let-7f (control) or miR-145 and luciferase activity was assayed after 24 hours (n = 4). [score:3]
We identified the Ets transcription factor Friend leukemia virus integration 1 (Fli1) as a miR-145 target, and showed that elevated levels of miR-145 reduced migration of microvascular cells in response to growth factor gradients in vitro. [score:3]
This suggests that miR-145 is expressed by a subset of pericytes. [score:3]
Perturbed expression of miR-145 reduced cell migration in cultured fibroblasts and ECs. [score:3]
By screening for mature miRNAs with vascular expression patterns we found that miR-145, miR-126, miR-23a, and miR-24 were enriched in the microvasculature in vivo. [score:3]
cDNA was prepared from the fragments and the remaining tissue using equal amounts of RNA, and miR-145 expression levels were determined using TaqMan qRT-PCR. [score:3]
Paradoxically, migration was reduced by both over -expression and silencing of miR-145 in our experiments. [score:3]
Differential expression of miR-126, miR-145, miR-24, and miR-23a in the mature microvasculature. [score:3]
We also performed a functional characterization of miR-145 and could show that it is a regulator of Fli1, and that increased or decreased expression of miR-145 leads to reduced cell migration in response to growth factor gradients. [score:2]
Figure 5Regulation of Fli1 by miR-145. [score:2]
This finding is supported by a recent publication that describes miR-145 knockout mice [40]. [score:2]
We further showed that miR-145 regulated the endothelial Ets factor Fli1 and that miRNA-145 reduced cell migration in response to growth factor gradients. [score:2]
Control cells migrated consistently toward the high-end of the gradient, whereas Pre-miR-145 -transfected cells exhibited a clear (>50%) reduction in migration in this direction (Figure 6c). [score:2]
For dual detection of miR-145 and the pericyte marker NG2, the immunostaining was performed after development of the in situ signal. [score:2]
In order to assess the role of miR-145, functional assays were performed in human foreskin fibroblasts, and in ECs that express Fli1. [score:2]
The polar plots illustrate the direction of migration for individual cells in the control experiments (top) and in the Pre-miR-145 transfected cultures (bottom). [score:2]
In accordance with the pericyte markers, miR-145 expression was higher in NG2+ cells compared to CD31+ cells (Figure 4b). [score:2]
These findings point to a role for miR-145 in regulation of cell migration. [score:2]
Single base-pair mutations reduced or abolished the effect of miR-145 on reporter activity in all cases. [score:2]
Approximately 60-bp regions containing wild-type (WT) miR-145 binding sites in the Fli1 3' UTR were cloned into pMIR-REPORT vector (Applied Biosystems). [score:1]
Cells were electroporated with either a negative control dsRNA or a synthetic miR-145 dsRNA (Pre-miR-145) and cultured for 48 hours. [score:1]
The bar graphs show average results from five independent experiments, and a total of 701 and 622 cells were tracked for the negative control and Anti-miR-145, respectively. [score:1]
miR-145, miR-126, miR-24 and miR-23a were consistently enriched in adult microvessels. [score:1]
Transfection of a synthetic miR-145 mimic dsRNA (Pre-miR-145) into HEK293 cells significantly reduced reporter activity for all predicted sites (Figure 5b). [score:1]
VAECs were electroporated with either Pre-miR-145 or Pre-miR negative control as described above. [score:1]
An effect of miR-145 on endogenous Fli1 protein levels was demonstrated in VAECs. [score:1]
In zebrafish, loss or gain-of-function experiments with miR-145 leads to identical phenotypes with poorly developed smooth muscle cells in the gut [42]. [score:1]
The average migrated distance per cell toward the high-end of the PDGF-BB gradient was reduced by more than 50% in Pre-miR-145 transfected cells, whereas migration perpendicular to the gradient was only slightly, and not significantly, reduced (Figure 6a). [score:1]
Similarly, migration towards the high-end of the gradient was reduced by Anti-miR-145 (Figure 6b). [score:1]
Oligonucleotides (65 bp) harboring wild-type or mutated miR-145 binding sites from the mouse Fli1 3' UTR (Additional data file 1) were annealed and ligated into the HindIII and SpeI sites of the pMIR-REPORT CMV-firefly luciferase reporter vector (Applied Biosystems). [score:1]
VAECs were also transfected with Anti-miR-145 in a loss-of-function experiment. [score:1]
Based on the above described in silico analyses, we chose to further characterize the expression of miR-126-3p (the predominant mature form of this miRNA, hereafter referred to as miR-126), miR-145, miR-30d, miR-23b, miR-24 and miR-23a; the latter being co-transcribed with miR-24 [1]. [score:1]
miR-145 modulates cell migration in vitro. [score:1]
Error bars indicate standard error of the mean (n = 2, P < 0.05 for control versus Pre-miR-145 with all WT constructs). [score:1]
Four replicate experiments were performed and values shown are normalized to the empty (plasmid only) transfections (P < 0.001 for both constructs, comparing empty and miR-145 transfections). [score:1]
A total of 285 and 239 cells were tracked for the negative control and Pre-miR-145, respectively. [score:1]
Nucleotides 2 and 4 in the seed region of three predicted miR-145 sites within the mouse 3' UTR fragment were mutated using Multisite-Quickchange (Stratagene/Agilent, Santa Clara, CA, USA). [score:1]
In situ hybridization and immunohistochemistry In situ hybridization was performed using a 3' DIG-labeled miRCURY LNA probe to mouse miR-145 and miR-126 (Exiqon, Vedbaek, Denmark) as previously described [26]. [score:1]
As expected, miR-145 stained smooth muscle cells in larger vessels whereas miR-126 stained ECs (staining patterns in kidney arteries are shown in Figure 4c, d). [score:1]
After 2 hours the medium was aspirated and the cells were transfected with 0.5 μg of Pre-miR negative control, Pre-miR-145, Anti-miR negative control or Anti-miR-145 (Applied Biosystems) using siPORT NeoFX (Ambion, Austin, TX, USA) in serum and growth factor free EBM-2 medium (Lonza) containing 0.2% bovine serum albumin. [score:1]
In situ hybridization was performed using a 3' DIG-labeled miRCURY LNA probe to mouse miR-145 and miR-126 (Exiqon, Vedbaek, Denmark) as previously described [26]. [score:1]
Figure 6Elevated levels of miR-145 leads to reduced microvasular cell migration. [score:1]
It is tempting to speculate that miR-145 could make such transitions sharp and distinct by silencing the hematopoietic differentiation factor Fli1. [score:1]
Next, we performed in situ hybridization on tissue sections using probes specific to miR-145 and miR-126. [score:1]
are average values from three independent experiments, and a total of 185 and 191 cells were tracked for the negative control and Pre-miR-145, respectively. [score:1]
[1 to 20 of 89 sentences]
9
[+] score: 228
Other miRNAs from this paper: mmu-mir-15b, mmu-mir-145a, mmu-mir-15a
Therefore, our data suggest downregulation of VEGF expression may be one of mechanisms by which miR-145 inhibits angiogenesis. [score:8]
Our present study demonstrates that overexpression of miR-145 inhibits glioma cell proliferation, invasion, angiogenesis in vitro, and decreases glioma cell growth in an animal mo del, possibly through the mechanism of miR-145-related decrease of ADAM17 and EGFR protein expressions via the Erk/p-Erk pathway in U87 cells. [score:7]
Overexpression and downregulation of miR-145 were established with transfection of miR-145 and zip-145 plasmids, respectively. [score:6]
miR-145-5p directly targets ADAM17 mRNA and inhibits glioma cell proliferation and invasion (20). [score:6]
miR-145 is a tumor-suppressive miRNA that has been recently implicated in the regulation of cell growth in tumor cells through targeting c-myc, EGFR, OCT4, and MUC1 (8– 11). [score:6]
Coincidentally, miR-145 overexpression deactivated ADAM17/EGFR/ERK in vitro, and downregulation of miR-145 increased ADAM17/EGFR/ERK activation. [score:6]
This suggests that the effect of miR-145 upon VEGF may be indirect, rather than via translational inhibition. [score:6]
However, downregulation of miR-145 reverses the capacity of tube formation that was associated with lowered VEGF expression. [score:6]
miR-145 directly targets ADAM17 and binds to 3′ UTR of ADAM17 mRNA, decreasing ADAM17 protein expression. [score:6]
Our data showed that the invasion potential of U87 cells is decreased by miR-145 overexpression, and increased by miR-145 downregulation. [score:6]
Overexpression of miR-145 inhibits tube formation in cultured mouse brain endothelial cells. [score:5]
Overexpression of miR-145 inhibits glioma cell invasiveness. [score:5]
Recently, we have demonstrated that expression of miR-145 is significantly downregulated in glioma cells as compared with normal brain tissue (20). [score:5]
High miR-145 expression decreased to 62.4% the VEGF release to supernatant by U87 miR-145, and low expression of miR-145 increased VEGF release to 2.4-fold by U87 zip-145. [score:5]
Establishment of U87 with stable expression of miR-145 and its inhibitor zip-145. [score:5]
Furthermore, low expression of miR-145 in glioma cells was correlated to increased ADAM17 and EGFR expression. [score:5]
At the same time, we tested the downregulation of miR-145 on glioma cell proliferation. [score:4]
Downregulation of miR-145 promotes tumor invasion and tumor growth. [score:4]
These results indicate that miR-145 regulates VEGF mRNA expression. [score:4]
miR-145 has been reported to target and regulate ADAM17, an important ADAM family member (20, 24). [score:4]
As for miR-145 overexpression in U87-zip-145 glioma cells, Fig. 1 shows that miR-145 expression level was significantly decreased to 0.4% compared to control U87 cells. [score:4]
The data showed that miR-145 overexpressing U87 cells have lower expression of ADAM17 and EGFR, respectively, in total protein levels, and lower phosphorylation state of Erk as compared with control groups. [score:4]
To quantify the expression level of the miR-145 in glioma cells with either stable transfection of miR-145 or zip-145, TaqMan real-time PCR of miR-145 expression was carried out using TaqMan assay kits according to the manufacturer’s protocol. [score:4]
miR-145 expression level in human glioma cell lines. [score:3]
These data confirmed our in vitro result that increased miR-145 expression decreases glioma proliferation. [score:3]
To address the function of miR-145 on glioma angiogenesis, we further tested VEGF expression in U87 cells and angiogenesis in vitro with mouse brain endothelial cells cultured in supernatant from U87 cells. [score:3]
These data indicate that miR-145 significantly contributes to glioma xenograph growth, and suggests overexpression of miR-145 may have therapeutic antitumor effects for glioma. [score:3]
We transfected U87 glioma cells with plasmids encoding miR-145 or zip-145, then added puromycin for high -expression clones. [score:3]
Downregulation of miR-145 significantly increased the growth rate of U87 cells from 13.2 to 20.3% compared to control. [score:3]
used in this study were stable transfection U87 cells with miR-145 cDNA plasmid stable transfection (U87-miR-145), U87 glioma cells with negative control cel-67 plasmid (U87-cel-67), and U87 glioma cells with miRzip-145 (targeting miR-145) plasmid stable transfection (U87-zip-145). [score:3]
We found that miR-145 expression was inversely correlated with VEGF mRNA, in addition to VEGF protein. [score:3]
High expression of miR-145 resulted in a significant decrease in U87 cell proliferation, invasion and angiogenesis. [score:3]
MiR145 -overexpressing U87 glioma cells were transfected with negative plasmid cel-67, and: i) control; ii) cel-67; iii) miR-145; and iv) zip-145 U87 glioma cells were injected stereotactically (5×10 [5] cells/mouse) at a depth of 3.5 mm, 1.5 mm to the right of midline, and 1.0 mm anterior to the bregma. [score:3]
While down-regulation of miR-145 medium showed a significant 1.28-fold increase in MBECs capillary tube formation compared to control medium. [score:3]
In our in vivo study, the data indicate that miR-145 is a growth inhibitor in U87 human glioma progression. [score:3]
ADAM17, EGFR, and Erk phosphorylation in miR-145 over -expressing cell lines. [score:3]
These data further indicate that miR-145 overexpression contributes to reduction of tumor progression through deactivation of the ADAM17/EGFR/ERK pathway. [score:3]
Overexpression of miR-145 decreases VEGF in mRNA and soluble protein release levels. [score:3]
Stable transfection with a plasmid encoding miR-145 leads to inhibition of the malignant phenotype. [score:3]
Furthermore, we examined the mechanisms by which ADAM17/EGFR/MAPK/ERK pathway contributed to miR-145 -induced inhibition on glioma proliferation, invasion, and angiogenesis after transfection of miR-145. [score:3]
Matrigel chambers (BD Biosciences) were used to determine the effect of stable expression of miR-145 on invasiveness, according to the manufacturer’s protocol. [score:3]
miR-145 inhibits U87 glioma growth in nude mice. [score:3]
To determine miR-145 expression level with stable transfection of miR-145 and its inhibitor zip-145, Taqman real-time PCR analysis of miR-145 level was used to measure and confirm miR-145, zip-145 versus control U87 cells. [score:3]
Our data showed that overexpression of miR-145 significantly decreased the growth rate of U87 cells after 5 days culture (Fig. 2). [score:3]
miR-145 overexpression significantly decreased cell invasion by 63.6% in U87 (Fig. 3). [score:3]
Using real-time RT-PCR, we compared the expression levels of miR-145-3p and miR-145-5p in glioma cell lines with total RNA from normal human astrocytes. [score:2]
VEGF expression level was significantly increased (3.16-fold) in U87 zip-145 cells, and was significantly decreased by 95.13% in U87 miR-145 cells compared to control cells. [score:2]
miR-145 overexpression decreased the rate of tumor growth in U87-miR-145 glioma bearing nude mice as compared with those parent tumor control and negative tumor control. [score:2]
Real-time PCR, soluble protein, and tube formation assays demonstrated that high expression of miR-145 leads to a decrease in gene, protein and functional levels of VEGF. [score:2]
We employed an additional method, the BrdU incorporation assay, to further test miR-145 -mediated growth inhibition of glioma cells using miR-145 plasmid transfected U87 clones (Fig. 2). [score:2]
As compared with control U87 cells, miR-145 downregulation evidently increased BrdU incorporation after 48 h of culture by 145.4% as compared with the control group. [score:2]
As shown in Fig. 1, miR-145-5p and miR-145-3p expression levels were significantly lower (4.2 and 6.3%) in U87 compared to total RNA from human astrocytes. [score:2]
The in vitro invasion assay data indicated that the invasiveness of U87 glioma cells is related to miR-145 expression levels, and increase of miR-145 decreases the invasiveness in U87 cells. [score:2]
As shown in Fig. 1, miR-145 expression level was significantly elevated (53.8-fold) in U87-145 cells compared with levels in control U87 cells. [score:2]
To test the effect of miR-145 expression upon glioma -induced angiogenesis, we performed a tube-formation assay of mouse brain endothelial cells (MBECs) in vitro. [score:2]
As shown in Fig. 4, culture medium from U87 glioma overexpressing miR-145 significantly reduced capillary tube formation of mouse brain endothelial cells by 34.55% when compared to control U87 media. [score:2]
We employed the Matrigel invasion assay to test if overexpressing miR-145 affects glioma cell invasiveness. [score:2]
Our data suggest that miR-145 decreased capillary-like tube formation. [score:1]
These data suggest that miR-145 significantly contribute to the pathways known to promote glioma cell malignancy. [score:1]
U87 cells transfected with miR-145 plasmid and control U87 cells were harvested and seeded at a density of 1×10 [4] cells/well in 24-well plates. [score:1]
Cells (1×10 [5]) with stable transfection of miR-145, or zip-145 were plated into 6-well plates and incubated for 48 h. Then, glioma cells were re-suspended in 500 μl of serum-free medium and added to the upper chamber, while the lower chamber was filled with 0.5 ml of complete medium that served as a chemo-attractant. [score:1]
Real-time PCR was employed to measure VEGF mRNA expression level in U87 miR-145, U87 zip-145, and control U87 glioma cells (Fig. 4). [score:1]
However, little has been reported on whether miR-145 is associated with glioma progression. [score:1]
miR-145 decreases cell growth in U87 glioma cells. [score:1]
These data suggest that miR-145 plays a key role in U87 cell malignancy. [score:1]
miR-145, zip-145, control U87 cells were cultured under 37°C for 24 h to attached to the bottom of the 6-well plate, respectively. [score:1]
TaqMan real-time PCR analysis of miR-145. [score:1]
Decrease of miR-145 by zip-145 significantly increased tumor cell proliferation. [score:1]
The cDNAs encoding miR-145 and cel-67 were purchased from Genscript (Piscataway, NJ, USA). [score:1]
The data suggested that stable transfection of miR-145 and zip-145 was established in the U87 cell lines. [score:1]
These results suggest that miR-145 in glioma cells promotes angiogenesis. [score:1]
These data suggest the potential therapeutic value of miR-145 in malignant human gliomas. [score:1]
Our data demonstrate that miR-145 decreases U87 glioma cell proliferation. [score:1]
Transfection of U87 cells with miR-145 and MiRzip-145. [score:1]
[1 to 20 of 74 sentences]
10
[+] score: 226
Other miRNAs from this paper: mmu-mir-145a
Figure 3Note: (A) The expression of miR-145, EGFR and other cytokines mRNA detected by qRT-PCR; (B) the expressions of EGFR and other cytokines proteins detected by western blotting; (C) western blotting images of expressions of EGFR and other cytokines proteins in each group (four times in each group)*, P < 0.05 in comparison with the blank, mimic control, inhibitor control and miR-145 inhibitors + si- EGFR groups; miR-145, microRNA-145; EGFR, epidermal growth factor receptor; MUC5AC, mucin 5AC; MMP-9, matrix metalloproteinase-9; TIMP-1, tissue inhibitor of metalloproteinase-1; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; qRT-PCR, quantitative real-time polymerase chain reaction. [score:13]
Note: (A) The expression of miR-145, EGFR and other cytokines mRNA detected by qRT-PCR; (B) the expressions of EGFR and other cytokines proteins detected by western blotting; (C) western blotting images of expressions of EGFR and other cytokines proteins in each group (four times in each group)*, P < 0.05 in comparison with the blank, mimic control, inhibitor control and miR-145 inhibitors + si- EGFR groups; miR-145, microRNA-145; EGFR, epidermal growth factor receptor; MUC5AC, mucin 5AC; MMP-9, matrix metalloproteinase-9; TIMP-1, tissue inhibitor of metalloproteinase-1; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; qRT-PCR, quantitative real-time polymerase chain reaction. [score:13]
Figure 5Comparison of miR-145, EGFR and other cytokines expressions among the normal, asthma, asthma + miR-145 mimic, asthma + miR-145 mimic NC, asthma + si- EGFR and asthma + si- EGFR NC groupsNote: (A), the expressions of miR-145, EGFR and other cytokines in mice detected by qRT-PCR; (B), the expressions of EGFR and other cytokines proteins in mice detected by western blotting; (C), western blotting images of expressions of EGFR and other cytokines proteins in mice among each group; *, P < 0.05 in comparison with the normal group; #, P < 0.05, in comparison with the asthma, asthma + miR-145 mimic NC and asthma + si- EGFR NC groups; miR-145, microRNA-145; EGFR, epidermal growth factor receptor; MUC5AC, mucin 5AC; TSLP, thymic stromal lymphopoietin; MMP-9, matrix metalloproteinase-9; TIMP-1, tissue inhibitor of metalloproteinase-1; qRT-PCR, quantitative real-time polymerase chain reaction; 20 mice × 6 groups. [score:11]
Note: (A), the expressions of miR-145, EGFR and other cytokines in mice detected by qRT-PCR; (B), the expressions of EGFR and other cytokines proteins in mice detected by western blotting; (C), western blotting images of expressions of EGFR and other cytokines proteins in mice among each group; *, P < 0.05 in comparison with the normal group; #, P < 0.05, in comparison with the asthma, asthma + miR-145 mimic NC and asthma + si- EGFR NC groups; miR-145, microRNA-145; EGFR, epidermal growth factor receptor; MUC5AC, mucin 5AC; TSLP, thymic stromal lymphopoietin; MMP-9, matrix metalloproteinase-9; TIMP-1, tissue inhibitor of metalloproteinase-1; qRT-PCR, quantitative real-time polymerase chain reaction; 20 mice × 6 groups. [score:9]
Comparison of expressions of EGFR and other cytokines among the control, blank, miR-145 mimics, mimic control, miR-145 inhibitors, inhibitor control, si-EGFR and miR-145 inhibitors + si-EGFR groups. [score:9]
Comparison of EGFR and related cytokines expression among the control, blank, miR-145 mimics, mimic control, miR-145 inhibitors, inhibitor control, si-EGFR and miR-145 inhibitors + si-EGFR groups. [score:9]
The specific groupings were made before transfection: (1) control group; (2) blank group; (3) miR-145 mimics group; (4) mimic control group; (5) miR-145 inhibitors group; (6) inhibitor control group; (7) si- EGFR group and (8) the miR-145 inhibitor + si- EGFR group. [score:7]
However, the miR-145 inhibitors group had a decreased miR-145 expression and a significantly increased expression of EGFR, MUC5AC, MMP-9 and TIMP-1 (all P < 0.05). [score:7]
Furthermore, the study revealed that the transfection of miR-145 mimics and EGFR siRNA plasmid leads to an increased expression of IL-25 and a decreased expression of MUC5AC, TSLP, MMP-9 and TIMP-1. Mucus hyper-secretion is a typical symptom of asthma and excessive mucus can contribute to airflow limitation and airway obstruction [12]. [score:5]
The normal group had the highest expression of miR-145 but the lowest expression of EGFR, MUC5AC, TSLP, MMP-9, TIMP-1 and cytokines. [score:5]
It has also been reported that an over expression of microRNA-145 (miR-145) in ASM cells significantly inhibits KLF4 and subsequently, affects downstream cytokines leading to an enhanced proliferation and migration of ASM cells in vitro [8]. [score:5]
No significant differences were found among the blank, miR-145 mimic control, miR-145 inhibitor control and miR-145 inhibitors + si- EGFR groups (all P> 0.05). [score:5]
In this study, we found that miR-145 targets and inhibits EGFR in the EGFR-3′UTR region. [score:5]
The miR-145 mimics, miR-145 inhibitors, corresponding mimic and inhibitor controls and si- EGFR were all purchased from Guangzhou RiboBio Co. [score:5]
Cho et al also showed that by targeting EGFR, miR-145 is able to inhibit human lung adenocarcinoma cell proliferation [26]. [score:5]
Sachdeva M et al. assumed that miR-145 was a specific cell type tumor suppressor which partially impacted metastasis and invasion by targeting mucin 1 [30]. [score:5]
In conclusion, miR-145 can decrease MUC5AC expression by inhibiting EGFR and alleviating airway remo deling. [score:5]
Compared with other groups, the control group had an increased miR-145 expression, but decreased expression of EGFR, MUC5AC, MMP-9 and TIMP-1 (Figure 3). [score:4]
Compared with the asthma group, the asthma + miR-145 mimics and asthma + si- EGFR groups showed significantly elevated miR-145 expression, but simultaneously reduced expressions of EGFR, MUC5AC, TSLP, MMP-9, TIMP-1 and other cytokines (all P< 0.05) (Figure 5 and Table 3). [score:4]
The miR-145 mimics and si- EGFR groups had higher miR-145 expression than the blank group, while expressions of EGFR, MUC5AC, MMP-9 and TIMP-1 were significantly decreased compared to the blank group (all P< 0.05). [score:4]
Hence, in our study, we explore whether miR-145 can affect airway remo deling by targeting EGFR to regulate MUC5AC. [score:4]
Additionally, EGFR activation and the down-regulation of miR-145 has been shown to have a relation to lung cancer [15]. [score:4]
Guo YH et al. reported that EGFR activation is associated with the down-regulation of miR-145 in lung cancer cells [25]. [score:4]
The molecular mechanism of EGFR regulating MUC5AC expression is shown in Figure 1. From it, we hypothesize that miR-145 is involved in airway remo deling via EGFR. [score:4]
This result indicates that miR-145 can specifically bind to the 3′UTR region of EGFR to inhibit its activity. [score:3]
There is a known positive relationship between EGFR and MMP-9, therefore, decreased EGRF caused by miR-145 can lead to decreased MMP-9. TIMP-1 is a major endogenous inhibitor of MMP-9 [33]. [score:3]
We aim to discuss the effect of miR-145 on airway remo deling and cytokine expression in hope that it can be clinically applied to treat asthma. [score:3]
The miR-145 -transfected cells and lung tissues in each group were washed with PBS and added to a cell lysis solution containing an appropriate amount of protease inhibitor. [score:3]
Comparison of miR-145, EGFR and other cytokines expressions among the normal, asthma, asthma + miR-145 mimic, asthma + miR-145 mimic NC, asthma + si- EGFR and asthma + si- EGFR NC groups. [score:3]
According to the prediction of the miRanda database, a targeting relationship might exist between miR-145 and EGFR (Figure 2A). [score:3]
The other groups showed significantly different expressions of miR-145, EGFR and related cytokines to the normal group. [score:3]
U6 was taken as a reference for miR-145 and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) acted as a reference for EGFR, MUC5AC, TSLP, matrix metalloproteinase-9 (MMP-9) and tissue inhibitor of metalloproteinase-1 (TIMP-1). [score:3]
Figure 1 According to the prediction of the miRanda database, a targeting relationship might exist between miR-145 and EGFR (Figure 2A). [score:3]
The results of the qRT-PCR and western blotting analysis confirmed that a lower expression of miR-145 causes higher EGFR. [score:3]
Accumulating evidence also shows the critical effect miR-145 has on asthma and lung disease via airway remo deling [9, 10]. [score:3]
Targeting relationship between miR-145 and EGFR detected by dual luciferase reporter gene assay. [score:2]
It either directly silences EGFR or leads to alleviated symptoms via miR-145. [score:2]
We demonstrated that MiR-145 promotes differentiation and inhibits the proliferation of smooth muscle cells [18]. [score:2]
MiR-145 targets EGFR. [score:2]
Differences were not significant among the asthma, asthma + miR-145 mimic NC and asthma + si- EGFR NC groups (all P> 0.05). [score:1]
In the asthma + miR-145 mimics group, after inhaling an OVA solution and being anaesthetized the mice were given an intranasal instillation of lentivirusmiR-145 (5 × 107TU mL-1) (200 μL per mouse)(purchased from Guangzhou Ribobio Biotechnology Co. [score:1]
Figure 2Note: (A) base sequence pairing of miR-145and EGFR; (B) luciferase activity after cells were transfected with miR-145 and EGFR3′UTR; *, P < 0.05 in comparison with the mimics control group; miR-145, microRNA-145; EGFR, epidermal growth factor receptor. [score:1]
Comparison of inflammatory cytokines in BALF among the normal, asthma, asthma + miR-145 mimic, asthma + miR-145 mimic NC, asthma + si-EGFR and asthma + si-EGFR NC groups. [score:1]
Comparison of miR-145, EGFR and cytokines among the normal, asthma, asthma + miR-145 mimic, asthma + miR-145 mimic NC, asthma + si-EGFR and asthma + si-EGFR NC groups. [score:1]
However, these conditions were remarkably alleviated in the asthma + miR-145 mimic and asthma + si- EGFR groups. [score:1]
Note: (A) base sequence pairing of miR-145and EGFR; (B) luciferase activity after cells were transfected with miR-145 and EGFR3′UTR; *, P < 0.05 in comparison with the mimics control group; miR-145, microRNA-145; EGFR, epidermal growth factor receptor. [score:1]
Nevertheless, the psiCHECK- EGFR -Mut-3′UTR transfected-cells did not show any differences in absorption signal after being transfected with miR-145 mimics or mimics control (P > 0.05). [score:1]
Mice in the asthma + miR-145 mimic NC group inhaled an OVA solution and were given an intranasal instillation of equal-amount negative control lentivirus (the lentivirus vector LV included miR-145 and the negative control lentivirus vector with miR-145. [score:1]
Note: miR-145, microRNA-145; HE, hematoxylin-eosin; PAS, periodic acid-Schiff; EGFR, epidermal growth factor receptor; 20 mice × 6 groups. [score:1]
After 2 weeks of adaptive feeding, the 120 mice were evenly divided into a normal, asthma, asthma + miR-145 mimics, asthma + miR-145 mimic NC, asthma + si- EGFR and asthma + si- EGFR NC group (Figure 6). [score:1]
It is reported that miR-145 can remarkably reduce MMP-9 and MMP-1 levels and slightly elevate TIMP-1 levels in J82 cells [35]. [score:1]
Whereas mice in the asthma, the asthma + miR-145 mimic NC and the asthma + si- EGFR NC groups showed goblet cell hyperplasia and mucus obstruction. [score:1]
, Ltd, Foshan, Guangdong, China) and those in the asthma, asthma + miR-145 mimics, asthma + miR-145 mimic NC, asthma + si-EGFR and asthma + si-EGFR NC groups were subjected to a phosphate buffered saline (PBS) solution with 1% OVA (30 min/time, 3 times/week× 5 weeks). [score:1]
Mice in the asthma + miR-145 mimics and asthma + si- EGFR groups were in good health condition, but there were 1∼2 mice deaths. [score:1]
Mice in the asthma, asthma + miR-145 mimic NC and asthma + si- EGFR NC groups did show inflammatory cell infiltration (mainly lymphocytes and eosinocytes). [score:1]
In the asthma, asthma + miR-145 mimic NC and asthma + si- EGFR NC groups, collagenous fiber increased and the collagen area of the basement membrane expanded. [score:1]
In the asthma + miR-145 mimics and asthma + si- EGFR groups, the airway epithelial tissue was smooth and inflammatory cells decreased. [score:1]
The study also showed that miR-145 causes a decreased level of TIMP-1. As this result cannot be supported by exiting studies, future studies should focus on exploring its specific mechanisms. [score:1]
There are existing studies that support the result that an elevation of IL-25 is caused by the transfection of miR-145 mimics and EGFR siRNA. [score:1]
However, those in the asthma + miR-145 mimics and asthma + si- EGFR groups had alleviated goblet cell hyperplasia and mucus obstruction (Figure 4). [score:1]
In our study, we found that mice in the asthma, asthma + miR-145 mimics NC and asthma + si- EGFR NC groups showed higher inflammatory cell infiltration, goblet cell hyperplasia and mucus obstruction. [score:1]
The asthma + miR-145 mimics and asthma + si- EGFR groups showed relatively less airway remo deling. [score:1]
Note: miR-145, microRNA-145; NC, negative control; EGFR, epidermal growth factor receptor; PBS, phosphate buffer saline; OVA, ovalbumin. [score:1]
This suggests that airway remo deling can be effectively treated by promoting miR-145 or silencing EGFR. [score:1]
Comparison of proportion of Th2 and Th17 cells in peripheral blood among the normal, asthma, asthma + miR-145 mimic, asthma + miR-145 mimic NC, asthma + si-EGFR and asthma + si-EGFR NC groups. [score:1]
89* 409.89 ± 123.78* 79.37 ± 6.48* 1701 ± 36* 202.77 ± 24.18* 60.39 ± 12.88*Note: BALF, bronchoalveolar lavage fluid; TNF-α, tumor necrosis factor-α, IL, interleukin; TSLP, thymic stromal lymphopoietin; miR-145, microRNA-145; EGFR, epidermal growth factor receptor; *, P < 0.05 in comparison with the normal control; [#], P < 0.05 in comparison with the asthma, asthma + miR-145 mimics NC and asthma + si-EGFR NC groups. [score:1]
The asthma, asthma + miR-145 mimics NC and asthma + si- EGFR NC groups showed higher proportions of Th2 and Th17 cells in CD 4+ T cells of peripheral blood. [score:1]
This indicates that miR-145 may be used as a molecular predictor for airway remo deling. [score:1]
, Carlsbad, CA, USA) and divided into a WT + mimics (transfected with miR-145 mimics and EGFR-WT plasmids), MT + mimics (transfected with miR-145 mimics and EGFR-MT plasmids), WT + NC (transfected with mimic control and EGFR-WT plasmids) or a MT + NC group (transfected with mimic control and EGFR-MT plasmids). [score:1]
There was no significant difference in WAt/Pbm, WAi/Pbm and WAm/Pbm among the asthma, asthma + miR-145 mimic NC and asthma + si- EGFR NC groups (all P > 0.05). [score:1]
However, the asthma + miR-145 mimic and asthma + si-EGFR groups had a remarkably decreased proportion of T h2 and Th17 cells in peripheral blood than the asthma, asthma + miR-145 mimic NC and asthma + si-EGFR NC groups (all P < 0.05). [score:1]
The asthma + miR-145 mimic and asthma + si-EGFR groups had a higher proportion of Th2 and Th17 cells in peripheral blood than the normal group, but the difference is not statistically significant (P > 0.05). [score:1]
Mice in the asthma, asthma + miR-145 mimic NC and asthma + si- EGFR NC groups showed no obvious discomfort, however, 4∼7 mice died in each group. [score:1]
[1 to 20 of 73 sentences]
11
[+] score: 179
To determine whether miRNA inhibitor conjugates could be used to promote growth signalling in human placental tissue, first trimester and term placental explants were cultured with scrambled-, miR-145 inhibitor- or miR-675 inhibitor conjugates, or with commercially available scrambled- or miR-145 inhibitors that lacked the CCGKRK targeting sequence. [score:11]
Placental explants were incubated with the scrambled inhibitor PNA conjugate, the miR-145 inhibitor PNA conjugate, the miR-675 inhibitor PNA conjugate, the scrambled miR inhibitor or the selective miR-145 inhibitor (50nM) for 24 or 48h. [score:11]
In this proof of principle study, we have explored the feasibility of using a miRNA inhibitor as putative therapeutic in pregnancy, designed placental homing peptide-microRNA inhibitor conjugates synthesised from peptide nucleic acids, and demonstrated that targeted inhibition of miR-145 and miR-675 expression within the placenta leads to enhanced CTB turnover in human first trimester explants and increased fetal and placental weights in mice. [score:11]
After 24h of culture, miR-145 expression was significantly reduced in first trimester explants treated with the miR-145 inhibitor conjugate, and the reduction in expression was comparable to explants treated with the non -targeted miR-145 inhibitor (Figure 6A), as previously reported 16. [score:11]
In contrast, there was no significant reduction in miR-145 expression in term placental explants exposed to either the targeted or non -targeted miRNA inhibitor conjugate (Figure 6B). [score:9]
PCR analysis of miRNA expression in placentas harvested at E18.5 showed that treatment with the miR-675 inhibitor conjugate significantly reduced miR-675 expression (Figure 4G), but median placental miR-145 expression was not significantly changed at this time point (Figure 4H). [score:9]
Three homing peptide-miRNA inhibitor peptide nucleic acid (PNA) conjugates were synthesised by Cambridge Research Biochemicals: (i) a scrambled miRNA inhibitor sequence conjugated to the peptide CCGKRK via a disulphide linkage (5'- ACCACGCCTCTCGCCAGTGTCAC-Cys-Cys-Gly-Lys-Arg-Lys-3'); (ii) a miR-145 inhibitor sequence conjugated to the peptide CCGKRK via a disulphide linkage (5'-CAGGTCAAAAGGGTCCTTAGGGA-Cys-Cys-Gly-Lys-Arg-Lys-3'); and (iii) a miR-675 inhibitor sequence conjugated to the peptide CCGKRK via a disulphide linkage (5'-ACCACGCCTCTCCCGGGTGTCAC-Cys-Cys-Gly-Lys-Arg-Lys-3'). [score:9]
This could be achieved by two approaches: firstly, as demonstrated in our study, miRNAs that are highly expressed in the first trimester (such as miR-145 and miR-675), and are negative regulators of growth and development, could be targeted for inhibition in women identified as being at high risk of impaired placentation. [score:9]
Both miRNA inhibitor conjugates significantly enhanced CTB proliferation in first trimester explants, compared to those treated with the scrambled inhibitor conjugate (Figure 7M), and this increase was comparable to that observed with the non -targeted miR-145 inhibitor. [score:8]
A commercially available scrambled miRNA inhibitor and a selective inhibitor of miR-145, both lacking targeting peptide sequences were purchased from Exiqon and were used as negative and positive controls, respectively. [score:7]
miR-145-5p target sequence: 5' GUCCAGUUUUCCCAGGAAUCCCU 3' (conserved sequence between mouse and human); mmu miR-675-5p target sequence: 5' UGGUGCGGAAAGGGCCCACAGU 3'; hsa miR-675-5p target sequence: 5' UGGUGCGGAGAGGGCCCACAGUG 3'. [score:7]
C57/BL6J mice were intravenously injected with PBS, a scrambled miRNA inhibitor conjugate (1mg/kg), a miR-145 inhibitor conjugate or a miR-675 inhibitor conjugate at three-time points during pregnancy. [score:7]
Mice were intravenously injected with 100 µl of vehicle (PBS) or 1 mg/kg of the scrambled inhibitor PNA conjugate, the miR-145 inhibitor PNA conjugate or the miR-675 inhibitor PNA conjugate on E12.5, E14.5 and E16.5 of pregnancy. [score:7]
Analysis of placental weight distribution indicated that 6 placentas weighed below the 10 [th] centile in PBS treated mice, and 5 placentas weighed below the 10 [th] centile in mice treated with the scrambled inhibitor conjugate, but no placentas fell below the 10 [th] weight centile in either miR-145 or miR-675 inhibitor conjugate -treated mice, suggestive of a growth-promoting effect. [score:5]
As these molecules have been shown to modulate implantation 47, trophoblast invasion 48 and spiral artery remo delling 49 respectively, miR-145 inhibition in the early stages of gestation has the potential to regulate multiple aspects of human pregnancy and placental development. [score:5]
As many of these miRNAs, including miR-145, have been detected in the peripheral blood of women with pregnancy complications 42, the potential for their use as biomarkers of disease and signposts for development of miRNA-specific personalised therapies also remains to be explored. [score:4]
Levene's test for homogeneity of variance confirmed that treatment with miR-145 inhibitor conjugate significantly reduced the variance in fetal/placental weight ratio, compared to that of mice treated with PBS (P<0.05) or the scrambled inhibitor conjugate (P<0.05). [score:4]
We demonstrate expression of miR-145 in mouse placenta for the first time, propose that this molecule controls placental weight gain and validate a previous report that miR-675 is a negative regulator of murine placental growth 25. [score:4]
In other tissues miR-145 has been identified as a putative tumour suppressor gene 43 and as a negative regulator of angiopoietin-2 44, MUC-1 45 and ADAM-17 46. [score:4]
miR-145 was also detected in the fetus (Figure 1B), and in the maternal heart, liver and uterus (Figure 1C); however, the level of expression did not change with gestation. [score:3]
As observed in human placental explants 16, increased miR-145 expression correlated with a decrease in the number of Ki67 -positive cells throughout the placenta and decidua (Figure 1D, E). [score:3]
microRNA-145 (miR-145) expression has previously been documented in the human placenta 16; however, no corresponding data exists in the mouse. [score:3]
3'UTRs 3'-untranslated region CTB cytotrophoblasts DMEM Dulbecco's modified Eagle medium EVT extravillous trophoblast FAM 5(6)-carboxyfluorescein FGR fetal growth restriction IGF-I insulin-like growth factor-I IGF-II insulin-like growth factor-II miR-145 microRNA-145 miR-675 microRNA-675 miRNA microRNA. [score:3]
No inhibitor significantly altered the median fetal/placental weight ratio, a measure of placental efficiency; however, the miR-145 inhibitor conjugates appeared to normalise efficiency, such that fewer placentas exhibited extremes of efficiency (Figure 4E). [score:3]
Moreover, as miR-145 limits tumour angiogenesis 50, 51, miR-145 inhibition may promote the normal physiological processes of decidual angiogenesis and uterine spiral artery remo delling which are key to pregnancy success in both humans and mice 52, 53. [score:3]
These wide-ranging effects may highlight some of the ways in which miR-145 inhibition may have enhanced fetal growth in our study, without significantly increasing placental weight. [score:3]
Quantitative RT-PCR analysis of mouse placental lysates confirmed miR-145 expression (Figure 1A), and demonstrated that miR-145 levels significantly increased between E12.5 and E18.5 of gestation. [score:3]
We have also identified a number of downstream targets of miR-145 in the human placenta, including IGF receptor-1, cyclin D1 and p38 MAPK 16, all of which promote growth signalling. [score:3]
The miR-145 inhibitor conjugate did not significantly alter median placental weight, but it appeared to normalise placental weight, such that there were fewer of the heaviest and lightest placentas within that treatment group (Figure 4E). [score:3]
Levene's test for homogeneity of variance confirmed that the miR-145 inhibitor conjugate significantly reduced the variance in placental weights, compared to mice treated with PBS (P<0.05). [score:2]
The miR-145 and miR-675 inhibitor conjugates also significantly increased median fetal weight at E18.5, compared to mice injected with PBS (Figure 4C); however, fetal weight distribution curves showed that the number of fetuses falling below the 10 [th] centile remained unchanged. [score:2]
Work by our group and others has identified numerous miRNAs, including miR-675, miR-145, let-7a, miR-377 and miR-483, that influence events in early pregnancy 15, and can either positively or negatively regulate CTB proliferation in explants of human placental tissue 16- 19. [score:2]
Indeed, analysis of the relative area of the labyrinth and junctional zone is indicative of a possible growth-promoting effect of the miR-145 inhibitor conjugate within the junctional zone, although this requires further investigation. [score:1]
[1 to 20 of 33 sentences]
12
[+] score: 168
Other miRNAs from this paper: mmu-mir-145a, mmu-mir-143, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2
We hypothesized that the high levels of ERBB3 are a consequence of miRNA regulation, and we subsequently identified a cluster of miRNAs, including miR-143 and miR-145, that directly target and regulate the expression of ERBB3 protein in breast cancer cells. [score:8]
In this study, we predicted that ERBB3 is a target of miR-143 and miR-145, which are a cluster of miRNAs that have been reported in many studies to be downregulated and to function as tumor suppressors in most cancers [17, 18]. [score:8]
We identified specific targeting sites for miR-143 and miR-145 (miR-143/145) in the 3’-untranslated region (3’-UTR) of the ERBB3 gene and regulate ERBB3 expression. [score:8]
When MCF-7 cells were infected with these viral vectors, the expression of mature miR-143 and miR-145 was found to be 4–6-fold higher than the endogenous miRNA levels (Additional file 1: Figure S1E), and ERBB3 protein expression was significantly inhibited (Additional file 1: Figure S1F). [score:7]
Taken together, our results not only reveal a critical role for miR-143 and miR-145 as tumor suppressors in breast carcinogenesis through repression of ERBB3 translation but also show that different miRNAs within a cluster can simultaneously and cooperatively repress a given target mRNA. [score:7]
MCF-7 cells were either infected with a lentiviral expression vector to express miR-143 and miR-145 or transfected with an ERBB3 plasmid to overexpress ERBB3. [score:7]
These results indicated that the suppressive effects of miR-143 and miR-145 on ERBB3 protein expression was not an individual response but was instead a synergistic effect. [score:5]
miR-143 and miR-145 suppress proliferation and invasion of breast cancer cells by targeting ERBB3. [score:5]
Furthermore, the expression of ERBB3 protein was significantly increased in MCF-7 cells transfected with anti-miR-143 or anti-miR-145, and the greatest increase in expression occurred when both anti-miR-143 and anti-miR-145 were used simultaneously (Figure  2A). [score:5]
To generate viral expression constructs, 300-bp fragments containing the genomic sequences of miR-143 and miR-145 were obtained by PCR amplification of human DNA and were then cloned into a lentiviral expressing vector. [score:5]
As anticipated, overexpression of miR-143 or miR-145 significantly suppressed ERBB3 protein levels in MCF-7 cells (Figure  2A). [score:5]
Knockdown of miR-143/145 was achieved by transfecting cells with anti-miR-143 and/or anti-miR-145, which are chemically modified antisense oligonucleotides that are designed to specifically target mature miR-143 and miR-145. [score:4]
We hypothesize that a combination replacement treatment with both miR-143 and miR-145 will be a promising strategy for cancers showing downregulation of miR-143 and miR-145. [score:4]
After determining the levels of miR-143 and miR-145 in the same six pairs of breast cancer tissues and corresponding noncancerous tissues, we showed that miR-143 and miR-145 levels were indeed downregulated in breast cancer tissues (Figure  1D). [score:4]
Interestingly, co-treatment of cells with both pre-miR-143 and pre-miR-145 enhanced the suppressive effect on ERBB3 protein expression compared to treatments with either pre-miR-143 or pre-miR-145 alone (Figure  2A). [score:4]
In support of the notion that miR-143 and miR-145 function as tumor suppressive miRNAs [9], MCF-7 and MBA-MD-231 cells transfected with pre-miR-143/145 showed decreased proliferation; in contrast, knockdown of miR-143/145 had the opposite effect on cell proliferation (Figure  3A and B; left and middle panel). [score:4]
These results further supported a synergistic effect of miR-143 and miR-145 on ERBB3 downregulation in MCF-7 cells. [score:4]
After 28 days of xenograft growth in vivo, tumors from the miR-143/145 -overexpressing group showed a significant increase in the expression of mature miR-143 and miR-145 compared to tumors from the control group (Figure  4D). [score:4]
For example, miR-143 and miR-145 (miR-143/145), which are located in a cluster within the 5q32-33 chromosomal region, are downregulated in many types of cancers, including colon cancer and breast cancer [17, 18]. [score:4]
Interestingly, co-treatment with both miR-143 and miR-145 at the same time suppressed the luciferase reporter containing the miR-143/145–responsive 3’-UTR to a greater extent than when either miR-143 or miR-145 was introduced alone. [score:3]
In our study, bioinformatic analyses of the 3’-UTR of ERBB3 revealed two non-overlapping target elements for miR-143 and miR-145. [score:3]
A 300-bp fragment containing genomic miR-143 and miR-145 sequences was generated by PCR amplification from human DNA and subsequently cloned into the Lenti-PacTM human immunodeficiency virus (HIV) expression packing system (Invitrogen). [score:3]
For overexpression of miRNAs, 100 pmol of pre-miR-143, 100 pmol of pre-miR-145 or 50 pmol of both pre-miR-143 and pre-miR-145 were used. [score:3]
Experimental validations supported the hypothesis that miR-143 and miR-145 exhibited a cooperative repression of ERBB3 expression and luciferase activity that was stronger than with either miR-143 or miR-145 alone. [score:3]
Identification of conserved miR-143 and miR-145 target sites within the 3’-UTR of ERBB3. [score:3]
In these experiments, overexpression was achieved by transfecting cells with pre-miR-143 and/or pre-miR-145, which are synthetic RNA oligonucleotides that mimic the miR-143 and miR-145 precursors. [score:3]
We next analyzed the biological consequences of the decreased expression of miR-143 and miR-145 in breast cancer cells. [score:3]
Interestingly, miR-143 and miR-145 showed a cooperative repression of ERBB3 expression and cell proliferation and invasion in breast cancer cells, such that the effects of the two miRNAs were greater than with either miR-143 or miR-145 alone. [score:3]
The minimum free energy values of the hybridizations between miR-143 and ERBB3 and between miR-145 and ERBB3 were −25.9 and −28.2 kcal/mol, respectively, which are well within the range of genuine miRNA-target pairs. [score:3]
These results demonstrated that miR-143 and miR-145 synergistically suppress proliferation and invasion in breast cancer cells. [score:3]
Target genes of miR-145 include Mucin-1 [21], RTKN [22], c-Myc [23] and EGFR [24]. [score:3]
Co-treatment with miR-143 and miR-145 synergistically suppress proliferation and invasion in breast cancer cells. [score:3]
As a result, co-treatment with both miR-143 and miR-145 synergistically suppressed the growth and invasion of breast cancer cells compared with a single treatment with either miR-143 or miR-145. [score:2]
For knockdown of miRNAs, 100 pmol of anti-miR-143, 100 pmol of anti-miR-145 or 50 pmol of both anti-miR-143 and anti-miR-145 were used. [score:2]
Meanwhile, although miR-143 and miR-145 can individually suppress cell proliferation and invasion, the simultaneous introduction of both miR-143 and miR-145 showed a cooperative repression of cell proliferation and invasion compared to effects of either miR-143 or miR-145 alone. [score:2]
In this study, co-treatment with miR-143 and miR-145 showed a synergistic anti-tumor effect both in vitro and in vivo through the negative regulation of ERBB3 in human breast cancer. [score:2]
miR-143 and miR-145 decrease the growth rate of breast cancer cells in vivo. [score:1]
Future studies are required to investigate whether miR-143 and miR-145 are involved in the mechanism of resistance to ErbB -targeted drugs in breast cancer. [score:1]
miR-143 and miR-145 are two miRNAs that are located within the same cluster, but they do not share sequence homology. [score:1]
Using these approaches, miR-143 and miR-145 were identified as candidate miRNAs. [score:1]
To test the binding specificity, the sequences that interact with the seed sequence of miR-143 and miR-145 were mutated (from UUGGGAG to AACCCUC for the miR-143 binding site; and from UUGGGAG to AACCCUC for the miR-145 binding site), and the mutant ERBB3 3’-UTR was inserted into an equivalent luciferase reporter plasmid. [score:1]
miR-143 and miR-145 have frequently been reported to be involved in drug resistance in many cancer types, although little evidence has been detected in breast cancer. [score:1]
We next evaluated the effects of miR-143 and miR-145 overexpression on the growth of human breast cancer cell xenografts in mice. [score:1]
Total RNA was subsequently extracted from each xenograft and was used to evaluate the expression of mature miR-143 and miR-145. [score:1]
One predicted hybridization was observed between both miR-143 and miR-145 and the 3’-UTR of ERBB3. [score:1]
One goal of this study was to determine whether miR-143 and miR-145 function individually or synergistically. [score:1]
However, for miRNAs in a cluster that do not share homology (e. g., miR-143 and miR-145), their individual and combined functionalities are less clear. [score:1]
In contrast, the luciferase activity was significantly increased in cells transfected with either anti-miR-143 or anti-miR-145, and a maximal increase in activity was observed when cells were transfected simultaneously with both anti-miR-143 and anti-miR-145 (Figure  2E). [score:1]
microRNA miR-143 miR-145 ERBB3 Breast cancer Proliferation Invasion Breast cancer is the most common cancer and principle cause of death from cancer in women worldwide [1, 2]. [score:1]
Synthetic RNA molecules, including pre-miR-143, pre-miR-145, anti-miR-143, anti-miR-145 and scrambled negative control RNA (pre-miR-control and anti-miR-control), were purchased from GenePharma (Shanghai, China). [score:1]
In future studies, an effective drug delivery system needs to be developed for the application of miR-143 and miR-145 for breast cancer therapy. [score:1]
MCF-7 cells were co -transfected with firefly luciferase reporters containing either wild-type (WT) or mutant (Mut) miR-143/145 binding sites in the ERBB3 3’-UTR and pre-miR-control, pre-miR-143, pre-miR-145 or both pre-miR-143 and pre-miR-145, or with anti-miR-control, anti-miR-143, anti-miR-145 or both anti-miR-143 and anti-miR-145. [score:1]
miR-143 and miR-145 were thus selected for further experimental verification. [score:1]
As expected, the luciferase activity was markedly reduced in cells transfected with pre-miR-143 or pre-miR-145, and the potency was increased when pre-miR-143 and pre-miR-145 were used in combination (Figure  2E). [score:1]
miR-143 and miR-145 have been shown to possess anti-tumorigenic activity, with involvement in various cancer-related events such as proliferation, invasion and migration. [score:1]
[1 to 20 of 55 sentences]
13
[+] score: 167
To further confirm whether miR-143 and miR-145 directly regulate their target genes, the activity of the 3′-untranslated region (UTR) of the target genes was analyzed by a reporter assay. [score:8]
Expression of PDGFRA and ABLIM-2, which are miR-143 and miR-145 target genes respectively, was specifically upregulated by miR-143 and miR-145 respectfully. [score:8]
Specifically, ARPC-2, and -5 was significantly upregulated by either miR-143 or miR-145 silencing, while ARPC-3 was significantly upregulated by miR-143 only. [score:7]
That is consistent with the Targetscan prediction that PDGFRA is a miR-143 target gene [25], and the PicTar prediction that ABLIM-2 is a miR-145 target gene [26]. [score:7]
PDGFRA was upregulated by miR-143 silencing, and ABLIM2 was upregulated by miR-145 silencing. [score:7]
The expression of the other predicted miR-143 and/or miR-145 target genes in the list, including KLF4, SSH2, PRKCE, and ROCK1, was not significantly regulated by miR-143 and or miR-145 silencing. [score:6]
PDGFRA and ABLIM-2 expression was upregulated by miR-143 and miR-145 silencing, respectively. [score:6]
MLCK expression was repressed by either miR-143 or miR-145 silencing, although it is not a predicted miR-143/145 target. [score:5]
Mechanistically, miR-143 and miR-145 are required for maintaining actin-cytoskeletal dynamics and contractility in HTM cells, possibly through regulating or directly targeting multiple genes involved in actin dynamics and contractility. [score:5]
Human TM (HTM) cells were isolated from donor eyes with no history of eye disease, and the expression of miR-143 and miR-145 was examined by qRT-PCR. [score:5]
miR-143 antagomiR only specifically silenced miR-143 expression, without affecting expression of miR-145; and vice versa. [score:5]
In addition, multiple members of the ARPC complex, including ARPC-2, -3 and -5, are upregulated by miR-143 or miR-145 silencing. [score:4]
Interestingly, neither miR-143 nor miR-145 significantly influenced the ARPC-3 3′-UTR activity, although they are capable of regulating its expression at mRNA level (Fig.   5H). [score:4]
These results suggest that miR-143 and miR-145 regulate genes involved in actin dynamics and cell contractility through both direct and indirect mechanisms. [score:4]
Surprisingly, KLF5 was downregulated by either miR-143 or miR-145 silencing. [score:4]
Targeted deletion of miR-143 and miR-145 results in reduced IOP, consistent with an ~2-fold elevation in outflow facilities. [score:3]
miR-143 and miR-145 expression plasmids were described in ref. [score:3]
PDGFRA and ARPC-5 UTRs contain canonical target sites for miR-143 and miR-145 respectively (Fig.   5C,D). [score:3]
MLCK expression was repressed by either miR-143 or miR-145 silencing. [score:3]
miR-143 and miR-145 have been reported to be expressed in corneal epithelial cells, especially limbal stem cells 20, 21. [score:3]
Accordingly, overexpression of miR-143 repressed the PDGFRA 3′-UTR activity in a dose -dependent manner, while miR-145 failed to influence its activity (Fig.   5E). [score:3]
Our data demonstrate that miR-143 and miR-145 are expressed in smooth muscle cells and TM cells in the eye. [score:3]
ARPC-2, ARPC-3, ARPC-5 and PDGFRA 3′UTRs were cloned downstream of the coding region of luciferase in a cytomegalovirus (CMV) -driven luciferase vector, and tested for luciferase activity after co-transfection with miR-143 or miR-145 expression plasmids in COS-1 cells. [score:3]
Figure 1Expression of miR-143 and miR-145 in the eye as revealed by qRT-PCR and LacZ staining. [score:3]
Although not homologous, miR-143 and miR-145 share a number of common target genes involved in actin dynamics and contractile function 16, 18, 19. [score:3]
By qRT-PCR, the expression of miR-143 and miR-145 in human TM cells is less but comparable to the aortic SMC cells, but much higher than in choroidal endothelial cells and RPE cells. [score:3]
The antagomir for miR-145 resulted in only a moderate but significant inhibition of cell contraction in one of the cell lines (p < 0.023). [score:3]
Based on these data, we conclude that miR-143 and miR-145 are enriched in the SMCs, pericytes, CMs and extraocular muscle in the mouse eye, but are also expressed in the TM cells. [score:3]
Expression of miR-143 and miR-145 in smooth muscle and TM cells in the eye. [score:3]
Similarly, miR-143 and miR-145 have been shown to regulate the contractility of vascular SMCs [19]. [score:2]
We provide genetic evidence that miR-143 and miR-145 regulate IOP in vivo. [score:2]
The results of this study reveal an important role for miR-143 and miR-145 in regulating IOP in mice. [score:2]
16. miR-143, or miR-145, expression plasmid was co -transfected with the reporter plasmids in COS1 cells and reporter assays were performed as described [36]. [score:2]
Normal gross ocular morphology in miR-143/ 145 d KO miceEncouraged by the smooth muscle- and TM-enriched expression of miR-143 and miR-145 in the eye, we set to characterize the ocular phenotype in the miR-143/ 145 double knockout (d KO) mice that we had previously generated [16]. [score:2]
These results suggest that miR-143/145 regulates the contractility of HTM cells, with miR-143 having a more dominant role than miR-145. [score:2]
Our findings that miR-143 and miR-145 regulate IOP have important therapeutic implications. [score:2]
To further examine whether miR-143 and miR-145 are required for regulating IOP under high IOP conditions, we induced intraocular hypertension in these mice by polystyrene microbead injection, and examined the effects of miR-143/ 145 deletion on IOP elevation 22, 23. [score:2]
miR-143 and miR-145 regulate actin dynamics and contractility of HTM cells. [score:2]
To further dissect the mechanism whereby miR-143 and miR-145 regulate outflow facilities, we tested the effect of miR-143/145 silencing on the actin dynamics and contractility of TM cells. [score:2]
With regard to the miR-143/145 functional mechanism, we showed that miR-143 and miR-145 regulate actin-cytoskeletal dynamics and contractility in TM cells. [score:2]
miR-143 and miR-145 have been shown to regulate contractility and maintain actin stress fibers in smooth muscle cells 16– 19. [score:2]
Cordes, K. R. et al. miR-145 and miR-143 regulate smooth muscle cell fate and plasticity. [score:2]
Encouraged by the smooth muscle- and TM-enriched expression of miR-143 and miR-145 in the eye, we set to characterize the ocular phenotype in the miR-143/ 145 double knockout (d KO) mice that we had previously generated [16]. [score:2]
After 24-hour transfection with miR-143 or miR-145 antagomiRs, HTM cells were embedded in the collagen preparation before pouring, and polymerized at 37 °C, 5% CO [2] for 30 minutes. [score:1]
The sequences include: 2′-O-methyl anti-miR-143: 5′-mGmAmG mCmUA CAG UGC UUC AmUmC mUmCmA3′; 2′-O-methyl anti-miR-145: 5′-mAmGmG mGmAU UCC UGG GAA AAC mUmGmG mAmC-3′; 2′- O-me-scrambled miR: 5′-mAmAmAmAmCCUUUUGACCGAGCmGmUmGmUmU-3′. [score:1]
miR-143, miR-145 and control antagomiRs were ordered IDT. [score:1]
To study the mechanisms whereby miR-143 and miR-145 regulate outflow facilities, we investigated how these miRNAs regulate actin-cytoskeletal dynamics and contractility in TM cells. [score:1]
Lee, S. K. W. et al. MicroRNA-145 Regulates Human Corneal Epithelial Differentiation. [score:1]
Stress fiber length was significantly reduced in HTM cells transfected with miR-143 and miR-145 antagomiRs (p < 0.001). [score:1]
Similarly, miR-145 dose -dependently repressed the ARPC-5 3′-UTR activity (Fig.   5F). [score:1]
Deletion of miR-143 and miR-145 in mice results in an ~19% decrease in IOP, which is consistent with an ~2-fold increase in outflow facilities. [score:1]
The reporter activity was not detectable in the TM of the reporter mice, although miR-143 and miR-145 was detected in HTM cells by qRT-PCR. [score:1]
Xin, M. et al. MicroRNAs miR-143 and miR-145 modulate cytoskeletal dynamics and responsiveness of smooth muscle cells to injury. [score:1]
Deletion of miR-143 and miR-145 results in a significant reduction (~14% decrease) in systolic blood pressure due to reduced vascular tone [19]. [score:1]
miR-143 and miR-145 antagomiRs were used to silence these two miRNAs, respectively. [score:1]
[1 to 20 of 55 sentences]
14
[+] score: 162
The ectopic expression of miR-145 downregulated c-Myc expression at the translation level and decreased the PKM2/PKM1 ratio in both bladder cancer T24 and 253JB-V cells (Figure 4B), thus suggesting that miR-145 controlled the cancer specific energy metabolism through the c-Myc/PTBP1/PKMs axis. [score:10]
Based on such a situation, we decided to explore the silencing of PTBP1 by siR-PTBP1 and treatment with miR-145, which suppresses the expression systems linked to PTBP1 mainly through the downregulation of c-Myc as an upstream regulator of PTBP1 and inactivation of both MAPK/ERK and PI3K/AKT growth signaling pathways. [score:9]
As shown in Figure 4A,B, the ectopic expression of miR-145 significantly downregulated PTBP1 through knockdown of c-Myc, resulting in growth inhibition in a concentration -dependent manner in both cells. [score:9]
Thus, miR-145 negatively affected the Warburg effect through the downregulation of c-Myc, which upregulated PTBP1 in these cell lines. [score:7]
It is a well-known fact that c-Myc, which positively regulates the expression of PTBP1 by acting upstream of it, is a direct target of miR-145 [31]. [score:7]
Expression of miR-145 Was Extremely Downregulated in Clinical Tumor Samples from Bladder Cancer Patients and Bladder Cancer Cell Lines. [score:6]
We previously reported that miR-145 is downregulated and acts as a tumor suppressor in colon adenomas [8, 12], colon cancers [13], gastric cancers [14], chronic lymphocytic leukemias and B-cell lymphomas [15], and several cancer cell lines [16, 17, 18], especially bladder cancer cells [11, 19, 20, 21]. [score:6]
Yamada N. Noguchi S. Mori T. Naoe T. Maruo K. Akao Y. Tumor-suppressive microRNA-145 targets catenin δ-1 to regulate Wnt/beta-catenin signaling in human colon cancer cells Cancer Lett. [score:6]
These results suggest that this combination treatment using ectopic expression of miR-145 and knockdown of PTBP1 would also cause significant growth inhibition even in other cancers. [score:6]
As a result, the expression levels of miR-145 in the clinical bladder cancer samples examined by reverse transcription polymerase chain reaction (RT-PCR) using real-time PCR were extremely downregulated compared with those in the normal mucosa (Figure 1A), and also in human bladder cancer T24 and 253JB-V cells (Figure 1B). [score:5]
Increased Expression of miR-145 Combined with Knockdown of PTBP1 Contributed to the Greater and Longer Growth Suppression Compared with Each Single Treatment. [score:5]
We described here the first novel combination RNAi treatment using ectopic expression of miR-145 and knockdown of PTBP1. [score:4]
Noguchi S. Yamada N. Kumazaki M. Yasui Y. Iwasaki J. Naito S. Akao Y. socs7, a target gene of microRNA-145, regulates interferon-beta induction through STAT3 nuclear translocation in bladder cancer cells Cell Death Dis. [score:4]
Earlier we reported that ectopic expression of miR-145 induces apoptosis and that knockdown of PTBP1 leads to autophagy and/or apoptosis [11, 28]. [score:4]
Biochemically, the ectopic expression of miR-145 resulted in the appearance of the cleaved form of PARP and knockdown of PTBP1 induced the transition of the LC3BI to LC3BII in both types of cancer cells (Figure 6A). [score:4]
Thus, miR-145 acted as an anti-oncomiR in the miR-145 -downregulated human bladder cancer cells. [score:4]
Next, we examined the effect on cell growth by the combination treatment at the half maximal inhibitory concentration (IC50) of miR-145 as a replacement treatment and knockdown of PTBP1 by siR-PTBP1 in both cancer cells. [score:4]
The Combination Treatment of Ectopic Expression of miR-145 and Knockdown of PTBP1 Induced Apoptosis and Autophagy. [score:4]
Sachdeva M. Zhu S. Wu F. Wu H. Walia V. Kumar S. Elble R. Watabe K. Mo Y. Y. p53 represses c-Myc through induction of the tumor suppressor miR-145 Proc. [score:3]
We first examined the expression of miR-145 in bladder cancers and the adjacent normal samples in the same patients, as well as that in various bladder cancer cell lines in this study. [score:3]
The introduction of miR-145 into bladder cancer 253JB-V and T24 cells induced growth inhibition accompanied by apoptotic cell death, as reported previously [11, 22, 29]. [score:3]
Importantly, the introduction of either miR-145, siR-PTBP1, or siR-c-Myc induced growth inhibition through the switching from PKM2 to PKM1, resulting in a reduced PKM2/PKM1 ratio (Figure 4A,B). [score:3]
Furthermore, results of flow cytometry by annexin V and propidium iodide (PI) staining indicated that combination treatment of ectopic expression of miR-145 and knockdown of PTBP1 using siR-PTBP1 clearly induced apoptosis in both cell lines compared with each single treatment and control (Figure 2D). [score:3]
Western blot analysis indicated the appearance of the cleaved form of poly (ADP-ribose) polymerase (PARP) in 253JB-V and T24 cells transfected with miR-145; and, to the contrary, treatment with antagomiR-145 reversed the growth inhibition and the decreased the level of the cleaved form of PARP elicited by miR-145 introduction (Figure 2A,B). [score:3]
As a result, a significant suppression of tumor growth was observed in either single-injection group, miR-145 or siR-PTBP1. [score:3]
Ectopic Expression of miR-145 in Bladder Cancer Cells Induced Apoptosis. [score:3]
To explore this possibility, we examined the effect of combination RNAi treatment by using miR-145, which can silence c-Myc expression and siR-PTBP1 to negate the action of the driver gene PTBP1 in cancer pathogenesis. [score:3]
Notably, miR-145 has a remarkable anti-cancer activity in bladder cancer, as the intravesical delivery of liposome-carrying miR-145 effectively inhibits the tumorigenic phenotypes in a human bladder cancer xenograft mouse mo del [22]. [score:3]
We consider that the combination of siRNA for the driver gene PTBP1 and the miR-145 silencing of the plural genes associated with the networks related to PTBP1 expression, such as c-Myc and PI3K/AKT signaling molecules, could avoid drug resistance of various kinds of cancers (Scheme 1). [score:3]
This synthetic miR-145 showed greater growth inhibition compared with any commercially supplied miR-145s for use in in vitro experiments. [score:2]
To determine the expression levels of miR-145, we conducted quantitative RT-PCR (qRT-PCR) by using TaqMan MicroRNA Assays (Applied Biosystems, Foster City, CA, USA) and THUNDERBIRD Probe qPCR Mix (TOYOBO Co. [score:2]
Antitumor Effect of miR-145 and/or siR-PTBP1 on 253JB-V Cell Xenografted Tumors in Nude Mice. [score:1]
The mature type of miR-145 (mirVanaTM miRNA mimic; Ambion, Foster City, CA, USA) was used for the transfection of the cells, which was achieved by using cationic liposomes, Lipofectamine RNAiMAX (Invitrogen, Carlsbad, CA, USA), according to the manufacturer’s Lipofection protocol. [score:1]
At 10 days after the inoculation, we injected a solution containing control-miR, miR-145, siR-PTBP1, or the combination of miR-145 and siR-PTBP1 into the tumors. [score:1]
A total of 5.0 × 10 [5] cells (253JB-V or T24) were seeded into a 6-well plate and transfected with miR-145 and/or siR-PTBP1 or control microRNA in 253JB-V and T24 cells. [score:1]
Zaman M. S. Chen Y. Deng G. Shahryari V. Suh S. O. Saini S. Majid S. Liu J. Khatri G. Tanaka Y. The functional significance of microRNA-145 in prostate cancer Br. [score:1]
Noguchi S. Mori T. Hoshino Y. Yamada N. Nakagawa T. Sasaki N. Akao Y. Maruo K. Comparative study of anti-oncogenic microRNA-145 in canine and human malignant melanoma J. Vet. [score:1]
We consider that some of the autophagic cells transfected with siR-PTBP1 and miR-145 underwent apoptotic cell death in the late phase, which was shown by the results of the biochemical and electron microscopic studies. [score:1]
The effects manifested by the introduction of miR-145 and/or siR-PTBP1 into the cells were assessed at 72 h after the transfection. [score:1]
Hoechst 33342 nuclear staining showed the typical apoptotic features, such as condensed chromatin and nuclear fragmentation in the miR-145 -treated and combination -treated cells (Figure 6B,C). [score:1]
2.3. miR-145 Impaired the PTBP1/PKMs Axis, Reducing the Cancer-Specific Energy Metabolism, through Silencing of c-Myc. [score:1]
On the other hand, an increased level of lactic acid was found with miR-145 or combination treatment (Figure 5F), which may indicate the gluconeogenesis from lactic acid in response to the perturbation of the cancer-specific energy metabolism. [score:1]
miR-145 is one of the most representative anti-oncomiRs in a variety of cancers, including bladder cancer [8, 9, 10, 11]. [score:1]
In the future, we plan to perform a double-blind comparative study on BCG therapy and this synthetic miR-145 in vivo. [score:1]
In order to examine the effect of miR-145 and/or siR-PTBP1 on a xenograft mouse mo del, we inoculated 253JB-V cells subcutaneously into nude mice. [score:1]
The ratio was almost the same between the cases of miR-145 alone and the combination treatment. [score:1]
Furthermore, the decreased level of FSCN-1, which is an mRNA typically silenced by miR-145, was also recovered to that in the control sample (Figure 2B). [score:1]
Based on such findings, we examined the relationship between miR-145 and c-Myc/PTBP1 in the cancer specific energy metabolism. [score:1]
To further enhance the antitumor effects of miR-145, we have developed a novel synthetic version of it. [score:1]
Although one medicine for a driver oncogene activated alternative signaling pathways, the combination treatment including miR-145, which affects various oncogenes, restrained the alternative signaling pathways including MAPK/ERK, PI3K/AKT, and c-Myc, which are necessary to maintain the cancer specific energy metabolism. [score:1]
So far, we have been paying attention to the use of RNA medicine such as RNA interference (RNAi), particularly by miR-145, which activates apoptotic pathways and blocks a cancer-specific metabolic pathway responsible for the Warburg effect through the silencing of c-Myc. [score:1]
In single treatment or combination treatment experiments, the sequence of the mature type of miR-145 used in this study was 5′-GUCCAGUUUUCCCAGGAAUCCCUU-3′; and that of siR-PTBP1, 5′-AUCUCUGGUCUGCUAAGGUCACUUC-3′. [score:1]
[1 to 20 of 52 sentences]
15
[+] score: 156
Other miRNAs from this paper: mmu-mir-145a, hsa-mir-145
Next, to validate the growth suppression of xenografted tumor by intravesical injection of miR-145, we examined the expression level of miR-145 in xenografted tumors by qRT-PCR and the expression levels of possible miR-145 -targeted genes by analysis. [score:9]
Figure 4 and assessment of protein expression of miR-145 -targeted and related genes in the xenografted tumor samples A. Relative expression levels of miR-145 in xenografted tumors treated with miR-145 or control miR. [score:7]
Also, recently, we found that miR-145 inhibits cell migration through the down-regulation of Fascin-1 (FSCN1), E-cadherin, β-catenin, and catenin δ-1 in various cancer cells [8, 9]. [score:6]
analysis showed that the expression levels of all FSCN1, E-cadherin, β-catenin, and catenin δ-1 were also significantly down-regulated in the miR-145 -treated 253J B-V cells (Figure 1C). [score:6]
Previously, we reported that miR-145 is down-regulated and acts as a tumor suppressor in colon adenomas [2, 3], colon cancers [4], gastric cancers [5], chronic lymphocytic leukemias and B-cell lymphomas [6], several cancer cell lines [7- 9], and of course in bladder cancer cells [10, 11]. [score:6]
analysis showed that the protein levels of miR-145 -targeted genes such as c-Myc, socs7, FSCN1, E-cadherin, and β-catenin were significantly down-regulated (Figure 4B). [score:6]
Recently, we found that ectopic expression of miR-145 induces apoptosis through the down-regulation of c-Myc and socs7 in bladder cancer cells [10, 11]. [score:6]
MiR-145 can reach xenografted tumors by intravesical injection and assessment of protein expression of miR-145 -targeted and related genes in the xenografted tumor samples. [score:5]
In conclusion, the present findings for the first time showed that miR-145 was an effective tumor suppressor miRNA against bladder cancer and that its intravesical delivery effectively inhibited the tumorigenic phenotypes without any adverse effects. [score:5]
As a result, the expression level of miR-145 in 253J B-V cells was markedly down-regulated compared with that in normal human urothelial cells (HUC; Figure 1A). [score:5]
Expectedly, the expression level of miR-145 was significantly up-regulated in the xenografted tissues compared with that in the control group (Figure 4A). [score:5]
Moreover, we found that down-regulation of miR-145, which is caused by extracellular disposal via microvesicles, is related to 5-FU resistance in colon cancer cells [13]. [score:4]
Exogenous miR-145 induces apoptosis in and inhibits cell migration of 253J B-V cells. [score:3]
To avoid serious general side effects, bladder instillation is an apparently better way for microRNA to reach diseased tissue, where bladder cancer arises from the epithelial lining even in liposome-encapsulated miR-145. [score:3]
These results underscore complementary roles of the PI3K/Akt and Erk1/2 pathways for bladder cancer proliferation and motility in vitro and raise implications for a solid inhibitory effect of these signaling pathways induced by intra-vesical miR-145 in vivo. [score:3]
Intravesically administered miR-145 inhibits orthotopic bladder tumor growth in vivo. [score:3]
A. Relative expression levels of miR-145 in HUC and 253 J B-V cells. [score:3]
Figure 3Intravesically administered miR-145 inhibits orthotopic bladder tumor growth in vivo A. Schema of our mouse orthotopic bladder cancer mo del. [score:3]
C. Expression of various proteins estimated by Western blot analysis at 48 h after transfection of 253 J B-V cells with miR-145. [score:3]
As shown in Figure 2B, the ectopic expression of miR-145 significantly decreased cell migration of 253J B-V cells approximately 30%. [score:3]
To examine the growth inhibitory effect of miR-145 on in vivo growth of bladder tumors, we used our mouse mo del bearing 253J B-V bladder xenografted tumors that had been established by transplanting the tumor cells orthotopically in the bladder wall of nude mice [14, 15] (Figure 3A). [score:3]
As a result, miR-145 significantly inhibited the tumor growth of orthotopic 253J B-V xenografts when used at a dose of 100 nM (Figure 3B and 3C). [score:3]
A. Relative expression levels of miR-145 in xenografted tumors treated with miR-145 or control miR. [score:3]
Transfection of human 253J B-V cells with miR-145 resulted in a pronounced growth suppression that occurred in a dose -dependent fashion (Figure 1B). [score:3]
Figure 1 A. Relative expression levels of miR-145 in HUC and 253 J B-V cells. [score:3]
Furthermore, we showed an additional anti-tumor mechanism, i. e., suppression of compensatory molecular pathways, by continuous intravesical instillation therapy with miR-145 achieved with 8 periods of administration (Figure 4B) as opposed to the increased activity of these compensatory pathways found in vitro (Figure 1C). [score:3]
These analyses demonstrated that transfection with miR-145 was an effective way to accomplish growth suppression in 253J B-V cells. [score:3]
B. Effects of ectopic expression of miR-145 on cell viability. [score:3]
When compared with the untreated group, the mice treated with miR-145 showed 76% inhibition of tumor growth (Figure 3B and 3C, P = 0.0021). [score:2]
To determine the expression levels of miR-145, we conducted quantitative RT-PCR (qRT-PCR) by using TaqMan MicroRNA Assays (Applied Biosystems) and THUNDERBIRD Probe qPCR Mix (TOYOBO Co. [score:2]
MiR-145 acts as a tumor suppressor in 253 J B-V cells. [score:2]
We concluded that 253J B-V cells would be suitable for validating the anti-tumor effects of miR-145 in our mouse orthotopic human bladder cancer xenograft mo del. [score:1]
Firstly, however, we examined the in vitro anti-tumor effects of miR-145 on 253J B-V cells, as previously observed in various cancer cells including bladder cancer ones [8- 11]. [score:1]
MiR-145 is one of the representative anti-oncomiRs in various cancers. [score:1]
The mature type of miR-145 (mirVana™ miRNA mimic; Ambion, Foster City, CA, USA) was used for the transfection of the cells, which was achieved by using cationic liposomes, Lipofectamine™ RNAiMAX (Invitrogen), according to the manufacturer's Lipofection protocol. [score:1]
Therefore, we examined 253J B-V cells by analysis and after transfection of them with miR-145. [score:1]
In this current study, we validated whether miR-145 would have anti-tumor effects in a xenografted mouse. [score:1]
These findings suggested that miR-145 has the potential to be an anti-cancer drug against various cancers including bladder cancer. [score:1]
Likewise, miR-145 given this way will mainly affect the cells lining the inside of the bladder, with little to no effect on cells elsewhere. [score:1]
Synthetic miR-145 (100 nM) complexed with 100 μl of Lipofectamine [TM] RNAiMAX reagent (Invitrogen) was added to 50 μl of PBS and delivered 8 times intravesically every other day. [score:1]
The sequence of the mature type of miR-145 used in this study was 5′-GUCCAGUUUUCCCAGGAAUCCCUU-3′. [score:1]
A. Hoechst 33342 staining at 48 h after transfection of 253 J B-V cells with miR-145 at a concentration of 20 nM. [score:1]
Thus we propose that the use of miR-145 by the intravesical approach can become a successful therapeutic strategy for bladder cancer. [score:1]
Therefore, we regard that miR-145 therapy would be more suitable for patients when we consider the side effects. [score:1]
Also, to further enhance the anti-tumor effects, we are making chemically -modified miR-145 that can possibly be given in its naked form. [score:1]
The effects manifested by the introduction of miR-145 into the cells were assessed at 48 h after the transfection. [score:1]
These findings taken together suggested that the intravesical administration of miR-145 effectively exhibited its anti-tumor effect in the xenografted tumor through overcoming the serious immunological side effects caused by liposome-encapsulated miRNA. [score:1]
Transurethral administration of miR-145 prevented the intravesical growth of bladder cancer. [score:1]
We conducted intravesical instillation of liposome-encapsulated miR-145 after emptying the residual urine from the bladder. [score:1]
Figure 2 A. Hoechst 33342 staining at 48 h after transfection of 253 J B-V cells with miR-145 at a concentration of 20 nM. [score:1]
Exogenous miR-145 reduces cellular viability of human bladder 253J B-V cells. [score:1]
The concentration of miR-145 was 10 or 20 nM in each experiment. [score:1]
253J B-V cells were seeded into six-well plates at a concentration of 1.0 × 10 [5]cells/well and transfected with miR-145 (10 nM). [score:1]
253J B-V cells were collected at 48 h after transfection with miR-145 (20 nM). [score:1]
Cells (5 × 10 [3]) were plated in 96-well plates for 24 hours and then incubated for 48 hours with or without miR-145 at various concentrations for a total volume of 100 μL. [score:1]
We are comparing the anti-tumor effects between BCG and miR-145 in our mouse mo del now and plan to begin a clinical phase-one trial by using this system in the near future. [score:1]
Hoechst33342 nuclear staining indicated a typical apoptotic appearance such as condensed chromatin and nuclear fragmentation in the miR-145 -treated 253J B-V cells (Figure 2A). [score:1]
We consider that clinical application of miR-145 therapy may be realized in the near future by combining present knowledge with new techniques. [score:1]
B. The anti-tumor effect of miR-145 was analyzed after intravesical administration of miR-145 to established 253 J B-V tumors. [score:1]
Once tumors had developed (average volume 70 mm [3]), they were treated with 8 intravesical injections of miR-145. [score:1]
In this study, we showed that miR-145 could reach xenografted tumors by intravesical injection and have anti-tumor effects in our mouse mo del. [score:1]
These findings taken together suggested that miR-145 had the same anti-tumor effects in 253J B-V cells as previously found in other cancer cells [8, 9, 11]. [score:1]
Now, we are comparing the anti-tumor effects between BCG and miR-145 therapy in our mouse mo del (Figure 4C). [score:1]
[1 to 20 of 63 sentences]
16
[+] score: 149
Other miRNAs from this paper: mmu-mir-145a
Inhibition of ROR expression by siRNA can promote upregulated expression of endogenous miR-145 and silencing of nanog expression. [score:12]
Together these results demonstrate that down-regulation of ROR expression can increase the expression of endogenous miR-145 and silence of Nanog expression. [score:10]
The value of ROR as a potential prognostic biomarker and/or therapeutic target in PDAC was supported by findings the epigenetic mechanism of the competitive inhibition of ROR or Nanog expression by miR-145 for inhibiting the proliferation, invasion and tumourigenicity of PCSCs. [score:9]
Inhibition of ROR expression by siRNA can promote endogenous miR-145 silencing of Nanog expression in PCSCs. [score:7]
This means there is more miR-145 available to bind to Nanog, and its expression will be downregulated. [score:6]
In this study, the biological role of miR-145 appears to be to silence ROR expression; most miR-145 binds ROR and little is available for silencing Nanog expression. [score:5]
Considering the interaction of ROR/miR-145, we therefore hypothesize that ROR may also regulate Nanog expression in PCSCs, which signifies the role of ROR in the tumorigenesis -regulating network. [score:5]
Fluorescence in situ hybridization (FISH) was performed and revealed that the expression of ROR in PCSCs was significantly higher than in pancreatic cancer cells (PCCs), whereas miR-145 expression was higher in PCCs than PCSCs (Figure 2A). [score:5]
Similarly, in the present study, when miR-145 was bound to ROR, it could inhibit the expression of the transcription factor Nanog, which have previously been shown to play key roles in maintaining stem cell pluripotency and iPS cell reprogramming [17]. [score:5]
The results were in agreement with the expression in PCSCs and PCCs, ROR silencing resulted in increased expression of miR-145. [score:5]
Therefore we propose that miRNA-145 competitively decreases ROR and Nanog expression through a ‘sponge’ effect, and inhibits the proliferation, invasion and tumourigenicity of PCSCs, thus playing an oncogenic role in pancreatic pathogenesis. [score:5]
The results were in agreement with the expression in PCSCs and PCCs (Supplemental Figure 1), ROR silencing resulted in increased expression of miR-145. [score:5]
Our study had confirmed that Nanog is a direct target of miR-145 (Supplementary Figure 3). [score:4]
In our pilot experiments, we found that the expression of both Nanog and ROR negatively correlates with miR-145 levels in PCSCs and PCCs. [score:3]
When PCSCs overexpress siRNA-ROR, the cross-linking signal of miR-145 to the Dicer enzyme was strong, while the nucleic acid signal of ROR was barely detected (Figure 4B). [score:3]
Northern blot was used to detect RNA expression levels of ROR and miR-145. [score:3]
Similarly, the luciferase activity was significantly lower than the control group (p < 0.05) when miR-145 and the Nanog mRNA 3′UTR were simultaneously overexpressed in the same cell line (Figure 2C). [score:3]
These results suggest that miR-145 can induce post-transcriptional silencing of its targeted genes by binding to the Nanog mRNA 3′UTR or ROR specific sites. [score:3]
So we further confirm that the expression of ROR and miR-145 are negatively correlated in pancreatic cancer tissue samples(Supplemental Figure 1). [score:3]
Similarly, when simultaneously overexpressing miR-145 and the Nanog mRNA 3′UTR in the same cell line, the Luciferase activity was significantly lower than that of the control group (pRNT-CMV32) (* p < 0.05; # p > 0.05; n = 3). [score:3]
By binding to this site, miR-145 induces Dicer enzyme cleavage of Nanog mRNA to silence Nanog expression. [score:3]
So we further confirm that the expression of ROR and miR-145 are negatively correlated. [score:3]
ROR and miR-145 expression are negatively correlated. [score:3]
Meanwhile, it was shown that when miR-145 was bound to ROR, it could negatively silence the expression of an embryonic stem cell pluripotent transcription factor Oct4, and therefore, the pluripotency of the embryonic stem cells was maintained [14, 16, 17, 20]. [score:3]
The present work provides an evidence for a positive ROR/Nanog correlation and the crosstalk between miR-145, ROR and Nanog, shedding new light on the potential therapeutic target in pancreatic cancer. [score:3]
Silencing ROR expression can enhance the negative regulation of Nanog by miR-145 and effectively reduce the malignant tumor characteristics of PCSCs. [score:2]
The miR-145 may function as a ‘sponge’-like material, absorbing ROR and regulating cell proliferation [16]. [score:2]
A. fluorescence in situ hybridization experiments show that ROR and miR-145 display opposite expression levels in pancreatic cancer cells (PCCs) compared to pancreatic cancer stem cells (PCSCs). [score:2]
Using a luciferase reporter assay, we found that the luciferase activity was significantly lower than the control group (p < 0.05) when miR-145 and the ROR 2055 bp-2059 bp sequence were simultaneously overexpressed in the same cell line (Figure 2C). [score:2]
C. The luciferase reporter assay results showed that when simultaneously overexpressing miR-145 and the ROR 2055 bp-2059 bp sequence in the same cell line, the luciferase activity was significantly lower than that of the control group. [score:2]
Figure 2 A. fluorescence in situ hybridization experiments show that ROR and miR-145 display opposite expression levels in pancreatic cancer cells (PCCs) compared to pancreatic cancer stem cells (PCSCs). [score:2]
RoR has been reported to act as an endogenous sponge of miR-145 in hESCs [16]. [score:1]
Through bioinformatics, we showed that the 3′UTR of Nanog mRNA has a specific miR-145 binding site. [score:1]
Therefore, when both ROR and Nanog exist in the same cell (as in PCSCs), they are in a competition for miR-145 binding. [score:1]
ROR and Nanog share a common miR-145 binding site. [score:1]
Hybridization was performed with the miR-145 or ROR antisense starfire probe, to detect the miR-145 or ROR fragments according to the instruction of the manufacturer. [score:1]
The ROR sequence also contains a miR-145 binding site. [score:1]
However, in siRNA-Control-PCSCs, there was a PCR band corresponding to ROR in the Dicer enzyme-nucleic acid complex, whereas the miR-145 PCR signal was very weak (Figure 4B). [score:1]
The cells were seeded at 3×104/well in 48-well plates and co -transfected with 400ng of pRNAT-CMV32-miR-145 or pRNAT-CMV32-Mut-miR-145 or pRNAT-CMV32, 20ng of pGL3cm-ROR-2037-2059 or pGL3cm-ROR-mut-2037-2059 or pGL3cm-Nanog-3UTR or pGL-Nanog-Mut-3UTR or pRL-TK (Progema, Madison, USA) using Lipofectamine 2000 Reagent according to the manufacturer's protocol. [score:1]
The red box represents the binding site for miR-145 on the Nanog mRNA 3′UTR, and the blue box represents the binding site for miR-145 on ROR. [score:1]
Further, the results also suggest that there is competition for miR-145 between ROR and Nanog. [score:1]
However, the miR-145 hybridization signal in the siRNA-ROR transfection group was significantly stronger than in the siRNA-Control transfection group. [score:1]
In addition, recent studies by Wang et al. and Chen et al. have shown that the levels of ROR in embryonic stem cells are controlled by endogenous miR-145 [14, 16]. [score:1]
In siRNA-ROR -transfected PCSCs, the cross-linking signal of miR-145 to the Dicer enzyme was stronger than in the siRNA-Control -transfected PCSCs. [score:1]
To investigate the miRNA-related functions of ROR in pancreatic pathogenesis, we chose miR-145 as a mo del miRNA for further studies, with a particular focus on the target gene Nanog. [score:1]
A bioinformatics analysis showed that there are conserved binding sites for miR-145 on both ROR and the 3′UTR of Nanog mRNA. [score:1]
The above relationship between ROR, miR-145 and Nanog can be defined as mutually competitive and mutually restrictive. [score:1]
We also analyzed the ROR and miR-145 in serial sections of tissues by FISH. [score:1]
However, the miR-145 hybridization signal in the siRNA-ROR -transfected cells was significantly stronger than in the siRNA-Control -transfected PCSCs (Figure 4A). [score:1]
[1 to 20 of 49 sentences]
17
[+] score: 148
Given our observation of significant downregulation of miR-143 and miR-145 and upregulation of miR-223 in cells treated with 3.5 mM Pi, we used RT-qPCR to determine the expression levels of representative VSMC phenotypic marker genes - most of which are targeted by these miRNAs [8], [10]. [score:11]
Elevated Pi significantly downregulates expression of miR-143 and miR-145 and upregulates miR-223. [score:9]
These changes were evidenced by significant downregulation of miRNA-143 (miR-143) and miR-145 and concomitant upregulation of their targets and key markers in synthetic VSMCs, such as Krüppel-like factors−4 and −5 and versican. [score:9]
In contrast, some of the synthetic phenotypic markers (such as Krüppel-like factor 4 [KLF4], KLF5, platelet derived growth factor receptor-α [PDGFR α] and versican [VSCN]) which are all targeted by miR-143 and/or miR-145 [7] were significantly upregulated; this was expected, given the observed downregulation of the corresponding miRNAs (Figure 2A). [score:9]
Furthermore, downregulation of miR-143 and miR-145 in the presence of high Pi implies the upregulation of their targets (such as KLF4, KLF5, PDGFRα and VSCN). [score:9]
To complement these in vitro findings, we also observed significant downregulation of miR-143 and miR-145 and upregulation of miR-223 in aorta samples collected from ApoE knock-out mice, which display vascular calcification. [score:8]
miR-143 and miR-145 are downregulated and miR-223 is upregulated in ApoE- KO mice. [score:7]
Our in vivo results in a well-established murine mo del thus reflected our in vitro findings, i. e. downregulation of miR-143 and miR-145 and upregulation of miR-223 in the presence of calcium-Pi deposits. [score:7]
Evidence from our studies suggests that Pi alters cell proliferation and migration, reduces the amount of the actin cytoskeleton, downregulates miR-143 and miR-145 and upregulates miR-223. [score:7]
Here, we showed that high Pi treatment results into downregulation of SMαA and MYO, with a concomitant downregulation of miR-143 and miR-145. [score:7]
There was significant downregulation of miR-143 and miR-145 and concomitant upregulation of miR-223 in 20-week-old ApoE- KO mice. [score:7]
These events affected downstream processes by reducing the size of the actin cytoskeleton, disturbing cell morphology, upregulating miR-143 and miR-145 targets and, ultimately, leading to increased calcification and a greater VSMC migration rate. [score:6]
The expression of miR-143 and miR-145 was also downregulated in Pi -treated cells. [score:6]
The latter authors also determined that expression levels of miR-143 and miR-145 are low in the aortas of apolipoprotein E gene knockout (ApoE- KO) mouse. [score:4]
MiR-143 and miR-145 (the most extensively studied species) have been correlated with human cardiovascular diseases, since VSMC maintenance and vascular homeostasis are altered in mir-143 and mir-145 knock-out (KO) mice [8]. [score:4]
Interestingly, we also found that miR-143 and miR-145 are downregulated in vivo in the aortas of ApoE- KO mice. [score:4]
Here, we expanded on Elia et al. results by finding that downregulation of miR-143 and miR-145 in mouse aortas was not detected in younger mice but became significant in 20-week-old mice (which also display vascular calcification [23]). [score:4]
We found significant downregulation of the vascular miRNAs miR-143 and miR-145 and a number of contractile phenotypic marker genes, such as MYO and SMαA [7]– [10]. [score:4]
MiR-143 and miR-145 negatively regulate the expression of many genes that are specific for the VSMC synthetic phenotype [7], [10]. [score:4]
RNAs extracted from mouse aorta collected from 8- and 20-week-old ApoE- KO and wild-type mice were used for the qPCR expression analysis of miR-143, miR-145 and miR-223. [score:3]
Expression of miR-143, miR-145 and miR-223 in wild-type and ApoE- KO mice. [score:3]
Additionally, a detailed study by Cordes et al. [10] showed that miR-145 can direct the fate of smooth muscle and regulate the synthetic phenotype of smooth muscle cells. [score:3]
There was a significant downregulation (20–25%) of both miR-143 and miR-145 in 3.5 mM Pi treated cells, when compared with control cells (Figure 1E). [score:3]
0047807.g006 Figure 6 RNAs extracted from mouse aorta collected from 8- and 20-week-old ApoE- KO and wild-type mice were used for the qPCR expression analysis of miR-143, miR-145 and miR-223. [score:3]
As observed with VSMCs in culture, the expression levels of both miR-143 and miR-145 were significantly lower in ApoE- KO mice than in WT mice. [score:3]
We thus investigated the expression of miRNAs miR-143 and miR-145 in the presence of high Pi. [score:1]
Lastly, we sought to study the fate of miR-143, miR-145 and miR-223 under in vivo vascular calcification conditions. [score:1]
Our results suggest that miR-143, miR-145 and miR-223 are potential biomarkers of vascular calcification. [score:1]
In our in vitro and in vivo mo dels, we confirmed the previously described impacts of miR-143 and miR-145 on normal and pathological cardiovascular events. [score:1]
[1 to 20 of 29 sentences]
18
[+] score: 130
Figure 4 (A) Tube formation photos of HMEC-1 cells at 10x magnification with i) no vector ii) control vector iii) miR-143-3p over -expression vector or iv) miR-145-5p over -expression vector v) graph of tube formation on HMEC-1 endothelial cells with no direct over expression (-) and direct over expression of miR-scramble (SCR), miR-143 (143) and miR-145 (145). [score:11]
To confirm that the observed increases in tube formation were at least in part caused by the presence of miR-145-5p or miR-143-3p, we examined the tube forming ability of HMEC-1 cells that directly over-expressed miR-145 and miR-143 (as opposed to being over-expressed via EVs). [score:6]
Figure 5 (A) of CAMK1D and Histone 3 in HMEC-1 cells after direct over expression of miR-143, miR-145 and miR-Scramble within HMEC-1 cells and after incubation with EVs isolated from H1437 over expressing miR-143, miR-145, miR-Scramble and unmodified cell. [score:6]
EVs over -expressing miR-143 and miR-145, as well as miR-Scramble EVs (using a miRNA scramble, but still expressing normal levels of miR-143-3p and miR-145-5p in the EVs) were collected and incubated with HMEC-1 cells for 24 hours, along with HMEC-1 cells receiving no EVs. [score:5]
Over -expression (OE) cell lines were created using the FIV lenti-vectors HmiR0085-MR01 for miR-145, HmiR0084-MR01 for miR-143, or CmiR0001-MR01 (miR-Scramble) for a scramble sequence control (GeneCopoeia), vectors express both 3p and 5p miRNAs. [score:5]
Our results show that miR-143-3p and miR-145-5p are in fact expressed by LAC cells; however, they are packaged into EVs so efficiently that expression of these miRNAs in the donor cells is typically not detected. [score:5]
Dimitrova et al. (2016) first showed that stromal expression of miR-143/miR-145 promotes neoangiogenesis by targeting CAMK1D [20]. [score:5]
We over-expressed miR-143, miR-145 and a miR-Scramble individually in H1437 cells, and H2073 cells which resulted in >100-fold over -expression of these miRNAs in the EVs derived from these cells. [score:5]
HMEC-1 cells were grown without EVs or in the presence of EVs over -expressing miR-143, EVs over -expressing miR-145 or control EVs (endogenous EV levels of miR-143 and miR-145). [score:5]
Once in the EVs, miR-143/miR-145 can enter endothelial cells and down-regulate CAMK1D protein levels. [score:4]
Once packaged the EVs are capable of shuttling miRNA cargo to endothelial cells where miR-143-3p and miR-145-5p down-regulate CAMK1D, promoting angiogenesis. [score:4]
The addition of EVs over -expressing miR-145-5p or miR-143-3p further increased the length of tubes formed compared to miR-Scramble over -expressing EVs (Figure 4I). [score:4]
Figure 4I demonstrates that direct over -expression was capable of increasing tube formation by 36% and 34% for miR-145 and miR-143, respectively (p<0.04 for both). [score:4]
Herein, we also demonstrated that miR-143-3p and miR-145-5p derived from LAC cell EVs can target the endothelial cell function of CAMK1D, a negative regulator of angiogenesis. [score:4]
HMEC-1 cells over -expressing miR-143 and miR-145 had decreased CAMK1D protein levels (87% and 96%, respectively) compared to HMEC-1 cells over -expressing the miR-Scramble (Figure 5A and 5B). [score:4]
Both miRNAs have been previously implicated as mediators of neo-angiogenesis and our analysis shows that when transferred through tumor derived EVs miR-143-3p and miR-145-5p promote tube formation through targeting of CAMK1D in endothelial cells. [score:3]
Given their increased EV expression in both LAC cell lines and LAC patient serum samples, we reasoned that EV -mediated miR-145-5p and miR-143-3p activity might promote lung tumorigenesis. [score:3]
Analysis of CAMK1D targeting by miR-143 and miR-145. [score:3]
HMEC-1 cells incubated with miR-Scramble over -expressing EVs (with normal miR-145-5p and miR-143-3p levels within EVs) showed an increase in miR-145-5p >5 fold and a slight increase in mR-143-3p by >2 fold (Figure 3). [score:3]
They also reported that expression of miR-143/miR-145 occurs in a small population of endothelial cells, but not lung epithelial cells [20]. [score:3]
We show that miR-145-5p and miR-143-3p are in fact produced by lung adenocarcinoma cells; however, no expression is observed in the epithelial cells, as these miRNAs are efficiently packaged into EVs and exported from the cell. [score:3]
Recent work demonstrated that miR-145-5p and miR-143-3p are capable of promoting neoangiogenesis by targeting CAMK1D in endothelial cells, and that loss of the miR-145/miR-143 cluster in these cells led to decreases in neoangiogenesis via CAMK1D [20]. [score:3]
MiR-143-3p and miR-145-5p are important tumor suppressors in many cancer types including lung, bladder, colon, and breast [32– 35]. [score:3]
MiR-145-5p and miR-143-3p increased by ~14-fold and ~6-fold in HMEC-1 cells incubated with EVs over -expressing miR-143 and miR-145 respectively when compared to HMEC-1 cells that were not incubated with EVs (Figure 3). [score:2]
Figure 3 Intracellular fold change analysis of miR-143-3p, miR-145-5p and miR-346 in HMEC-1 cells incubated with EVs from H1437 cells over expressing miR-143, miR-145 and miR-Scramble, compared to HMEC-1 cells receiving no. [score:2]
The addition of EVs from H1437 miR-Scramble over -expressing cells (with normal miR-145-5p and miR-143-3p levels within EVs) significantly increased the ability of HMEC-1 cells to form tubes compared to the HMEC-1 cells receiving no EVs (p<0.01) (Figure 4I). [score:2]
MiR-143-3p and miR-145-5p are enriched within serum draining directly from LAC tumors. [score:2]
Intracellular fold change analysis of miR-143-3p, miR-145-5p and miR-346 in HMEC-1 cells incubated with EVs from H1437 cells over expressing miR-143, miR-145 and miR-Scramble, compared to HMEC-1 cells receiving no. [score:2]
Cross referencing with miRNA profiles obtained from serum collected from blood directly draining from the tumor suggests a biological role for miR-143-3p and miR-145-5p in lung tumorigenesis. [score:2]
A greater decrease was observed in HMEC-1 cells incubated with EVs over -expressing miR-145 or miR-143, showing a 79% and 83% decrease respectively compared to HMEC-1 cells receiving no EVs (Figure 3B). [score:2]
To the best of our knowledge, this is the first time miR-143-3p and miR-145-5p are reported as enriched within EVs released directly from LAC cells. [score:2]
MiR-145-5p is also known to target IGF1R in colorectal cancer, as well as EGFR in LAC [28, 29]. [score:2]
MiR-143-3p and miR-145-5p, two miRNAs enriched within LAC EVs, were also found enriched within serum obtained from blood draining directly from LAC tumor bearing lungs indicating a biological significance. [score:2]
Of the remaining EV miRNA candidates, miR-143-3p and miR-145-5p were enriched in tumor draining effluent samples. [score:1]
All HMEC-1 cells that received EVs containing miR-143-3p or miR-145-5p showed a decrease in CAMK1D protein by western blot. [score:1]
Significance was reached for miR-145 (p=0.03) but not for miR-143 (p=0.1) (Figure 4I). [score:1]
To interrogate the impact of EV -associated miR-143-3p and miR-145-5p, the levels of these miRNAs within EVs must be manipulated. [score:1]
MiR-145-5p and miR-143-3p promote tube formation in endothelial cells. [score:1]
Our remaining miRNA candidates (miR-143-3p, miR-145-5p, miR-223-3p, and miR-605-5p) appear to be more specific to lung adenocarcinoma. [score:1]
Impact of miR-143 and miR-145 on tube formation. [score:1]
In the present study, using LAC cell lines, we identified several miRNAs (miR-142-3p, miR-143-3p, miR-145-5p, miR-150-5p, miR-223-3p, miR-451a, miR-486-5p, and miR-605-5p) that are selectively packaged into EVs and released into the tumor microenvironment. [score:1]
We next sought to determine if the transfer of EVs, and in particular miR-143-3p and miR-145-5p, within the EVs is capable of inducing tube formation changes in endothelial cells. [score:1]
[1 to 20 of 42 sentences]
19
[+] score: 96
Other miRNAs from this paper: mmu-mir-145a, hsa-mir-34a, hsa-mir-145, mmu-mir-34a
of small inhibitory oligonucleotides to counter expression of targeted miRNAs (anti-miRNAs), anti- miR-34a and anti- miR-145, resulted in ∼80% miRNA depletion (Figure S6C), and had specific effects on expression of stem cell factors: inhibition of miR-34a led to increased expression of OCT4, KLF4, LIN28A, and SOX2 proteins, and to a lesser extent SIRT1 (Figure 6E), as well as SOX2 and SIRT1 RNA (Figure 6D). [score:13]
siRNA targeting human TP53, CDKN1A (p21), HDM2, TRIM24 (Table S1) and non-target (control) were purchased from Dharmacon and anti-miRNA oligonucleotides targeting human miR-34a, miR-145, and miR-nonspecific were purchased from Applied Biosystems. [score:7]
miR-145 is known to be a p53 target in somatic cells [54]; however, the mechanisms that lead to miR-145 up-regulation during differentiation of hESCs have not been defined. [score:6]
In parallel, p53 activates specific microRNAs, miR-34a and miR-145, that inhibit the expression of several stem cell factors and prevent differentiated cells from backsliding to pluripotency. [score:5]
Inhibition of miR-145 induced protein levels of OCT4, SOX2, and KLF4, as well as increased RNA expression of SOX2 and KLF4 (Figure 6D and 6E). [score:5]
Pluripotency genes targeted by mir-145 are known [53]; additionally, we found that mir-34a has predicted target sites within the 3′ UTRs of KLF4 and LIN28A, which are conserved across species (Figure 6G). [score:5]
miR-145 targets c-Myc [54], which is known to repress p21 [55]; thus, miR-145 represses pluripotency factors and likely contributes to regulation of the hESC cell cycle by decreasing c-Myc and indirectly activating p21 during differentiation. [score:5]
In silico analysis by TargetScan [56], PicTar [57], miRanda [58], and miRBase [59] of genes potentially regulated by miR-34a and miR-145 identified several genes significant to ESC biology (Figure S7E). [score:4]
Putative p53 targets included miRNAs; among these, we focused on miR-34a and miR-145 as likely significant in the p53 -mediated regulation of hESCs. [score:4]
In response to RA treatment and differentiation of hESCs, miR-34a and miR-145 were significantly up-regulated in a p53 -dependent manner (Figure 6A and 6B), an induction which also occurs with a DNA-damaging agent, Adr (Figure S7A). [score:4]
On the other hand, miR-145 targets OCT4, KLF4, and SOX2 and antagonize pluripotency. [score:3]
Quantitative determination of OCT4/SSEA4 -positive cells by flow cytometry analysis revealed that hESCs could differentiate with RA after inhibition of miR-34a but not in the presence of anti- miR-145 (Figure 6F). [score:3]
miR-145 was discovered to be a direct repressor of pluripotency factors, but was not shown to be regulated by p53 in stem cells [53]. [score:3]
However, since DNA damage induced miRNAs miR-34a and miR-145 but did not promote accumulation of hESCs in G [1] and differentiation of hESCs, as seen with RA treatment or ectopic p53 expression, it is clear the miRNAs alone are insufficient to induce differentiation of hESCs. [score:3]
Activation of p53 elongates the G [1] phase of the cell cycle by p21 induction, and increases miR-34a and miR-145, which target specific stem cell factors for repression. [score:3]
Here we show that p53 activates miR-34a and miR-145 expression during RA -mediated differentiation of hESCs. [score:3]
p53 Regulates miR-34a and miR-145 to Drive Differentiation of hESCsTo understand the mechanism underlying p53 -mediated differentiation of hESCs, we performed high-throughput sequencing analysis of hESCs incubated with RA (unpublished data). [score:2]
In contrast, a role for miR-145 in differentiation of hESCs is known, where miR-145 acts by negatively regulating levels of pluripotency genes, OCT4, SOX2, and KLF4 [53]. [score:2]
p53 regulates miR-34a and miR-145 to drive differentiation of hESCs. [score:2]
Thus, p53 exerts a cumulative pro-differentiation effect by elongating hESC G [1] phase via p21 and synergistically up -regulating miR-34a and miR-145 to counteract pluripotency. [score:2]
p53 Regulates miR-34a and miR-145 to Drive Differentiation of hESCs. [score:2]
1001268.g006 Figure 6p53 regulates miR-34a and miR-145 to drive differentiation of hESCs. [score:2]
We found that miR-145 has a more significant role in differentiation of hESCs, with miR-34a acting to augment its functions. [score:1]
Differentiation induces acetylation at Lys373 of p53 via CBP/p300, p53K373ac then activates transcription by binding to p53REs on CDKN1A (p21), miR-34a, and miR-145. [score:1]
hESCs transfected with either anti- miR-NS (control) or anti- miR-145 oligonucleotides and treated with RA were stained with PI and subjected to flow cytometry analysis. [score:1]
RA treatment led to a time -dependent enrichment of p53 at predicted p53REs of both miR-34a and miR-145 (Figure 6C), in parallel with the transient activation of p53. [score:1]
Depletion of miR-145 also significantly affected accumulation of hESCs in G [1] after RA treatment (Figure S7D). [score:1]
miRNAs were analyzed using total RNA from hESCs with probes specific for human miR-34a and miR-145 and were normalized to RNU6B as internal control (*, p<0.01). [score:1]
The collective effects of p53 activation elongate the G [1] phase and antagonize pluripotency by induction of miR-34a and miR-145 (Figure 7). [score:1]
p53-bound chromatin was immunoprecipitated from hESCs, and p53 enrichment on miR-34a and miR-145 promoters was analyzed by qRT-PCR (*, p<0.05). [score:1]
[1 to 20 of 30 sentences]
20
[+] score: 72
For example, Tnfsf10, a critical pro-apoptotic gene whose expression was upregulated by 1.9-fold in the LW of C57 mice, is predicted to be regulated by two anti-apoptotic miRNAs, miR-145 and miR-107, which were downregulated at 9 m. Also, Birc5, an anti-apoptotic gene downregulated in both strains during aging, is predicted to be regulated by miR-200a, a known pro-apoptotic miRNA that was upregulated at 9 m in the LW of C57 mice. [score:17]
Tnfsf10 is predicted to be directly targeted by miR-107 and miR-145, which were found to be expressed in the SV and downregulated during aging in both strains. [score:9]
miR-203 was expressed in all cell types with weak expression in the marginal cells, while miR-145 was expressed in all cell types in the SV with strongest expression in the marginal cells. [score:9]
miR-107 and miR-145 were found to be expressed in the SV and downregulated during aging in both strains. [score:6]
Notably, our data revealed that expression of Tnfsf10 (upregulated by ∼2-fold) is likely influenced by several miRNAs including miR-107, miR-145, miR-342-3p, miR-491, miR-494, miR-182, and miR-467a. [score:6]
The expression of miR-145 in melanocytes exhibits a negative relationship with the expression of Sox9, Mitf, Tyr, Trp1, Myo5a, Rab27a, and Fscn1. [score:5]
The four downregulated miRNAs are miR-107, miR-145, miR-342, and miR-455. [score:4]
miR-145 additionally targets the insulin receptor substrate-1 (IRS1), a factor in the insulin/insulin-like growth factor-1 (IGF-1) signaling pathway, the first established aging pathway [74]. [score:3]
miR-145 expression is also found in the vascular wall of the capillaries in the SV [63], [64] and in the intermediate cells. [score:3]
miRNAs that were differentially expressed only in the LW during aging include miR-29c, miR-705, miR-99a, miR-127, miR-130a, miR-145, miR-151-5p, miR-379, miR-467a, and miR-574-3p. [score:3]
Previous studies demonstrated miR-145 is abundantly expressed in the smooth muscle tissues and critical for vascular smooth muscle cell differentiation [61], [62]. [score:3]
Dynoodt et al. [65], [66] demonstrated that miR-145 is a key regulator in melanogenesis. [score:2]
miR-145 was also detected in the SV by in situ hybridization (Fig. 6B). [score:1]
These miRNAs include miR-107, miR-127, miR-130a/b, miR-145, miR-342, miR-351, miR-379, miR-455, and miR-467. [score:1]
[1 to 20 of 14 sentences]
21
[+] score: 71
miR-145 is downregulated in various cancers and has been demonstrated to possess tumor suppressor and metastasis inhibitory properties [29, 30]. [score:8]
Recently, it was reported that miR-145 inhibits cell proliferation of human lung adenocarcinoma by targeting EGFR, indicating that miR-145 is a tumor suppressor miRNA [55]. [score:7]
These data suggest that knockdown of DCLK1 results in downregulation of miR-145 miRNA downstream targets in pancreatic cancer cells. [score:7]
miR-145 specifically inhibits the aforementioned pluripotency factors by binding the 3’ untranslated region (UTR) of mRNA, which leads to inhibition of ESCs, self-renewal, and induction of differentiation. [score:7]
In cancer, miR-145 is downregulated and has been demonstrated to possess tumor suppressor properties. [score:6]
Knockdown of DCLK1 results in downregulation of pluripotency factors in pancreatic tumor xenografts via miR-145. [score:5]
Following the knockdown of DCLK1 in AsPC-1 tumor xenografts, a significant upregulation of miR-143/145 cluster (A) and miR-145 miRNA (B) by real-time RT-PCR. [score:5]
Overall, these data taken together demonstrate a potential regulatory role for DCLK1 in the expression of iPSC factors in pancreatic cancers via miR-145 miRNA. [score:4]
These data taken together suggest that miR-145 is a master regulator of iPSCs factors in ESCs and CSCs and may play an important role in inhibition of pancreatic cancer initiation, progression and EMT. [score:4]
Furthermore, in another published work, it was demonstrated that EGFR suppress miR-143 and miR-145 in a murine mo dels of colon cancer [56]. [score:3]
C, A decrease in luciferase activity (luciferase units) following transfection with plasmid-encoding luciferase containing the miR-145 binding site was observed following the knockdown of DCLK1 in AsPC-1 human pancreatic cancer cells. [score:2]
Similarly, here we observed a significant induction (1.5-fold) of pri-miR-143/145 cluster miRNA (Figure 3A) and pri-miR-145 miRNA (Figure 3B) following the knockdown of DCLK1 in AsPC-1 tumor xenografts. [score:2]
DCLK1 post-transcriptionally regulates miR-145 in pancreatic cancer. [score:2]
This indicates (a) the existence of a direct link between the core reprogramming factors and miR-145, and (b) the presence of a double -negative feedback loop involving OCT4, SOX2, KLF4, and miR-145 [21]. [score:2]
Furthermore, Ras-responsive element binding protein 1 (RREB1) represses miR-143/ miR-145 promoter activity, which indicates that repression is an early event in pancreatic cancer initiation and progression [29]. [score:1]
Repression of miR-143 and miR-145, two co-transcribed miRNAs located on human chromosome 5q, has been reported in pancreatic cancer. [score:1]
miR-145 has been shown to repress OCT4, SOX2, and KLF4, thereby repressing pluripotency and controlling differentiation [21]. [score:1]
Furthermore, loss of miR-145 impairs differentiation and elevates OCT4, SOX2, and KLF4 [21]. [score:1]
Additionally, it has been demonstrated that the miR-145 promoter is bound and repressed by OCT4 in ESCs. [score:1]
AsPC-1 cells were transfected with a plasmid containing the firefly luciferase gene with a complementary miR-145 binding site at the 3' UTR. [score:1]
The loss of miR-145 (miR-143/145 cluster) is observed in KRAS mutated pancreatic cancers, and therapeutic restoration of these miRNAs abrogates tumorigenesis [29, 30]. [score:1]
[1 to 20 of 21 sentences]
22
[+] score: 68
Furthermore, miR-145, miR-192, and miR-378 also showed inhibitory role in the expression of B7-DC, CTLA4 and PD-1. Taken together, our present study provides the first evidence that under-regulated miRNAs play significant roles in inhibiting translation of B7 co -inhibitory molecules, especially miR-143 in B7-H3 and B7-H4. [score:12]
We found that TGF-β1 upregulated the expression of miR-155, while downregulating the expression of miR-143, miR-145, miR-192, and miR-378 (Figure 4A). [score:11]
In addition, our results showed that miR-145, miR-192, and miR-378 suppressed the expression of co -inhibitory molecules B7-H3, B7-DC, CTLA4, and/or PD-1 (Supplementary Figure S3). [score:7]
MiR-143 inhibited the growth of CRC cells in vitro and in vivoGiven the important role of down-regulated miRNAs in cancer immune escaping, we assessed the impact of miR-143, miR-145, miR-192, and miR-378 on the growth of HCT-116 cancer cells. [score:6]
Interestingly, we found that the expression of miR-155 was inversely proportional to those of miR-143, miR-145, miR-192, and miR-378 in normal tissues (Figure 3D and 3E; Supplementary Table S3), conversely to the expression in adenoma and carcinoma tissues (Figure 3F and 3G). [score:5]
In the adenoma tissues, we found that the expression of miR-155, miR-143, miR-145, miR-192, and miR-378 were initially deregulated (Figure 3H). [score:4]
was used to determine the effect of the down-regulated miRNAs, including miR-143, miR-145, miR-192, and miR-378, on the proliferation of HCT-116 cells. [score:4]
We found that miR-143 and miR-145 were mostly related to the TGF-β signaling pathway (Supplementary Table S4), suggesting a regulatory role of TGF-β1 in their expression. [score:4]
Down-regulation of miR-143, miR-145, miR-192, and miR-378 has also been well documented in many types of human tumors including colorectal cancer [38– 40]. [score:4]
Given the important role of down-regulated miRNAs in cancer immune escaping, we assessed the impact of miR-143, miR-145, miR-192, and miR-378 on the growth of HCT-116 cancer cells. [score:4]
Figure 4(A) Impact of TGF-β1 on the expression of miR-143, miR-145, miR-155, miR-192, and miR-378 in HCT-116 cells. [score:3]
The miR-143 and miR-145 mimics significantly inhibited the proliferation of the HCT-116 cells in vitro as compared with the scramble miRNA control (Figure 8A). [score:2]
Figure 8(A) Impact of miR-143, miR-145, miR-192, and miR-378 mimics on the growth of HCT-116 cells in vitro. [score:1]
We found that the miR-155 node was close to those of miR-143, miR-145, and miR-192, etc. [score:1]
[1 to 20 of 14 sentences]
23
[+] score: 60
The 6 upregulated miRNAs (mmu-miR-5132-5p, mmu-miR-3104-5p, mmu-miR-669c-5p, mmu-miR-705, mmu-miR-760-3p, mmu-miR-1962) and the 9 downregulated miRNAs (mmu-miR-146a, mmu-miR-138, mmu-miR-5123, mmu-miR-196b, mmu-miR-5099, mmu-miR-150, mmu-miR-145, mmu-miR-27a, mmu-miR-23a) chosen for validation were also based on their target genes predicted, whose functions are well relevant to inflammation and cancer. [score:9]
Only one patient (Sample 6) showed upregulation of miR-145, but the upregulation was not significant (Figure 3B, p>0.05). [score:7]
As shown in Figure 3, in overall, the expression level of miR-138, miR-145, miR-146a and miR-150 were downregulated by approximately 3.37, 3.39, 2.56 and 4.99 fold in colorectal cancers than those in the matched adjacent normal mucosa (p<0.0001). [score:6]
Among them, all the 16 colorectal cancers showed downregulated miR-138 and miR-150 levels (Figures 3A and 3D), and 15 out of the 16 colorectal cancers showed lower miR-145 and miR-146a expression levels than normal control (Figures 3B and 3C). [score:6]
Moreover, microRNA-145 induces apoptosis with the induction of tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) expression, targeted oncogene socs7 and regulated interferon-β induction through STAT3 nuclear translocation in bladder cancer cells [45]. [score:6]
Please be noted that CCT3 and PAPPA were the common targets for miR-138, miR-146a and miR-150, and ZHX2 was the common target for miR-138, miR-145 and miR-150. [score:5]
As shown in Figure 5 and Table 2, there were 21, 13 and 25 common targets between miR-138 and miR-145, miR-146a and miR-150, respectively; there were 16 and 15 common between miR-145 and miR-146a and miR-150, respectively; and there were 7 common targets between miR-146a and miR-150. [score:5]
miR145 could target the SOX9/ADAM17 axis and inhibit tumor-initiating cells and IL-6 -mediated paracrine effects in head and neck cancer [44]. [score:5]
B, miR-145 was significantly downregulated in colorectal cancers. [score:4]
B, miR-145 was significantly downregulated in colitis. [score:4]
miR-145 is also a tumor suppressor gene. [score:3]
[1 to 20 of 11 sentences]
24
[+] score: 57
For M2-skewed activation, the down-regulation of miRNAs is critical in ‘releasing’ primary microglia from their M0 state, through down regulation of miR-711 and miR-124, and up-regulation of miR-145 may facilitate establishing the M2a-alternatively activated state. [score:8]
Supporting a role for miR-145 in the IL-4/STAT6 signaling, Collison A. et al. have recently demonstrated that miR-145 inhibition is as effective as steroid treatment in animal mo dels of allergic airway disease, a disease mediated by IL-4 induced Th2 skewing disorder [55]. [score:7]
Interestingly, down-regulation of miR-711 or mir-124 are as significant as up-regulation of either miR-145 or miR-449a in establishing the M2a phenotype based on –log(p-value) score (Fig 4D and Table S5). [score:7]
Further, our second IPA analysis identified that down-regulation of miR-711 or miR-124 may play a key role in ‘releasing’ microglia from the M0 state, and up-regulation of miR-145 may contribute to establishment of the M2a state. [score:7]
Using the same screening criteria as described above, we performed the second IPA enrichment analysis on four up-regulated miRNAs upon IL-4 stimulation: miR-145, -214, -297b-5p, and -449a and nine are down-regulated miRNAs: miR-711, -124, -2133, -2135, -2132, -2861, - 2138, -762, and -1224. [score:7]
Overall, we have identified miRNAs miR-155 and miR-145 as the most significantly up-regulated miRNAs in the M1 or M2a-skewed microglia, respectively. [score:4]
We observed several miRNAs that are significantly up-regulated in IL-4 stimulated primary microglia, including miR-145 and mir-214. [score:4]
Upon M2a-skewing of primary microglia we observed up-regulation in two miRNAs: miR-145 and miR-214. [score:4]
miR-145 was recently identified as down-regulated in M2-skewed peripheral macrophages as compared to that of M1-skewed macrophages while this paper was being revised [81]. [score:3]
The M2a-phenotype appears to rely on induction of miR-145, which may regulate the ETS1 pathway. [score:2]
Interestingly both miR-145 and miR-214 are anti-oncogenic miRNAs [51]– [54]. [score:1]
However, Jindra, PT et al. reported a role for miR-214 in T cell proliferation [56], suggesting a similar function as miR-145. [score:1]
In IL-4 stimulated microglia we observed miR-145 as the most increased miRNA (2.66-fold) along with miR-297b-5p and miR-214 (all greater than 2.0-fold increase, p<0.05, Fig. 2E). [score:1]
The association of miR-145 or miR-214 with the IL-4/STAT6 signaling pathway has never been reported in microglia. [score:1]
[1 to 20 of 14 sentences]
25
[+] score: 53
Mmu-miR-145-5p was strongly down-regulated in myopic retina (FC = -10.5, p = 8.87 × 10 [−09]) and targeted 25 mRNAs, while mmu-miR-429-3p was strongly up-regulated in myopic retina (FC = 7.8, p = 2.05 × 10 [−03]) and targeted 17 mRNAs (Table 2). [score:11]
Although the majority of the differentially expressed miRNAs originated from different miRNA clusters, mmu-miR-429-3p and mmu-miR-200a-5p belonged to the same cluster (MID < 5 kb) on chromosome 4 and were both up-regulated in myopic retina, while mmu-miR-145-5p and mmu-miR-143-3p localized within the same cluster (MID < 5 kb) on chromosome 18 and were both down-regulated in myopic retina (Table 1) [68]. [score:9]
For example, mmu-miR-145-5p, which was strongly down-regulated in myopic retina (FC = -10.5, p = 8.87 × 10 [−09]), targeted 25 mRNAs (the largest number among all 21 miRNAs) (Table 2); while mmu-miR-429-3p (FC = 7.8, p = 2.05 × 10 [−03]), mmu-miR-143-3p (FC = -2.0, p = 1.43 × 10 [−03]), mmu-miR-223-3p (FC = -2.7, p = 4.84 × 10 [−04]) and mmu-miR-146a-5p (FC = -3.2, p = 2.70 × 10 [−05]) targeted 17, 17, 16 and 14 mRNAs respectively. [score:8]
The down-regulated miR-145 was 25.4 times less abundant in the retina versus sclera suggesting that it is likely to be expressed in a very small population of retinal cells. [score:6]
MP1, MP2, MP3, MP4, MP5, MP6 and MP7 had a common core comprised of mmu-miR-1-3p, mmu-miR-145-5p, mmu-miR-18a-5p, mmu-miR-199a-5p, mmu-miR-200b-3p, mmu-miR-223-3p, mmu-miR-291a-3p, mmu-miR-34a-5p and their target mRNAs. [score:3]
Interestingly, mmu-miR-145-5p and mmu-miR-429-3p (mmu-miR-200b-3p cluster), which formed a common core of all pathways, were among the most differential miRNAs and targeted the largest number of mRNAs. [score:3]
Several miRNAs exhibited more than 10-fold change in expression in the myopic retina (Table 1), including mmu-miR-1947-5p (FC = 31.5, p = 1.47 × 10 [−04]), mmu-miR-200a-5p (FC = 18.8, p = 9.46 × 10 [−05]), mmu-miR-141-5p (FC = 13.9, p = 4.75 × 10 [−06]), mmu-miR-465b-5p (FC = 12.8, p = 5.93 × 10 [−04]), mmu-miR-214-5p (FC = 12.6, p = 8.27 × 10 [−03]), mmu-miR-1936 (FC = 12.3, p = 9.56 × 10 [−06]), mmu-miR-466f-5p (FC = 11.5, p = 3.85 × 10 [−03]), mmu-miR-669o-5p (FC = 10.9, p = 2.18 × 10 [−03]), mmu-miR-18b-5p (FC = 10.1, p = 1.79 × 10 [−03]), and mmu-miR-145-5p (FC = -10.5, p = 8.87 × 10 [−09]). [score:3]
MicroRNA miR-145 regulates stem cell, smooth muscle cell, corneal epithelium and mesenchymal stem cell differentiation [102– 107], as well as intestine and neural crest development [108, 109]. [score:3]
miR-145 directs intestinal maturation in zebrafish. [score:2]
Two of these miRNAs, i. e., mmu-miR-145-5p and mmu-miR-200b-3p, served as a common core for all pathways except for MP9. [score:1]
Abate and switch: miR-145 in stem cell differentiation. [score:1]
Interestingly, two miRNAs miR-145 and miR-200b seemed to play a role of the integrative core for all pathways. [score:1]
MicroRNA-145 regulates OCT4, SOX2, and KLF4 and represses pluripotency in human embryonic stem cells. [score:1]
MiR-145 was also shown to regulate L-DOPA decarboxylase [110], which is one of the key enzymes synthesizing dopamine in the dopaminergic amacrine cells in the retina [111]. [score:1]
[1 to 20 of 14 sentences]
26
[+] score: 51
For example, although inhibition of luciferase activity in a vector containing the full-length human ATF6 3′UTR indicated that each of the three miRNAs were capable of decreasing luciferase expression, in order to demonstrate that miR-145, miR-221 and miR-494 directly target the human ATF6 3′UTR, additional experiments using reporter constructs in which the predicted MREs for the individual miRNAs are deleted or mutated would be required. [score:8]
Here, we report decreased expression of ATF6 mRNA in F508 del CF bronchial epithelium both in vitro and in vivo and correlate this observation with increased expression of miR-145, miR-221 and miR-494, three miRNAs predicted to target the ATF6 3′UTR. [score:7]
ATF6, a protein of interest to us, was predicted to be regulated by three of the upregulated miRNAs - miR-145, miR-221 and miR-494 (Figure  1). [score:5]
Three of these miRNAs, miR-145, miR-221 and miR-494, were upregulated in F508 del-CFTR homozygous CFBE41o- versus non-CF 16HBE14o- bronchial epithelial cells and also in F508 del-CFTR homozygous or heterozygous CF (n = 8) versus non-CF (n = 9) bronchial brushings. [score:4]
miR-145, miR-221 and miR-494 target human ATF6 via repression of an ATF6 3′UTR luciferase reporter. [score:3]
Expression of miR-145, miR-221 and miR-494 is increased in airway tissues from βENaC-transgenic versus wild-type mice. [score:3]
Figure  1A depicts the full-length human ATF6 3′UTR with predicted binding locations for miR-145, miR-221 and miR-494, and Figure  1B shows the locations and base pair matches of their proposed binding sites, adapted from TargetScan 6.2. [score:3]
Previously, we reported how altered levels of miR-145 and miR-494, together with other factors, can control decreased CFTR mRNA and protein expression in vivo and in vitro [13]. [score:3]
In order to determine whether human ATF6 is regulated by miR-145, miR-221 and miR-494, HEK293 cells were transiently transfected with a luciferase reporter vector containing the full-length wild-type 408 bp human ATF6 3′UTR and a reference Renilla luciferase reporter plasmid pRLSV40. [score:2]
Here, we extend our understanding of miR-145 and miR-494 in the context of CF bronchial epithelial cells by demonstrating their reciprocal relationship with ATF6 mRNA levels and provide evidence that miR-221 also contributes to the post-transcriptional regulation of ATF6. [score:2]
Interestingly, bioinformatic analysis of the murine ATF6 3′UTR revealed two predicted miRNA recognition elements for miR-221, whereas miR-145 and miR-494 were not identified as potential regulators. [score:2]
Taken together, the data here demonstrate a role for miR-145, miR-221 and miR-494 in regulating ATF6. [score:2]
These results implicate miR-145, miR-221 and miR-494 in the regulation of ATF6 in CF bronchial epithelium, with miR-221 demonstrating structural and functional conservation between humans and mice. [score:2]
miR-145, miR-221 and miR-494 are conserved in mammals. [score:1]
We have previously reported that miR-145 and miR-494 are increased in vitro and in vivo in CF versus non-CF bronchial epithelium [13]. [score:1]
HEK293 cells (1 × 10 [5] in triplicate) were transiently co -transfected for 24 h with a WT-ATF6 3′UTR (OriGene, Rockville, MD, USA) firefly luciferase reporter vector containing the full-length 3′UTR (250 ng), a constitutive Renilla luciferase vector (100 ng) and 30 nM synthetic premiR mimics (PM) for miR-145, miR-221 and miR-494 (Applied Biosystems, Foster City, CA, USA) as indicated or with a scrambled control. [score:1]
In this study, we observed that levels of miR-145, miR-221 and miR-494 are increased in CF bronchial epithelial cells in vitro and in vivo. [score:1]
It contains two predicted binding locations for miR-221, but none for miR-145 or miR-494. [score:1]
[1 to 20 of 18 sentences]
27
[+] score: 51
This network reveals five putative direct targets: CACNA1C (Calcium channel) target of miR-149-5p; GJA5 (Gap Junction protein, alpha 5), RNF207 (Ring finger protein 207) and KCNA1 (potassium voltage-gated channel shaker-related subfamily, member 1) targets of miR-145-5p; KCNA1 which is also a miR-21-5p target; and finally, SLC18A2 (Solute carrier family 18 member 2) target of miR-142-5p. [score:12]
In the same way, KCNA1 is upregulated while miR145-5p is downregulated, however, miR-21-5p is also upregulated (Fig 7B). [score:10]
miR-145-5p also has two other targets, GJA5 and RNF207 of which both are upregulated. [score:6]
Ingenuity Pathway Analysis (IPA) software was used to identify molecular networks and targets of the miRNAs miR-146b, miR-21, miR-142-3p miR-142-5p, miR-145 and miR-149, which were differentially expressed in all three time points post infection and were significantly correlated both with changes in parasitemia and QTc interval. [score:5]
As observed, four out of those six miRNAs (miR-142-5p, miR-21-5p, miR-145-5p and miR-149-5p), directly or indirectly regulate several genes involved with QTc interval length. [score:4]
This gene was also highly predicted as target of both miRNAs miR-21-5p and miR-145-5p. [score:3]
This also happens with miR-145-5p and its targets KCNA1, GJA5 and RNF207 (Fig 7C). [score:3]
The alterations occurring in the host microRNA profile observed here reflect the role of these molecules in the acute phase of the infection and may highlight important aspects of the pathogenesis, opening a broad range of possibilities in the study of Chagas disease S1 Fig In silico analysis done using the IPA software (Ingenuity Systems, USA) showing a biological network built with four miRNAs (miR-142-5p, miR-21-5p, miR-145-5p and miR-149-5p). [score:3]
In addition, six (out of nine) microRNAs were significantly correlated with changes in both parasitemia and QTc interval: miR-146b, miR-21, miR-142-3p miR-142-5p (positive correlation) and miR-145-5p and miR-149-5p (negative correlation) (Fig 5). [score:1]
Individual mature miRNAs and their respective putative gene targets: A) miR-149-5p and CACAN1C B) miR-21-5p, miR-145-5p and KCNA1 C) miR-145-5p and KCNA1, GJA5, RNF207 and D) miR-142-5p and SLC18A2 were measured by real time RT-PCR in each time point post infection (15, 30 and 45) in four animals per group. [score:1]
In silico analysis done using the IPA software (Qiagen, USA) showing a biological network built with 4 miRNAs (miR-142-5p, miR-21-5p, miR-145-5p and miR-149-5p) from the 6 (miR-146b, miR-21-5p, miR-142-3p, miR-142-5p, miR-145-5p and miR-149) uploaded for the analysis. [score:1]
In silico analysis done using the IPA software (Ingenuity Systems, USA) showing a biological network built with four miRNAs (miR-142-5p, miR-21-5p, miR-145-5p and miR-149-5p). [score:1]
0003828.g006 Fig 6 In silico analysis done using the IPA software (Qiagen, USA) showing a biological network built with 4 miRNAs (miR-142-5p, miR-21-5p, miR-145-5p and miR-149-5p) from the 6 (miR-146b, miR-21-5p, miR-142-3p, miR-142-5p, miR-145-5p and miR-149) uploaded for the analysis. [score:1]
[1 to 20 of 13 sentences]
28
[+] score: 49
cDNA samples were diluted 1:80 in nuclease-free water and then PCR was amplified using SYBR Green Master Mix and specific LNA [TM] miRNA primers (Exiqon, Denmark) for mmu-miR-691 (target sequence AUUCCUGAAGAGAGGCAGAAAA), mmu-miR-377 (target sequence AUCACACAAAGGCAACUUUUGU), mmu-miR-1935 (target sequence AGGCAGAGGCUGGCGGAUCUCU), mmu-miR-190 (target sequence UGAUAUGUUUGAUAUAUUAGGU), mmu-miR-203 (target sequence GUGAAAUGUUUAGGACCACUAG), and mmu-miR-145 (target sequence GUCCAGUUUUCCCAGGAAUCCCU). [score:12]
ARF6, the target of down-regulated miRNA miR-145, was found to be up-regulated. [score:9]
The predicted target genes of five up-regulated miRNAs, miR-691, miR-377, miR-190, miR-203, and miR-1290-5p, and one down-regulated miRNA, miR-145, were found to be involved in other pathways, such as the Adherens junction, Wnt signaling pathway, Axon guidance, cell cycle, TGF-beta signaling pathway, and Focal adhesion. [score:9]
As shown in Table 1, the predicted target genes of six up-regulated miRNAs, miR-691, miR-377, miR-1935, miR-190, miR-203, and miR-135a*, and one down-regulated miRNA, miR-145, were found to be involved in immune-related pathways, such as the Jak-STAT signaling pathway, MAPK signaling pathway, Fc gamma R -mediated phagocytosis and cytokine-cytokine receptor interactions. [score:9]
To validate the differential expression profiles of miRNAs obtained by microarray analysis, quantitative RT-PCR was performed on six selected differentially expressed miRNAs including miR-691, miR-377, miR-1935, miR-190, miR-203, and miR-145. [score:5]
However, only one miRNAs, miR-145, was found to be down-regulated upon RABV infection. [score:4]
73 ± 1.42×,↑ VEGFANM_0010252571.37×,↓4.87 ± 1.96×,↓mmu-miR-290-5pMI00003882.44×,↑6.79 ± 2.31×,↑ CD40NM_0116111.3×,↓5.43 ± 2.76×,↓ mmu-miR-145 MI0000169 0.40×,↓ 4.82 ± 1.58×,↓ ARF6 NM_007481 1.21×,↑ 5.38 ± 2.77×,↑ Data from qRT-PCR are shown as mean ± standard deviation (SD) of one representative experiment. [score:1]
[1 to 20 of 7 sentences]
29
[+] score: 41
Other miRNAs from this paper: hsa-let-7c, hsa-let-7d, hsa-mir-16-1, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-28, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-99a, hsa-mir-101-1, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-30a, mmu-mir-99a, mmu-mir-101a, mmu-mir-125b-2, mmu-mir-126a, mmu-mir-128-1, mmu-mir-9-2, mmu-mir-142a, mmu-mir-144, mmu-mir-145a, mmu-mir-151, mmu-mir-152, mmu-mir-185, mmu-mir-186, mmu-mir-24-1, mmu-mir-203, mmu-mir-205, hsa-mir-148a, hsa-mir-34a, hsa-mir-203a, hsa-mir-205, hsa-mir-210, hsa-mir-221, mmu-mir-301a, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-142, hsa-mir-144, hsa-mir-145, hsa-mir-152, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-126, hsa-mir-185, hsa-mir-186, mmu-mir-148a, mmu-mir-200a, mmu-let-7c-1, mmu-let-7c-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-21a, mmu-mir-24-2, mmu-mir-29a, mmu-mir-31, mmu-mir-34a, mmu-mir-148b, mmu-mir-339, mmu-mir-101b, mmu-mir-28a, mmu-mir-210, mmu-mir-221, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-125b-1, mmu-mir-128-2, hsa-mir-128-2, hsa-mir-200a, hsa-mir-101-2, hsa-mir-301a, hsa-mir-151a, hsa-mir-148b, hsa-mir-339, hsa-mir-335, mmu-mir-335, hsa-mir-449a, mmu-mir-449a, hsa-mir-450a-1, mmu-mir-450a-1, hsa-mir-486-1, hsa-mir-146b, hsa-mir-450a-2, hsa-mir-503, mmu-mir-486a, mmu-mir-542, mmu-mir-450a-2, mmu-mir-503, hsa-mir-542, hsa-mir-151b, mmu-mir-301b, mmu-mir-146b, mmu-mir-708, hsa-mir-708, hsa-mir-301b, hsa-mir-1246, hsa-mir-1277, hsa-mir-1307, hsa-mir-2115, mmu-mir-486b, mmu-mir-28c, mmu-mir-101c, mmu-mir-28b, hsa-mir-203b, hsa-mir-5680, hsa-mir-5681a, mmu-mir-21b, mmu-mir-21c, hsa-mir-486-2, mmu-mir-126b, mmu-mir-142b, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
Furthermore, some of the differentially expressed miRNAs have been reported to play a role in the metastasis of other types of cancer, for example, the up-regulated miRNAs, let-7i, miR-9, miR-30a, miR-125b, miR-142-5p, miR-151-3p, miR-450a and the down-regulated miRNAs, miR-24, mir-145, miR-146b-5p, miR-185, miR-186, miR-203 and miR-335. [score:9]
Of the down-regulated miRNAs a number have been reported to be down-regulated in prostate cancer relative to benign prostate tissues, i. e. miR-16 [23]– [25], miR-24 [26]– [28], miR-29a [26], miR-145 [23], [24], [27], [29], [30], and miR-205 [24], [31], [32]. [score:7]
The down-regulation of miR-145 in the metastatic xenograft line is in agreement with many reports identifying it as down-regulated in prostate tumors [23], [24], [27], [29], [30]. [score:7]
As well, a role for miR-145 in prostate cancer metastasis is suggested by its down-regulation observed in clinical samples of metastatic prostate cancer relative to localized high grade prostate cancer [35]; furthermore, miR-145 is considered a putative tumor suppressor in colon cancer cells [55] and can reduce breast cancer cell motility [56]. [score:5]
The down-regulation of miR-16 [25], miR-34a [33], miR-126* [34], miR-145 [35] and miR-205 [36] correlated with the development of prostate cancer metastasis. [score:5]
Thus some of the miRNAs have already been linked to this phenomenon, in particular down-regulated miRNAs such as miR-16, miR-34a, miR-126*, miR-145 and miR-205, supporting the validity of our analytical approach. [score:4]
A number of these miRNAs (21/104) have previously been reported to show similar down- or up-regulation in prostate cancers relative to normal prostate tissue, and some of them (e. g., miR-16, miR-34a, miR-126*, miR-145, miR-205) have been linked to prostate cancer metastasis, supporting the validity of the analytical approach. [score:4]
[1 to 20 of 7 sentences]
30
[+] score: 39
Martinez-Sanchez A., Dudek K. A., and Murphy C. L. (2012) Regulation of human chondrocyte function through direct inhibition of cartilage master regulator SOX9 by microRNA-145 (miRNA-145). [score:6]
Both miR-145 and miR-495 target SOX9 in mesenchymal stem cells (9, 28), and miR-101 targets SOX9 in hepatocellular carcinoma (29). [score:5]
Dynoodt P., Speeckaert R., De Wever O., Chevolet I., Brochez L., Lambert J., and Van Gele M. (2013) miR-145 overexpression suppresses the migration and invasion of metastatic melanoma cells. [score:5]
Yu C. -C., Tsai L. -L., Wang M. -L., Yu C. -H., Lo W. -L., Chang Y. -C., Chiou G. -Y., Chou M. -Y., and Chiou S. -H. (2013) miR145 targets the SOX9/ADAM17 axis to inhibit tumor-initiating cells and IL-6 -mediated paracrine effects in head and neck cancer. [score:5]
For example, miR-145 has been shown to target SOX9 in various cancer subtypes (25, 26) and chondrocytes (27). [score:3]
It is worth noting that although miR-145 was reported to have robust expression in the study by McKenna et al. (4) of the entire intestinal mucosa, it was recently demonstrated that miR-145 is specific to mesenchymal cells in the intestine (34). [score:3]
Yang B., Guo H., Zhang Y., Chen L., Ying D., and Dong S. (2011) MicroRNA-145 regulates chondrogenic differentiation of mesenchymal stem cells by targeting Sox9. [score:3]
Based on these differences, we conclude that it is likely that both miR-145 and miR-101 are robustly expressed in a non-epithelial mucosal tissue, but not in IECs. [score:3]
Only four miRNA families were expressed at a minimum of 10 reads/million mapped: miR-145, miR-101, miR-320, and miR-30 (Fig. 1 a). [score:3]
miR-101 and miR-145 were very lowly expressed, indeed barely detected, in any cell type of the intestinal epithelium (Fig. 1 b). [score:3]
[1 to 20 of 10 sentences]
31
[+] score: 39
It has been suggested previously that myocardin expression is regulated by miR-145, either via direct binding to the 3'UTR of myocardin and translational activation [11] or via down-regulation of KLF5, a repressor of myocardin expression [6]. [score:12]
Some of the other miRNAs analyzed, as well as Dicer mRNA, may also be significantly expressed in fibroblasts and/or endothelial cells present in the aortic preparation where they would not be affected by the SM-specific Dicer KO, which would explain the higher expression levels compared to miR-145 in SM-Dicer KO. [score:4]
The loss of SMC contractile differentiation in SM-Dicer KO mice may thus be initially caused by a reduced miR-145 and myocardin expression. [score:3]
In accordance, we found that over -expression of miR-145 rescued the loss of contractile differentiation in isolated Dicer KO SMCs [27]. [score:3]
miR-21 and miR-221 were initially found to play a role in SMC proliferation and differentiation [7]– [10] and more recently, miR-145 was shown to be specifically expressed in SMCs and play an important role in SMC differentiation [6], [11], [13], [14]. [score:3]
In addition, we previously reported that deletion of Dicer resulted in a dramatic loss of actin stress fibers, which was rescued by over -expression of miR-145 [27]. [score:3]
We also found that the potentiating effect of miR-145 on SMC contractile differentiation was abolished in Dicer KO SMCs pretreated with an inhibitor of actin polymerization [27]. [score:3]
Although miR-145 can rescue several defects in cultured SMCs, the absence of a lethal phenotype of miR-145 KO mice suggests that other miRNAs or combinations of miRNAs are important for SMC development and function. [score:2]
Of note, at 5 and 10 weeks, the SMC enriched miRNA, miR-145, was reduced in SM-Dicer KO aorta by approximately 95% and 99% respectively, suggesting an efficient knockdown of SMC miRNAs (Figure 1B and C). [score:2]
A similar loss of actin stress fibers was also observed in miR-145 KO SMC [14]. [score:1]
Mice with inducible smooth muscle specific deletion of Dicer exhibit near complete loss of smooth muscle specific miR-145. [score:1]
In isolated Dicer KO VSMCs, loss of contractile differentiation was rescued by miR-145 mimic, possibly via increased actin polymerization. [score:1]
Firstly, systolic blood pressure of miR-145 and miR143/145 KO mice is reduced by approximately 15–20 mmHg [14], [15] while systolic blood pressure in SM-Dicer KO mice is reduced by 27.7 mmHg. [score:1]
[1 to 20 of 13 sentences]
32
[+] score: 37
miRNA gene or target mRNA Species Genome variation Molecular effect PDGFRa Human Mutation 3′UTR Altered miR-140 bindingRattanasopha et al., 2012 miR-140 Human SNP Altered miRNA-140 processingLi et al., 2010, 2011 Zebrafish Overexpression Altred Pdfra repressionEberhart et al., 2008 MSX1 Human SNP 3'UTR Altered miR-3649 bindingMa et al., 2014 FGF2/5/9 Human SNP3'UTR Altered miR-496/miR-145/miR-187 bindingLi D. et al., 2016 miR-17-92 cluster Mouse Homozygous deletion Altered Tbx113, Fgf10, Shox2 & Osr1 repressionWang et al., 2013 miR-200b Mouse Overexpression Altered Smad2, Snail& Zeb112 repressionShin et al., 2012a, b miR-133b Zebrafish Overexpression UnkownDing et al., 2016 MiRNAs are small, 19–23 nucleotide non-coding RNAs that function as post-transcriptional repressors of gene expression, either through messenger RNA (mRNA) degradation or translational repression (Bartel, 2009). [score:14]
miRNA gene or target mRNA Species Genome variation Molecular effect PDGFRa Human Mutation 3′UTR Altered miR-140 bindingRattanasopha et al., 2012 miR-140 Human SNP Altered miRNA-140 processingLi et al., 2010, 2011 Zebrafish Overexpression Altred Pdfra repressionEberhart et al., 2008 MSX1 Human SNP 3'UTR Altered miR-3649 bindingMa et al., 2014 FGF2/5/9 Human SNP3'UTR Altered miR-496/miR-145/miR-187 bindingLi D. et al., 2016 miR-17-92 cluster Mouse Homozygous deletion Altered Tbx113, Fgf10, Shox2 & Osr1 repressionWang et al., 2013 miR-200b Mouse Overexpression Altered Smad2, Snail& Zeb112 repressionShin et al., 2012a, b miR-133b Zebrafish Overexpression UnkownDing et al., 2016 Using microarray analysis, the expression profile of murine miRNAs in the developing lip and PS were analyzed from E10 to E14 (Mukhopadhyay et al., 2010; Warner et al., 2014). [score:12]
miRNA gene or target mRNA Species Genome variation Molecular effect PDGFRa Human Mutation 3′UTR Altered miR-140 bindingRattanasopha et al., 2012 miR-140 Human SNP Altered miRNA-140 processingLi et al., 2010, 2011 Zebrafish Overexpression Altred Pdfra repressionEberhart et al., 2008 MSX1 Human SNP 3'UTR Altered miR-3649 bindingMa et al., 2014 FGF2/5/9 Human SNP3'UTR Altered miR-496/miR-145/miR-187 bindingLi D. et al., 2016 miR-17-92 cluster Mouse Homozygous deletion Altered Tbx113, Fgf10, Shox2 & Osr1 repressionWang et al., 2013 miR-200b Mouse Overexpression Altered Smad2, Snail& Zeb112 repressionShin et al., 2012a, b miR-133b Zebrafish Overexpression UnkownDing et al., 2016 CS, CC, JV: Conception of the work, drafting of the manuscipt, revision of the manuscript, final approval of the manuscript. [score:10]
Similarly, altered miR-496-FGF2, miR-145-FGF5, and miR-187-FGF9 interactions were associated with clefting in 289 nsCLP and 49 nsCPO patients (Li D. et al., 2016). [score:1]
[1 to 20 of 4 sentences]
33
[+] score: 35
Other miRNAs from this paper: mmu-mir-145a, mmu-mir-490
As miR-145 is homologous miRNA in both of human and mouse, so it may also play an important role in modulating mESCs pluripotency through its ability to target and regulate the expression of Sox2 in mESCs. [score:6]
To explore the mechanisms by which PFOS disturbed the observed altered expression of Sox2, Nanog in mESCs, the expressions of miR-145 and miR-490-3p which may target Sox2, Nanog were evaluated. [score:5]
Effects of PFOS on the Potential and the Relative Expression of miR-145 and miR-490-3p in mESCsWe detected the effects of PFOS on the potential by examining the expression of self-renewal factors (Oct4, Sox2, Nanog). [score:5]
Effects of PFOS on pluripotency and expressions of miR-145, miR-490-3p in mESCs. [score:3]
miR-145 had been previously identified as targeting Sox2 in hESCs [39]. [score:3]
0074968.g002 Figure 2Effects of PFOS on pluripotency and expressions of miR-145, miR-490-3p in mESCs. [score:3]
miR-145 has been previously identified as targeting Sox2 in hESC [39]. [score:3]
Effects of PFOS on the Potential and the Relative Expression of miR-145 and miR-490-3p in mESCs. [score:3]
The expression of miRNAs (has/ mmu-miR-145, has/ mmu-miR-490-3p, U6) were analyzed using SYBR PCR Master Mix reagent kits (Takara) according to the manufacturer’s instructions. [score:3]
We found that both miR-145 and miR-490-3p were dose dependently increased after PFOS exposure. [score:1]
[1 to 20 of 10 sentences]
34
[+] score: 33
Interestingly, p53-miR-145 has recently been shown to inhibit the expression of ER-α [85], suggesting that p53/p73/p63 could function as a positive regulator of the processing of the tumor suppressor miRNA-145/16/143. [score:8]
Evidently, TA-p73/p63 appears to increase E-cadherin expression (a negative regulator of EMT), by suppressing ZEB1/2 through its target miRs, such as miR-192, miR-215, miR-145, miR-203, miR-200b, miR-200c, miR-183, miR-92a/b, miR-132, and miR-30a-e [45]. [score:8]
This data suggests that p53/TA-p73/p63, by negatively regulating c-Myc/lin-28 through its transcriptional target miR-145, it could increase the expression of let-7 [73]. [score:6]
Together, p53/TA-p73/p63, by increasing the expression of miR-145, let-7, and miR-200, it could decrease the expression of metastasis promoting factors, and stem cell factors. [score:5]
miRNA-145, a transcriptional target of p53/TA-p73/p63, has recently been shown to suppress c-Myc (a transcriptional activator of lin-28), metastasis promoting factors (Fascin, mucin1), and stem cell reprogramming factors (Oct-4, Klf-4, Sox-2) [72], [73]. [score:5]
Estrogen receptor-α (ER-α) has been shown to attenuate the Drosha -mediated cleavage of pre-miR-145/16/143 [84]. [score:1]
[1 to 20 of 6 sentences]
35
[+] score: 29
IPA software generated targets for miR-145-5p included NAP1L1, PCB2, GORASP2, P4HA1, CAPZB, CTPS1, GANAB, HDLBP and DPYSL2; miR-1 targets included ANXA2, ATP6V1B2, CNN3, ARL3, CORO1C, ARF3, HSPA1A/B and HSP90B1; and miR-133a-3p targets include ARL3, HYUO1, PPP2R4 and CORO1C. [score:7]
The IPA software analysis showed that of the 124 miRNAs that were downregulated in Srf KO samples, 11 were known miRNAs (including SMC-specific miR-143 and miR-145), 8 were predicted miRNAs and 105 were unknown miRNAs that may have been directly or indirectly induced by SRF (Figure 4d). [score:6]
Among the miRNAs predominately expressed in SMCs, miR-143 and miR-145 are the most well established, and not surprisingly, these two miRNAs account for 78% of all miRNAs expressed in the smooth muscle of our in vivo Srf KO mo del (Supplementary Table 1). [score:5]
[22] As SRF -induced miR-143 and miR-145 expression promotes GI SMC differentiation and suppression of proliferation, [10] deficiency of Dicer, which prevents generation of mature miRNAs, can lead to degeneration of SMCs in GI smooth muscle. [score:5]
This finding can be partly explained by the fact that miR-143 and miR-145 are generated from the same primary transcript, and binding of SRF to a conserved CArG box located in the distal promoter region modulates their expression. [score:3]
Our results were further validated by the finding that 12 of the 36 SRF -dependent miRNAs, including miR-143 and miR-145 that were discovered through in vitro Srf knock-down were also found to be SRF dependent in the in vivo Srf KO mo del. [score:2]
The investigation also revealed that SMC-specific miRNAs, such as miR-145-5p, miR-1 and miR-133a-3p, have multiple targets. [score:1]
[1 to 20 of 7 sentences]
36
[+] score: 28
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-18a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-21, hsa-mir-23a, hsa-mir-31, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-96, hsa-mir-98, hsa-mir-99a, hsa-mir-106a, mmu-let-7g, mmu-let-7i, mmu-mir-23b, mmu-mir-99a, mmu-mir-127, mmu-mir-128-1, mmu-mir-136, mmu-mir-142a, mmu-mir-145a, mmu-mir-10b, mmu-mir-182, mmu-mir-183, mmu-mir-187, mmu-mir-193a, mmu-mir-195a, mmu-mir-200b, mmu-mir-206, mmu-mir-143, hsa-mir-139, hsa-mir-10b, hsa-mir-182, hsa-mir-183, hsa-mir-187, hsa-mir-210, hsa-mir-216a, hsa-mir-217, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-224, hsa-mir-200b, mmu-mir-302a, mmu-let-7d, mmu-mir-106a, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-128-1, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-127, hsa-mir-136, hsa-mir-193a, hsa-mir-195, hsa-mir-206, mmu-mir-19b-2, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-18a, mmu-mir-21a, mmu-mir-23a, mmu-mir-31, mmu-mir-92a-2, mmu-mir-96, mmu-mir-98, hsa-mir-200c, mmu-mir-17, mmu-mir-139, mmu-mir-200c, mmu-mir-210, mmu-mir-216a, mmu-mir-219a-1, mmu-mir-221, mmu-mir-222, mmu-mir-224, mmu-mir-19b-1, mmu-mir-92a-1, mmu-mir-128-2, hsa-mir-128-2, mmu-mir-217, hsa-mir-200a, hsa-mir-302a, hsa-mir-219a-2, mmu-mir-219a-2, hsa-mir-363, mmu-mir-363, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-371a, hsa-mir-18b, hsa-mir-20b, hsa-mir-452, mmu-mir-452, ssc-mir-106a, ssc-mir-145, ssc-mir-216-1, ssc-mir-217-1, ssc-mir-224, ssc-mir-23a, ssc-mir-183, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-128-1, ssc-mir-136, ssc-mir-139, ssc-mir-18a, ssc-mir-21, hsa-mir-146b, hsa-mir-493, hsa-mir-495, hsa-mir-497, hsa-mir-505, mmu-mir-20b, hsa-mir-92b, mmu-mir-302b, mmu-mir-302c, mmu-mir-302d, hsa-mir-671, mmu-mir-216b, mmu-mir-671, mmu-mir-497a, mmu-mir-495, mmu-mir-146b, mmu-mir-708, mmu-mir-505, mmu-mir-18b, mmu-mir-493, mmu-mir-92b, hsa-mir-708, hsa-mir-216b, hsa-mir-935, hsa-mir-302e, hsa-mir-302f, ssc-mir-17, ssc-mir-210, ssc-mir-221, mmu-mir-1839, ssc-mir-146b, ssc-mir-206, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-128-2, ssc-mir-143, ssc-mir-10b, ssc-mir-23b, ssc-mir-193a, ssc-mir-99a, ssc-mir-98, ssc-mir-92a-2, ssc-mir-92a-1, ssc-mir-92b, ssc-mir-142, ssc-mir-497, ssc-mir-195, ssc-mir-127, ssc-mir-222, ssc-mir-708, ssc-mir-935, ssc-mir-19b-2, ssc-mir-19b-1, ssc-mir-1839, ssc-mir-505, ssc-mir-363-1, hsa-mir-219b, hsa-mir-371b, ssc-let-7a-2, ssc-mir-18b, ssc-mir-187, ssc-mir-218b, ssc-mir-219a, mmu-mir-195b, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, ssc-let-7d, ssc-let-7f-2, ssc-mir-20b-1, ssc-mir-20b-2, ssc-mir-31, ssc-mir-182, ssc-mir-216-2, ssc-mir-217-2, ssc-mir-363-2, ssc-mir-452, ssc-mir-493, ssc-mir-671, mmu-let-7k, ssc-mir-7138, mmu-mir-219b, mmu-mir-216c, mmu-mir-142b, mmu-mir-497b, mmu-mir-935, ssc-mir-9843, ssc-mir-371, ssc-mir-219b, ssc-mir-96, ssc-mir-200b
Increased miR-145 expression inhibits hESC self-renewal, represses the expression of pluripotent genes, and induces the expression of lineage-restricted differentiation. [score:9]
Compared with pEFs, expression of ssc-miR-145-5p and ssc-miR-98 were down-regulated in both two types of piPSCs (Fig 2D), whereas ssc-miR-1839-5p and ssc-miR-31 were both up-regulated in both types of piPSCs (Fig 2E). [score:8]
To validate the differential expression identified by the miRNA sequencing, ssc-miR-145-5p, ssc-miR-98, ssc-miR-31 and ssc-miR-1839-5p were selected for quantitative stem-loop RT-PCR analysis. [score:3]
Compared with pEFs, miRNAs such as ssc-miR-145-5p and ssc-miR-98 were significantly down-regulated in both types of piPSCs. [score:3]
adj ssc-miR-21 -1.1788 1.45E-02 1.68E-02 -2.4642 2.07E-04 3.85E-04 ssc-miR-143-3p -1.1940 1.40E-02 1.67E-02 -2.7004 2.27E-05 5.34E-05 ssc-miR-145-3p -1.2289 2.47E-02 2.68E-02 -2.6837 6.34E-04 1.10E-03 ssc-miR-505 -1.3657 2.68E-02 2.82E-02 -2.1577 4.16E-02 4.16E-02 ssc-miR-98 -1.5185 3.46E-03 5.15E-03 -2.8061 7.55E-05 1.55E-04 ssc-miR-139-3p -1.6685 2. 54E-02 2.71E-02 -2.5158 1.69E-02 1.93E-02 ssc-miR-23b -1.7157 3.70E-03 5.42E-03 -2.3687 8.39E-03 1.10E-02 ssc-miR-224 -1.8515 1.41E-02 1.67E-02 -2.5778 1.95E-02 2.19E-02 ssc-miR-23a -1.8753 3.40E-03 5.15E-03 -2.4676 1.00E-02 1.24E-02 ssc-miR-143-5p -1.9243 1.15E-04 2.60E-04 -3.9943 1.25E-09 5.88E-09 ssc-miR-139-5p -2.1198 2.01E-02 2.24E-02 -3. 2644 1.01E-02 1.24E-02 ssc-miR-222 -2.2666 2.58E-07 1.02E-06 -2.6019 2.34E-05 5.35E-05 ssc-miR-671-5p -2.3068 1.15E-02 1.47E-02 -2.7986 3.86E-02 3.92E-02 ssc-miR-9843-3p -2.3507 9.68E-04 1.87E-03 -4.7281 5.90E-05 1.31E-04 ssc-miR-145-5p -2.7059 2.08E-03 3.50E-03 -4.3459 7.18E-05 1.51E-04 ssc-miR-221-5p -2.7136 3.21E-07 1.21E-06 -1.9513 3.02E-02 3. 22E-02 ssc-miR-221-3p -2.9643 8.31E-11 5.47E-10 -2.1967 1.74E-03 2.90E-03 ssc-miR-708-5p -4.0615 2.31E-06 7.60E-06 -2.8238 6.43E-03 8.72E-03 ssc-miR-193a-3p -4.1933 2.39E-07 1.02E-06 -4.3848 2.87E-07 9.18E-07 ssc-miR-193a-5p -4.1933 2.39E-07 1.02E-06 -7.1423 2.32E-12 1.33E-11 ssc-miR-452 -4.3025 5.55E-11 3.99E-10 -2.2057 1.53E-02 1.77E-02 ssc-miR-206 -5.3001 6. 39E-09 3.37E-08 -6.2200 3.10E-09 1.38E-08 10.1371/journal. [score:1]
adj ssc-miR-21 -1.1788 1.45E-02 1.68E-02 -2.4642 2.07E-04 3.85E-04 ssc-miR-143-3p -1.1940 1.40E-02 1.67E-02 -2.7004 2.27E-05 5.34E-05 ssc-miR-145-3p -1.2289 2.47E-02 2.68E-02 -2.6837 6.34E-04 1.10E-03 ssc-miR-505 -1.3657 2.68E-02 2.82E-02 -2.1577 4.16E-02 4.16E-02 ssc-miR-98 -1.5185 3.46E-03 5.15E-03 -2.8061 7.55E-05 1.55E-04 ssc-miR-139-3p -1.6685 2. 54E-02 2.71E-02 -2.5158 1.69E-02 1.93E-02 ssc-miR-23b -1.7157 3.70E-03 5.42E-03 -2.3687 8.39E-03 1.10E-02 ssc-miR-224 -1.8515 1.41E-02 1.67E-02 -2.5778 1.95E-02 2.19E-02 ssc-miR-23a -1.8753 3.40E-03 5.15E-03 -2.4676 1.00E-02 1.24E-02 ssc-miR-143-5p -1.9243 1.15E-04 2.60E-04 -3.9943 1.25E-09 5.88E-09 ssc-miR-139-5p -2.1198 2.01E-02 2.24E-02 -3. 2644 1.01E-02 1.24E-02 ssc-miR-222 -2.2666 2.58E-07 1.02E-06 -2.6019 2.34E-05 5.35E-05 ssc-miR-671-5p -2.3068 1.15E-02 1.47E-02 -2.7986 3.86E-02 3.92E-02 ssc-miR-9843-3p -2.3507 9.68E-04 1.87E-03 -4.7281 5.90E-05 1.31E-04 ssc-miR-145-5p -2.7059 2.08E-03 3.50E-03 -4.3459 7.18E-05 1.51E-04 ssc-miR-221-5p -2.7136 3.21E-07 1.21E-06 -1.9513 3.02E-02 3. 22E-02 ssc-miR-221-3p -2.9643 8.31E-11 5.47E-10 -2.1967 1.74E-03 2.90E-03 ssc-miR-708-5p -4.0615 2.31E-06 7.60E-06 -2.8238 6.43E-03 8.72E-03 ssc-miR-193a-3p -4.1933 2.39E-07 1.02E-06 -4.3848 2.87E-07 9.18E-07 ssc-miR-193a-5p -4.1933 2.39E-07 1.02E-06 -7.1423 2.32E-12 1.33E-11 ssc-miR-452 -4.3025 5.55E-11 3.99E-10 -2.2057 1.53E-02 1.77E-02 ssc-miR-206 -5.3001 6. 39E-09 3.37E-08 -6.2200 3.10E-09 1.38E-08 10.1371/journal. [score:1]
The loss of miR-145 impairs differentiation and increases the levels of OCT4, SOX2 and KLF4 [37]. [score:1]
The present findings indicate that the fibroblast-enriched miRNAs, such as ssc-miR-145-5p and ssc-miR-98, may serve as barriers to reprogramming. [score:1]
MicroRNA-145 regulates OCT4, SOX2, and KLF4 and represses pluripotency in human embryonic stem cells. [score:1]
[1 to 20 of 9 sentences]
37
[+] score: 28
The results showed that 5 miRNAs (miR-130b-5p (formerly designated as miR-130b*), miR-196a, miR-455-3p, miR-455-5p, and miR-801) or 2 miRNAs (miR-133b and miR-145) were significantly up-regulated or down-regulated, respectively in laryngeal cancers (Figure 1A). [score:7]
In the previous reports, miR-145 was reported as miRNA down-regulated in multiple cancers as mentioned above [32]– [43]. [score:4]
miR-145 is related to angiogenesis and down-regulated in the lungs when exposed to cigarette smoke [57]. [score:4]
Recent report using microarray and qRT-PCR showed down-regulation of miR-145 in laryngeal cancer consistent with our result [56]. [score:4]
miR-145 was also excluded from the further studies, because it has been reported to be frequently down-regulated in cancers in multiple organs including prostate cancer [32], breast cancer [33], bladder cancer [34], colon cancer [35], [36], ovarian cancer [37], esophageal cancer [38], lung cancer [39], [40], nasopharyngeal cancer [41], gastric cancer [42], as well as B-cell malignancies [43] and considered to be not a proper biomarker for laryngeal cancer. [score:3]
MYCN, FOS, YES, FLY, cyclins D2 and L1, MAP3K3 and MAPK4K4 were reported to be potential oncogenic targets of miR-145 [33]. [score:3]
Furthermore, the proto-oncogene YES1 and the transduction protein MAP3K3 were reported to be common potential targets of miR-133b and miR-145 [36]. [score:3]
[1 to 20 of 7 sentences]
38
[+] score: 28
We observed the overexpression of miR-145 in NOA, and there were also up-regulated BPs related to muscle development in MArrest and oligospermia and down-regulated BPs related to sperm-egg recognition and sperm motility in NOA and teratospermia. [score:10]
The miR-145 regulates the development of smooth muscles [30], and its high level of expression leads to the inhibition of cell-cell adhesion and cell motility [31]. [score:7]
Furthermore, we observed that mir-145 is one of the common up-regulated genes. [score:4]
For the up-regulated genes, 21 genes among 717 genes (0.029%) were common among PostMA, MA and SCOS, and half of these genes were miRNA (LOC100130428, LOC100131541, MALAT1, MGC24103, miR-145, miR-199a-2, miR-21, miR-27b, miR-30e, miR-32, miR-99a, miR-LET7A2, miR-LET7C, miR-LET7G, PP12719, PWAR6, SNX2, TET2, ZEB2, ZNF189 and ZNF737). [score:4]
SOX9 is an essential protein for the maturation of sertoli cells and normal spermatogenesis, and it is a possible target of miR-145 43, 44. [score:3]
[1 to 20 of 5 sentences]
39
[+] score: 25
Four downregulated miRNAs (hsa-let-7a, hsa-miR-125b, hsa-miR-145, and hsa-miR-195) can be potentially useful diagnostic markers in the clinic. [score:4]
In this study, we found that hsa-let-7a, hsa-miR-125b, and hsa-miR-145 were downregulated in CRC and correlated with improved survivals of CRC patients. [score:4]
Four downregulated miRNAs (hsa-let-7a, hsa-miR-125b, hsa-miR-145, and hsa-miR-195) were demonstrated to be potentially useful diagnostic markers in the clinical setting. [score:4]
For hsa-let-7a, hsa-miR-125b, and hsa-miR-145, previous reports have shown their downregulation was correlated with the antitumor effect in CRC [31, 32]. [score:4]
In addition, we validated and obtained 4 downregulated miRNAs (i. e., hsa-let-7a, hsa-miR-125b, hsa-miR-145, and hsa-miR-195) from over 250 tumors from the TCGA-COAD database which granted us the opportunity to systematically analyze the potential molecular mechanisms associated with the pathophysiology of CRC. [score:4]
Only hsa-let-7a, hsa-miR-125b, hsa-miR-145, and hsa-miR-195 were significantly downregulated in CRC tumors (Fig.   1c), and each of these miRNAs could provide a high accuracy on CRC tissue classification as estimated by ROC curve analysis (Fig.   2a; Additional file 10: Figure S1a). [score:4]
In contrast, low levels of let-7, miR-125b, or miR-145 in TCGA CRC tissues were correlated with improved overall survivals (Additional file 10: Figure S1b). [score:1]
[1 to 20 of 7 sentences]
40
[+] score: 24
Other miRNAs from this paper: mmu-mir-145a, mmu-mir-143, mmu-mir-34a
Our data show a significant (p < 0.01) increase of miR-145 and miR-143 in cervical cancer cells after treatment with Cucurbitacin D, which clearly indicates that Cucurbitacin D may inhibit the growth of cervical cancer cells via inducing the expression of tumor suppressing miR-145 and miR-143. [score:7]
Studies have also demonstrated that expression of miR-145 and miR-143 are significantly lower in cervical cancer when compared with their normal counterparts and over -expression of these miRNAs inhibit growth of cervical cancer cells 34 35. [score:6]
Studies have reported that miR-145 and miR143 are significantly lower in cervical cancer and expression of these miRNA inhibits growth of cervical cancer cells 34 35. [score:5]
Cucurbitacin D treatment induces the expression of miR-145, miR-143 and miR-34a in cervical cancer cells. [score:3]
Our results illustrated that treatment of CaSki cells with Cucurbitacin D (1 μM) significantly (p < 0.01) induced the expressions of miR-145 (Fig. 5Bii) and miR-143 (Fig. 5Biii) compared to control cells. [score:2]
To investigate the effect of Cucurbitacin D treatment on the expression of miRNAs (miR-145, miR-143 and miR-34a) in cervical cancer cells, we performed qRT-PCR. [score:1]
[1 to 20 of 6 sentences]
41
[+] score: 24
We observed in our tumor samples a downregulation of miR-125a-5p, miR-125b, miR-126, miR-145 and let-7g genes, which have been shown to be related to hormonal settings and ErbB2 status of the tumor: miR-125a-5p and miR-125b downregulate ErbB2 and ErbB3 expression [31], miR-126 and let-7g are upregulated in ErbB2 -negative tumors, whereas miR-145 is upregulated in ErbB2 -negative tumors and upregulated in estrogen-receptor -positive and progesterone-receptor -positive tumors [13]. [score:18]
On the other hand, miR-145 [10, 20], miR-10b [10], let-7g [19], miR-125a-5p [10, 31], miR-125b [31] and miR-126 [40] have been described as downregulated. [score:4]
Previous studies have demonstrated that there is a large number of deregulated miRNAs in human breast cancer (in particular, miR-10b, miR-17-5p, miR-21, miR-27a, miR-27b, miR-125a, miR-125b, miR-126, miR-145, miR-155, miR-200c, miR-206, miR-336 and the let-7 family) [9- 31]. [score:2]
[1 to 20 of 3 sentences]
42
[+] score: 22
Because CamKIIδ is a predicted and validated target for the highly expressed miR-145 [16], we examined the expression of CamKIIδ by western blotting. [score:7]
Increased CamKIIδ expression is moreover a signature feature of the phenotype switch in vascular smooth muscle [45], and recent work has identified CamKIIδ as a direct target of miR-145 [16]. [score:6]
MiR-145, miR-22, miR-125b-5p, miR-27a and miR-1 appeared to be most highly expressed in the bladder muscle layer, and their knockdown level ranged between 68 and 99% (Table S1). [score:4]
In vascular smooth muscle the effects are due in part to miR-145, which regulates smooth muscle differentiation via multiple mechanisms including myocardin expression [19], actin polymerization [18], [32], and angiotensin signaling [17]. [score:4]
MiR-143 was not on the array but was included because it is generated together with miR-145 from a bicistronic transcript [16]. [score:1]
[1 to 20 of 5 sentences]
43
[+] score: 22
Over -expressing miR-145 in breast cancer cells suppresses the cell growth and induces apoptosis through downregulating ERα and Rhotekin expression [46, 47]. [score:10]
MiR-145, on the other hand, is a tumor suppressor gene and is down-regulated in MCF-7 cells [45]. [score:5]
Although the expression of miR-145 was not significantly changed among all groups, celecoxib tended to increase its level (Figure  5C). [score:3]
In addition, miR-145 may also block the expression of Fli-1 and Bcl-2 in colon cancer cells [48]. [score:3]
Expression of breast cancer -associated miRNAs, including miR-let-7c, miR-let-7 g, miR-98, miR-221, miR-222, miR-101, miR-145 and miR-17-5p, in the xenografts was also measured. [score:1]
[1 to 20 of 5 sentences]
44
[+] score: 22
As expected, the results confirmed that miR-145 target genes (Pou5F, Sox2 and Klf4) were down regulated by day 12 and remained at a low expression level during further cardiomyocyte maturation. [score:6]
This effect was well synchronized with the up-regulation of miR-145. [score:4]
Another example of up regulated miRNA is miR-145 which is significantly increased by day 12 and remains a high expression level until day 26. [score:4]
In the time course study of the 50 selected miRNAs, miR-145 showed the highest increase by day 12, and remained at a high expression level thereafter. [score:3]
OCT4, SOX2 and KLF4 can be directly regulated by miR-145 [32]. [score:3]
This suggests that miR-145 (and the other miRNA members of cluster A, Figure 9) is not the candidate which triggers the maturation process of the Cor. [score:1]
A high concentration of miR-145 is essential for stem cell differentiation. [score:1]
[1 to 20 of 7 sentences]
45
[+] score: 21
Other miRNAs from this paper: mmu-mir-145a, mmu-mir-34a
Subsequently, miR-34a and mir-145 down-regulates pluripotency genes, including SOX2, the latter via Wnt signaling. [score:4]
Wild type p53 results in induction of expression of miR-145 and miR-34a. [score:3]
Indeed, earlier miR profiling experiments demonstrate that miR-34a is not present in NCCIT, and miR-145 shows a low level of expression [60]. [score:3]
It has been shown that p53 activates expression of miR-34a and miR-145, which in turn repress key stem cell factors such as OCT3/4 and SOX2 to prevent self-renewal and promote differentiation [58] (Figure 4). [score:3]
0083585.g004 Figure 4 Wild type p53 results in induction of expression of miR-145 and miR-34a. [score:3]
miR-145 regulates such activities by activation of WNT signaling pathway via intracellular localization of β-catenin [59]. [score:2]
NT2 has a low level of wild type p53 as well as miR-34a and miR-145, with a high level of SOX2. [score:1]
Interestingly, NT2 and TCam2 (another GCC cell line with seminomatous characteristics) show similar corelation patterns between p53 status and expression levels of miR-34a and miR-145. [score:1]
In contrast, the TCam2 cells have a relatively normal level of wild type p53, and a high level of miR-34a and miR-145. [score:1]
[1 to 20 of 9 sentences]
46
[+] score: 21
Recent work from our laboratory has shown that downregulation of miRNA-145 is implicated in the development of cancer stem cells (CSC) in Ewing's sarcoma family tumors (ESFT), the second most common bone malignancy in children and young adults [8]. [score:5]
We have previously identified miRNA-145 as a direct EWS-FLI-1 target gene, whose repression is implicated in ESFT development, suggesting that other miRNAs may be involved in the pathogenesis of these tumors. [score:5]
Based on our recent observations that miRNA-145 repression underlies the emergence of ESFT CSC [8], we compared the miRNA expression profiles of MSCs and ESFT cell lines to identify miRNAs that may be implicated in ESFT pathogenesis and that may provide potential therapeutic targets. [score:4]
Similar to our discovery that repression of miRNA-145 is directly involved in the emergence of ESFT CSC [8], the observed repression of let-7a may enhance expression of LIN28B, triggering a double negative feed-back loop that reinforces let-7 repression in ESFT and facilitates CSC generation and maintenance. [score:4]
In the context of the recent report that ESFT CSC express high ALDH levels [41], it is tempting to speculate that let-7a and miRNA-145 repression may play a critical role in EWS-FLI-1 -mediated CSC generation. [score:3]
[1 to 20 of 5 sentences]
47
[+] score: 20
Other miRNAs from this paper: mmu-mir-145a, mmu-mir-21a, mmu-mir-21b, mmu-mir-21c
Chemo-resistance in HCT-116 and HT-29 cells was reported to be associated with increased expression of the miR21, an oncomiR [38], [43] and reduced expression of the tumor suppressor miR145 (unpublished data). [score:7]
Metformin and FuOx combination therapy decreases miRNA21 and increases miR145 expression. [score:3]
Quantitative real-time PCR showing the expression of miRNA145 (A) and miRNA21(B) normalized to RNU6B in metformin and/or FuOx treated CR HT-29 cells. [score:3]
In view of the notion that miR-21 is oncogenic, while miR-145 is tumor suppressive, we have analyzed their levels in chemo-resistant colon cancer cells. [score:3]
of the quantitative real time PCR analysis showed, while metformin either alone or together with FuOx caused a marked reduction of miR-21expression, it induced miR-145, when compared to their respective controls (Fig. 4). [score:2]
To quantitate miR-21 and miR-145, first the cDNA synthesis was carried out using Taqman MicroRNA Reverse transcription kit (Applied Biosystems, Foster City, CA). [score:1]
Suffice it to mention that the qRT-PCR values for miR-21 and miR-145 were normalized to the levels of RNU6B. [score:1]
[1 to 20 of 7 sentences]
48
[+] score: 20
To examine whether VSMC specific miR-145 contributes to the downregulation of VSMC marker genes, we further transduced Drosha KD cells using miR-145 lentiviral vector and found that the downregulation of VSMC marker genes can be partially rescued by re-introducing miR-145 expression(Figure S4). [score:9]
Our data indicate that downregulation of VSMC marker genes in Drosha KD cells can be partially rescued by introducing miR-145 expression, suggesting that loss of miR-145 in Drosha KO partially contributes to VSMC marker gene reductions. [score:6]
However, miR-143 and miR-145 were significantly downregulated in Drosha KO VSMCs compared to controls. [score:3]
The supernatant was collected 60 h following transfection and purified by ultracentrifugation for 90 mins at 25000 g. miR-145 and control lentiviral vectors were produced as described previously [9]. [score:1]
Drosha KD and control VSMCs were transduced using miR-145 and control lentiviral vector, respectively. [score:1]
[1 to 20 of 5 sentences]
49
[+] score: 20
Interestingly, miR-145 also participates in a regulatory loop involving the tumor suppressor p53 and targets ER-alpha in human breast cancer cells [32], and the processing of the primary miRNAs (pri-miRNAs) of miR-143 and miR-145 by Drosha was also shown to be regulated in a p53 -dependent manner [33]. [score:7]
MiR-143 and miR-145 are co-expressed miRNAs that function as tumor suppressors and their repression by k-Ras potentiates the oncogenic k-Ras signaling by a feed-forward loop [30, 31]. [score:5]
Spizzo R. Nicoloso M. S. Lupini L. Lu Y. Fogarty J. Rossi S. Zagatti B. Fabbri M. Veronese A. Liu X. miR-145 participates with TP53 in a death-promoting regulatory loop and targets estrogen receptor-alpha in human breast cancer cellsCell Death Differ. [score:4]
Cui S. Y. Wang R. Chen L. B. MicroRNA-145: A potent tumour suppressor that regulates multiple cellular pathwaysJ. [score:3]
Noticeably, several of the estrogen-repressed miRNAs (miR-26, miR-107, miR-126 and miR-145) were also reduced by the physiological estrogen levels of vitellogenic females [8]. [score:1]
[1 to 20 of 5 sentences]
50
[+] score: 19
Other miRNAs from this paper: mmu-mir-126a, mmu-mir-145a, hsa-mir-145, hsa-mir-126, mmu-mir-126b
At the post-transcriptional level, two microRNAs, miR-126 and miR-145, have been identified that target and suppress protein expression [120- 122]. [score:7]
Both miR-126 and miR-145 inhibit cell growth and their expression is frequently decreased in many cancer types [120, 121, 123, 124]. [score:5]
Interestingly, promotes stem cell self-renewal and its expression decreases during embryonic stem cell differentiation when miR-145 expression increases [126]. [score:5]
miR-145 has also been implicated in positively regulating embryonic stem cell differentiation [125]. [score:2]
[1 to 20 of 4 sentences]
51
[+] score: 19
Other miRNAs from this paper: mmu-mir-145a, mmu-mir-146a, hsa-mir-145, hsa-mir-146a
29 Inhibition of miR-145 or overexpression of Fli-1 resulted in an increase in the production of megakaryocytic cells relative to erythroid cells. [score:5]
28 Kumar et al have identified the FLI1 gene, encoding a transcription factor involved in megakaryopoiesis, as a critical target of miR-145 and have shown that patients with del(5q) MDS have increased expression of FLI1. [score:5]
The study by Starczynowski et al showed down-regulation of miR-145 and miR-146a in the CD34 [+] cells of patients with the 5q- syndrome. [score:4]
Loss of the miRNA genes miR-145 and miR146a seems to play a role in the development of the megakaryocytic abnormalities observed in this disorder. [score:2]
29 These data suggest that deficiency of miR-145 and miR-146a may underlie the thrombocytosis observed in some 5q- syndrome patients. [score:1]
41 A correlation of clinical response and response duration with induction of the microRNA miR-145 by lenalidomide in CD34 [+] cells from patients with MDS and the del(5q) has been recently proposed. [score:1]
15 It has been suggested that haploinsufficiency of miR-145 and miR-146a, two miRNA genes that map within and adjacent to the CDR respectively, 12 may be the cause of other key features of the 5q- syndrome, namely hypolobulated megakaryocytes and thrombocytosis. [score:1]
[1 to 20 of 7 sentences]
52
[+] score: 19
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-20a, hsa-mir-21, hsa-mir-29a, hsa-mir-33a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-107, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-29b-1, mmu-mir-124-3, mmu-mir-126a, mmu-mir-9-2, mmu-mir-132, mmu-mir-133a-1, mmu-mir-134, mmu-mir-138-2, mmu-mir-145a, mmu-mir-152, mmu-mir-10b, mmu-mir-181a-2, hsa-mir-192, mmu-mir-204, mmu-mir-206, hsa-mir-148a, mmu-mir-143, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-204, hsa-mir-211, hsa-mir-212, hsa-mir-181a-1, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, mmu-mir-106b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-138-2, hsa-mir-143, hsa-mir-145, hsa-mir-152, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-126, hsa-mir-134, hsa-mir-138-1, hsa-mir-206, mmu-mir-148a, mmu-mir-192, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-18a, mmu-mir-20a, mmu-mir-21a, mmu-mir-29a, mmu-mir-29c, mmu-mir-34a, mmu-mir-330, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-181b-2, mmu-mir-107, mmu-mir-17, mmu-mir-212, mmu-mir-181a-1, mmu-mir-33, mmu-mir-211, mmu-mir-29b-2, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-138-1, mmu-mir-181b-1, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, hsa-mir-106b, hsa-mir-29c, hsa-mir-34b, hsa-mir-34c, hsa-mir-330, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-181b-2, hsa-mir-181d, hsa-mir-505, hsa-mir-590, hsa-mir-33b, hsa-mir-454, mmu-mir-505, mmu-mir-181d, mmu-mir-590, mmu-mir-1b, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-let-7k, mmu-mir-126b, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3
Epidermal growth factor receptors (EGFR) suppress the tumor suppressors miR-143 and miR-145, which coordinately control multiple targets of downstream cell-signaling pathways (i. e., K-Ras or MYC, cdk6, E2F3, and G1/S-specific cyclin-D2 or CCND2) in the AOM rodent mo del (Zhu et al., 2011). [score:7]
EGFR signals downregulate tumor suppressors miR-143 and miR-145 in western diet–promoted murine colon cancer: role of G1 regulators. [score:7]
miR-145, miR-133a and miR-133b: tumor-suppressive miRNAs target FSCN1 in esophageal squamous cell carcinoma. [score:5]
[1 to 20 of 3 sentences]
53
[+] score: 18
Other miRNAs from this paper: mmu-mir-145a, mmu-mir-483
Given that miR-483-3p was proven to have an oncogenic role in HCC [5] and to inhibit the pro-apoptotic pathway induced by miR-145-5p and TP53, [4] we hypothesize that 2-DG could reduce miR-483-3p expression and increase the efficacy of chemotherapeutic treatments in HCC cells. [score:5]
We also demonstrated that miR-145-5p influences the expression of miR-483-3p in HepG2 cells with stimulatory or inhibitory effects, depending on the availability of glucose in the culture media. [score:5]
Effect of 2-DG on HepG2 cells in vitro and in vivoGiven that miR-483-3p was proven to have an oncogenic role in HCC [5] and to inhibit the pro-apoptotic pathway induced by miR-145-5p and TP53, [4] we hypothesize that 2-DG could reduce miR-483-3p expression and increase the efficacy of chemotherapeutic treatments in HCC cells. [score:5]
Indeed, we have previously shown that in hepatoblastoma HepG2 cells, which carry mutated CTNNB1 and wild-type TP53, constant activation of the TP53/ miR-145-5p signaling selects cells with high miR-483-3p expression that are resistant to apoptosis. [score:3]
[1 to 20 of 4 sentences]
54
[+] score: 18
Of these 15 miRNAs, we selected six miRNAs, miR-451, miR-126, miR-145, miR-146b-5p, miR-491-5p, and miR-107, which were previously reported to have a tumor suppressor role because our previous studies revealed that some tumor suppressor miRNAs in plasma were significantly down-regulated in cancer patients compared with healthy volunteers 30, 32, 33, and the down-regulation of tumor suppressor miRNAs in the blood stream might be related to tumor progression and poor prognostic outcomes [32]. [score:12]
We selected six down-regulated tumor suppressor miRNAs (miR-451, miR-126, miR-145, miR-146b-5p, miR-491-5p, and miR-107) in plasma through a comprehensive miRNA array -based approach. [score:6]
[1 to 20 of 2 sentences]
55
[+] score: 17
Other miRNAs from this paper: hsa-mir-16-1, hsa-mir-17, hsa-mir-20a, hsa-mir-21, hsa-mir-23a, hsa-mir-100, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, hsa-mir-16-2, mmu-mir-1a-1, mmu-mir-23b, mmu-mir-125b-2, mmu-mir-130a, mmu-mir-9-2, mmu-mir-145a, mmu-mir-181a-2, mmu-mir-184, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-205, mmu-mir-206, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-199a-2, hsa-mir-205, hsa-mir-181a-1, hsa-mir-214, hsa-mir-219a-1, hsa-mir-223, mmu-mir-302a, hsa-mir-1-2, hsa-mir-23b, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-184, hsa-mir-206, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-20a, mmu-mir-21a, mmu-mir-23a, mmu-mir-103-1, mmu-mir-103-2, rno-mir-338, mmu-mir-338, rno-mir-20a, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-181b-2, mmu-mir-107, mmu-mir-17, mmu-mir-100, mmu-mir-181a-1, mmu-mir-214, mmu-mir-219a-1, mmu-mir-223, mmu-mir-199a-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-181b-1, mmu-mir-125b-1, hsa-mir-302a, hsa-mir-219a-2, mmu-mir-219a-2, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-367, hsa-mir-372, hsa-mir-338, mmu-mir-181b-2, rno-mir-9a-1, rno-mir-9a-3, rno-mir-9a-2, rno-mir-16, rno-mir-17-1, rno-mir-21, rno-mir-23a, rno-mir-23b, rno-mir-100, rno-mir-103-2, rno-mir-103-1, rno-mir-107, rno-mir-125b-1, rno-mir-125b-2, rno-mir-130a, rno-mir-145, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-184, rno-mir-199a, rno-mir-205, rno-mir-206, rno-mir-181a-1, rno-mir-214, rno-mir-219a-1, rno-mir-219a-2, rno-mir-223, hsa-mir-512-1, hsa-mir-512-2, rno-mir-1, mmu-mir-367, mmu-mir-302b, mmu-mir-302c, mmu-mir-302d, rno-mir-17-2, hsa-mir-1183, mmu-mir-1b, hsa-mir-302e, hsa-mir-302f, hsa-mir-103b-1, hsa-mir-103b-2, rno-mir-9b-3, rno-mir-9b-1, rno-mir-9b-2, rno-mir-219b, hsa-mir-23c, hsa-mir-219b, mmu-mir-21b, mmu-mir-21c, mmu-mir-219b, mmu-mir-219c, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
From our top ten differentially expressed miRNAs at the early OP to mid OP stage transition, two miRNAs (miR-199a-5p and miR-145) show strong target bias towards C11Orf9. [score:5]
In addition, miR-145 also followed a similar expression pattern increasing during the first transition from OP1 to OP2, stable during OP2 to OP3 and then subsequently increasing from OP3 to OL. [score:3]
For instance, miR-145 and miR-199a-5p within our data showed similar expression patterns throughout differentiation and both contain conserved 8mer predicted seed pairings to multiple sites within the 3′-UTR of C11orf9. [score:3]
Similarly, the expression pattern of miR-145 at these stages conformed to the same trend as miR-199a-5p. [score:3]
Therefore, these data suggest that miR-199a-5p and miR-145 may be simultaneously regulating the human homolog of MRF. [score:2]
The key miRNAs discussed in this manuscript were validated by conducting real-time qRT-PCR for samples from the appropriate stages, including the following: miR-199a and miR-145 at the OP1, OP2, OP3, and OL stages; miR-214 at the OP1 and OP2 stages; miR-184 and miR-1183 at the GP and OP1 stages (Table 1 ). [score:1]
[1 to 20 of 6 sentences]
56
[+] score: 16
Inhibition of house dust mite -induced allergic airways disease by antagonism of microRNA-145 is comparable to glucocorticoid treatment. [score:5]
Our group also observed that miRNAs let-7b, miR-21 and miR-145 were upregulated in a HDM -induced mo del of AAD [17]. [score:4]
However, blockade of miR-145 did markedly reduce hallmark features of disease [17]. [score:3]
In mouse mo dels of AAD, important functions for let-7, miR-21, miR-126, miR-145 and miR-155 have been demonstrated in disease pathogenesis [12– 19]. [score:3]
One previous study has used an acute OVA -induced mo del of AAD (aerosol delivery and challenge over a 7-day timecourse), but failed to identify alterations in miRNAs previously identified in other mouse mo dels of AAD (including let-7b, miR-21 or miR-145) [36]. [score:1]
[1 to 20 of 5 sentences]
57
[+] score: 16
Other miRNAs from this paper: mmu-let-7g, mmu-let-7i, mmu-mir-23b, mmu-mir-27b, mmu-mir-126a, mmu-mir-127, mmu-mir-145a, mmu-mir-181a-2, mmu-mir-182, mmu-mir-199a-1, mmu-mir-122, mmu-mir-143, mmu-mir-298, mmu-let-7d, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-23a, mmu-mir-27a, mmu-mir-31, mmu-mir-98, mmu-mir-181a-1, mmu-mir-199a-2, mmu-mir-181b-1, mmu-mir-379, mmu-mir-181b-2, mmu-mir-449a, mmu-mir-451a, mmu-mir-466a, mmu-mir-486a, mmu-mir-671, mmu-mir-669a-1, mmu-mir-669b, mmu-mir-669a-2, mmu-mir-669a-3, mmu-mir-669c, mmu-mir-491, mmu-mir-700, mmu-mir-500, mmu-mir-18b, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-466d, mmu-mir-466l, mmu-mir-669k, mmu-mir-669g, mmu-mir-669d, mmu-mir-466i, mmu-mir-669j, mmu-mir-669f, mmu-mir-669i, mmu-mir-669h, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-466j, mmu-mir-669e, mmu-mir-669l, mmu-mir-669m-1, mmu-mir-669m-2, mmu-mir-669o, mmu-mir-669n, mmu-mir-466m, mmu-mir-669d-2, mmu-mir-466o, mmu-mir-669a-4, mmu-mir-669a-5, mmu-mir-466c-2, mmu-mir-669a-6, mmu-mir-466b-4, mmu-mir-669a-7, mmu-mir-466b-5, mmu-mir-669p-1, mmu-mir-669a-8, mmu-mir-466b-6, mmu-mir-669a-9, mmu-mir-466b-7, mmu-mir-669p-2, mmu-mir-669a-10, mmu-mir-669a-11, mmu-mir-669a-12, mmu-mir-466p, mmu-mir-466n, mmu-mir-486b, mmu-mir-466b-8, mmu-mir-466q, mmu-let-7j, mmu-mir-451b, mmu-let-7k, mmu-mir-126b, mmu-mir-466c-3
For example, miR-127 has been shown to participate in cancer development [85], miR-145 has been shown to control c-Myc expression through p53 [86], miR-199a regulates MET protooncogene and affects NF-KB expression [54], miR-379 affects brain neuronal development [87], [88], miR-451 affects erythroid differentiation [89], miR-126 affects angiogenic signaling and controls blood vessel development [90], miR-143 regulates ERK5 signaling and targets KRAS gene [91], miR-298 regulates CYPA3 expression [92] and miR-486 regulates kinase activity and tumor progression [93]. [score:16]
[1 to 20 of 1 sentences]
58
[+] score: 16
In four independent differentiation procedures we could confirm the microarray data (Fig. 5A)–that is, a strong concentration -dependent induction of muscle-specific/abundant miRNA (mir-206, mir-10a, mir-214, mir-145, mir-143, mir-199a) and a significant downregulation of the expression of neuro-specific miRNAs (mir-124, mir-128, mir-137, mir-491, mir-383) in comparison to the solvent control. [score:6]
Comparing to the solvent control, in cells treated with VPA we observed a strong upregulation of myogenic miRNAs (myo- mirs: mir-206, mir-133a,b), or miRNAs shown to be involved in muscle differentiation and specification (mir-10a, mir-143/ mir-145 cluster, mir-214, mir-322, mir-199a). [score:4]
Moreover, mir-214, mir-145 and mir-199a were significantly downregulated in these cells. [score:4]
Mir-214, mir-199a and mir-145 were also induced but not to such an extent as seen for VPA. [score:1]
Importantly, clustering of some miRNA genes within the genome is also conserved between human and mice (e. g. mir-206/mir-133b, mir-214/mir199a, mir-10a/HoxB4, mir-145/143 clusters, all of which have been studied here) (www. [score:1]
[1 to 20 of 5 sentences]
59
[+] score: 15
Our data showed that miR-145 is significantly up-regulated during postnatal aortic development (Supplementary Table S2) and that there is a significantly lower target-gene expression in the aortic samples from six-week old mice [34] (Fig. 2). [score:9]
As with miR-29 and miR-145, computational analysis of the target gene profile for miR-27 and miR-24 showed a significant shift in the aortic samples from six-week old mice (Fig. 2), suggesting that these miRNAs also contribute to the mRNA expression profile in the adult aorta. [score:5]
In fact, prominent roles of miR-145 in smooth-muscle cell fate and plasticity and smooth muscle cell maintenance and vascular homeostasis have recently been reported [59], [60]. [score:1]
[1 to 20 of 3 sentences]
60
[+] score: 15
MiR-34a is known to exacerbate p53 activation by inhibiting the p53 -inhibitor, SIRT-1 [20], while miR-145 is known to suppress the expression of the pluripotency genes, OCT4, SOX2, and KLF4 in hESCs and promote differentiation [21]. [score:9]
A recent study showed that upon the induction of differentiation of hESCs, there was an enrichment in p53 binding to p53 responsive elements in the promoters of miR-145 [19], which then suppresses the expression of the pluripotency genes, OCT4, SOX2 and KLF4 in hESCs and promotes differentiation [21]. [score:5]
MicroRNA-145 regulates OCT4, SOX2, and KLF4 and represses pluripotency in human embryonic stem cells. [score:1]
[1 to 20 of 3 sentences]
61
[+] score: 14
Other miRNAs from this paper: mmu-mir-145a, mmu-mir-143, mmu-mir-21a, mmu-mir-21b, mmu-mir-21c
We found that two newly identified vascular smooth muscle associated miRNAs, miR-143 and miR-145 [57]– [60], were down-regulated in the oviducts of Tgfbr1 c KO mice (Figure 5C). [score:4]
However, dramatic reductions in the expression of smooth muscle genes and miR-143 and miR-145 were not detected at this stage (data not shown). [score:3]
We found a global reduction of expression of smooth muscle genes, as well as two miRNAs, miR-143 and miR-145, in the Tgfbr1 c KO oviducts compared with controls. [score:2]
1002320.g005 Figure 5Dysregulation of smooth muscle genes and miR-143 and miR-145 in the oviducts of Tgfbr1 c KO mice at 3–4 weeks of age. [score:2]
Dysregulation of smooth muscle genes and miR-143 and miR-145 in the oviducts of Tgfbr1 c KO mice at 3–4 weeks of age. [score:2]
Relative mRNA levels of smooth muscle genes (A) and Myocd (B) were normalized to Gapdh, while levels of miR-143, miR-145, and miR-21 (C) were normalized against snoRNA202. [score:1]
[1 to 20 of 6 sentences]
62
[+] score: 13
The expression of three miRNAs predicted to target CFTR (miR-101, miR-144, and miR-145) was determined. [score:5]
Effect of the air pollutants cigarette smoke and cadmium on expression of miR-101, miR-144, and miR-145. [score:3]
Conversely, neither cigarette smoke extract nor cadmium increased the expression of miR-145 (Fig. 1). [score:3]
Total RNA was isolated and expression of mature miR-101, miR-144, and miR-145 was measured by quantitative RT-PCR. [score:1]
Both pollutants increased miR-101 and miR-144 but had no effect on miR-145. [score:1]
[1 to 20 of 5 sentences]
63
[+] score: 13
The 50 highest expressed miRNAs in the mice ovaries are represented in a heatmap in Fig 1 and for miRNA expression levels in Fig 2. The top five most expressed miRNAs in the ovary (all samples combined) were mmu-miR-92a-3p (miR-25 family), mmu-let-7c-5p (let-7 family), mmu-miR-143-3p (miR-143 family), mmu-miR-26a-5p (miR-26 family) and mmu-miR-145a-5p (miR-145 family). [score:7]
Interestingly, miR-145, the fifth most expressed ovarian miRNA in our study, also targets TGFBRII, and is a known regulator of primordial follicle activation [7]. [score:6]
[1 to 20 of 2 sentences]
64
[+] score: 13
Comparison of female patients with female controls resulted in significant 5.4 fold upregulation of miR-206 (p = 0.02), 2-fold upregulation of miR-133b (p = 0.03) and 1.4 fold upregulation of miR-145 (p = 0.04) (Figure S5B). [score:10]
Sufficiently high levels of expression was found only in 10 miRNAs: miR-133a, miR-206, miR-1, miR-145, miR-24, miR-19b, miR-17, miR-106b, miR-20a and miR-21. [score:3]
[1 to 20 of 2 sentences]
65
[+] score: 12
Nevertheless, the did deviate from a previously described whole heart miRNA expression profile [31] and our own left ventricle dataset in some respects, e. g. exhibiting higher miR-145 and lower miR-1 expression. [score:5]
Furthermore, in adult tissue there is evidence that miR-145 is expressed to a much greater extent in the atrium versus the ventricle [32]. [score:3]
The 20 most abundant miRNAs in HL-1 cells contributed 66% of all miRBase-mapped tags (Figure 1C and Table S4), with the cardiovascular miR-145 [28] alone contributing 13% of tags. [score:1]
[31], and the entire material for our heart biopsy, we would suggest that the predominance of miR-145 (and possibly the reduced miR-1 levels) in the HL-1 dataset is due to its atrial origin. [score:1]
Northern blots of HL-1 cell total RNA were probed for miR-301a, as well as miR-133a and miR-145 for reference (top panel). [score:1]
There were also differences between the heart biopsy and HL-1 datasets, the most notable being the higher miR-145 levels and lower miR-1 levels in HL-1 cells. [score:1]
[1 to 20 of 6 sentences]
66
[+] score: 12
For instance, miR-21 targets the mRNA for the tropomyosin (Zhu et al., 2007); both miRNA-143 and miR-145 regulate podosome formation in smooth muscle cells (Xin et al., 2009); and miR-145, miR-133a, and miR133b target the fascin homolog 1 (Kano et al., 2010). [score:6]
miR-145, miR-133a and miR-133b: tumor-suppressive miRNAs target FSCN1 in esophageal squamous cell carcinoma. [score:5]
MicroRNAs miR-143 and miR-145 modulate cytoskeletal dynamics and responsiveness of smooth muscle cells to injury. [score:1]
[1 to 20 of 3 sentences]
67
[+] score: 12
To determine if miR-30b upregulation has an impact on the cellular miRNA biosynthesis machinery, the expression of three miRNA (let-7c, miR-26a and miR-145) and Dicer, Drosha and Exportin5 were analyzed in the mammary gland of these two transgenic lines, by RT-qPCR (Figure S1). [score:6]
Relative expressions of let-7c, miR-26a and miR-145 were determined by RT-qPCR in mammary gland at 3 different physiological stages (virgin, lactation and involution) in Tg12 and Tg33 lines and in control (WT) mice. [score:3]
Figure S1Expression level of let-7c, miR-26a and miR-145 in mammary gland of transgenic mice. [score:3]
[1 to 20 of 3 sentences]
68
[+] score: 12
3) SM genes are indirectly and negatively controlled by SRF through SM miRNAs; we previously found that a large number of SM miRNAs, such as miR-143/miR-145 and miR-199a/miR-214, are SRF targets [26], and SM miRNAs target SM genes (see Table S5). [score:6]
However, half of the SMC miRNAs including miR-145(5p) and miR-143(3p) were still detected in the mutant SMCs although expression levels of most of the SMC miRNAs were significantly reduced in the SMCs (Figure 3C and Table S2). [score:3]
A set of miRNAs including miR-21, miR-133a, miR-143, and miR-145 have been identified as regulators of SMC growth and/or differentiation in cardiovascular disorders [21]– [25]. [score:2]
miR-125a-5p, miR-29c(3p), miR-145(5p), miR-143(3p), miR-337-5p, and miR-380-3p were analyzed on the gels. [score:1]
[1 to 20 of 4 sentences]
69
[+] score: 11
Altered expression of many miRNAs is seen in several tumor types: e. g. B-cell lymphomas (clustered miR-17) [2], [3], malignant lymphomas (miR-15a, miR-16-1; targeting BCL2) [4], glioblastoma tumors (miR-21up-regulation) [5], colorectal neoplasia (miR-143, miR-145 down-regulated) [6], lung cancer (miR-29) [7], and breast cancer (miR-10b) [8], with several more tumor types under analysis. [score:11]
[1 to 20 of 1 sentences]
70
[+] score: 11
Likewise, Guijun et al. reported that miR-145 suppressed mouse granulosa cells proliferation by targeting ACR1B via activin induced SMAD2 phosphorylation [26]. [score:5]
Differential analysis of mmu-mir-145 showed down-regulation with ovarian growth i. e., log [2] fold change was 1.53 during 6d-8d and −1.12 during 12d-15d thus showing its roles in cell proliferation. [score:4]
Similarly, miR-224, miR-21 and miR-145 regulate proliferation and apoptosis of granulosa cells [24– 26]. [score:2]
[1 to 20 of 3 sentences]
71
[+] score: 11
Mice with targeted deletions of the following putative tumor suppressor miRNAs did not show development of an overt malignancy: miR-145, miR-223, miR-133, and miR-206 (Park et al., 2010). [score:6]
Liposome delivery of microRNA-145 to mesenchymal stem cells leads to immunological off-target effects mediated by RIG-I. Mol. [score:3]
Examples include miR-34a (lung adenocarcinoma), miR-145 and miR-33 (colon carcinoma) and miR-15 and 16-1 (colon carcinoma). [score:1]
Identification of miR-145 and miR-146a as mediators of the 5q- syndrome phenotype. [score:1]
[1 to 20 of 4 sentences]
72
[+] score: 10
Both mir-1 and mir-145, whose expression is downregulated in prostate cancer, have been implicated as pro-differentiation factors by silencing the stem cell self-renewal and pluripotency program or inhibiting epithelial-mesenchymal transition (EMT), respectively [61], [62]. [score:8]
For example, many target genes of miRNAs let-7, mir-1, and mir-145 were hypermethylated in cells cultured under AR-inducing conditions for 3 days compared to 1 day (Table S6), suggesting a promoting role of these microRNAs in secretory differentiation of prostatic epithelial cells. [score:2]
[1 to 20 of 2 sentences]
73
[+] score: 10
Other miRNAs from this paper: mmu-mir-145a, mmu-mir-200c, mmu-mir-489
Therefore, we hypothesize that MALAT-1 may function as endogenous sponge RNA to interact with miR-200c and miR-145, and upregulate the expression of their target gene Sox2, leading to enhanced stem cell-like phenotypes. [score:8]
Interestingly, loss of miR-145 elevates Sox2 and impairs differentiation in pancreatic tumors [49]. [score:1]
php) [48], and the results showed that MALAT-1 contains complementary sites to miR-200c and miR-145 (Figure S1). [score:1]
[1 to 20 of 3 sentences]
74
[+] score: 10
Along with these studies of spinal cord injury, miR-145, together with miR-199a, has been reported to play a role in glial tumors, inhibiting migration 58 59, proliferation 60, and astrogliosis 57. [score:3]
However, some miRNAs, like miR-720, miR-22, and miR-145, were substantially more highly expressed in the 14 DIV MG. [score:3]
Moreover, there were two miRNAs (miR-21 and miR-145) and three miRNAs (miR-199a-3p/5p and miR-143), which were not or barely expressed in vivo (<500 counts), but increased dramatically in vitro (over 6,900 and over 1,500 counts respectively, Fig. 5F). [score:3]
Moreover, spinal cord injury also induces an increase in miR-145 in astrocytes 57. [score:1]
[1 to 20 of 4 sentences]
75
[+] score: 10
RT-qPCR using TaqMan probes was performed in triplicate to determine the expression of miR-145, miR-296, miR-134, and miR-21, normalized to RNU6B expression, and reported as average differences in fold change from RNU6B expression. [score:7]
The expression of miR-145 was measured, because it is reported to target the 3'UTR of Sox2 transcripts [36]. [score:3]
[1 to 20 of 2 sentences]
76
[+] score: 9
miRNAs have been shown to be important regulators of immune homeostasis and their aberrant expression was found in some autoimmune diseases, such as miR155 and miR146a in rheumatoid arthritis, and miR145 and miR224 in lupus erythematosus [12– 14]. [score:6]
Hosokawa et al. reported that expression of four miRNAs (miR126-3p, miR145-5p, miR199a-5p, and miR223-3p) were decreased in peripheral blood T cells of AA patients [15]. [score:3]
[1 to 20 of 2 sentences]
77
[+] score: 9
Previously, it was reported that p53, another well-known tumor suppressor, upregulates the transcription of tumor-suppressor miRNAs such as miR-34a/b/c/, miR-107, miR-145, miR-192, and miR-215, which regulate cell proliferation, apoptosis, and angiogenesis [29]. [score:9]
[1 to 20 of 1 sentences]
78
[+] score: 9
Knockdown of miR-145 and miR-146a using a miRNA decoy approach in mouse HSPC resulted in hematological abnormalities including elevated platelets, neutropenia, megakaryocytic dysplasia, and myeloid leukemia. [score:2]
Although miR-146a is consistently down regulated in del(5q) MDS, additional miRNAs residing on chr 5q (i. e., miR-145) may also contribute to aspects of MDS pathogenesis. [score:2]
That the miR-146a knockout mice do not show evidence of elevated platelets suggests that loss of miR-145 may contribute to thrombocytosis associated with del(5q) MDS patients (Kumar et al., 2011). [score:2]
Identification of miR-145 and miR-146a as mediators of the 5q- syndrome phenotype. [score:1]
The first evidence that miR-146a deficiency may contribute to hematopoietic defects associated with MDS was shown in mice with reduced levels of miR-146a, and a neighboring miRNA (miR-145). [score:1]
The distinction between miR-145 and miR-146a’s contribution to the hematopoietic defects has been revealed by examination of the miR-146a -deficient mice. [score:1]
[1 to 20 of 6 sentences]
79
[+] score: 9
miR-125a and miR-145 expression declines upon aging in the mouse subcutaneous adipose tissue and CR restore their levels [18]. [score:3]
The expressions of mature miR-125a-5p and miR-145b were significantly higher in the CR group similar to the microarray data (Figure 1 A & B). [score:3]
Determination of miRNA expression of miR-125a-5p and miR-145b was done by using TaqMan micro RNA assay (ThermoFisher Scientific Catalog # 4427975), and TaqMan Fast Universal PCR master mix 2x (ThermoFisher Scientific Catalog # 4352042) as per the manufacturer's instructions. [score:2]
We selected two miRNAs: mmu-miR-125a-5p, and mmu-miR-145b (miR-145b) which were found to be significantly affected by CR (Figure 1A). [score:1]
[1 to 20 of 4 sentences]
80
[+] score: 9
Hierarchichal clustering of the miRNA data revealed significant upregulation of tumor promoter miRNAs (miR-17, miR-21, miR-31, miR-98 and miR-182) and significant downregulation of tumor suppressor miRNAs (Let7a, miR-143, miR-144, miR145, miR-30a and miR-200a) in the IECs of Apc [Min/+] mice (Figure 4A). [score:9]
[1 to 20 of 1 sentences]
81
[+] score: 9
Of the p53 -upregulated miRNAs, miR-34a/b/c-5p [39], miR-145-5p [40], miR-199a-2-3p [41], miR-34b-5p, miR-34c-5p and miR-145-5p, but not miR-34a-5p and miR-199a-2-3p, showed at least two-fold reduced expression at the Thy1- to SSEA1+ transition. [score:6]
The final submodule, 2C, is found only in the FDR5 dataset and is composed of only four miRNAs (miR-199a-5p, miR-145-5p, miR-155-5p, miR-143-5p), including two differentiation -associated miRNAs (miR-145-5p, miR-155-5p), and tends to have significant decreases in expression early in reprogramming. [score:3]
[1 to 20 of 2 sentences]
82
[+] score: 8
Further analysis of expression of vascular miRNAs showed that miR-126, miR-143 and miR-145 are not upregulated in the ECs nor released into the endothelial MPs following overexpression of p75 [NTR] (Supplementary Fig. 6C,D). [score:8]
[1 to 20 of 1 sentences]
83
[+] score: 8
Here, we intended to identify suitable MREs for bladder cancer specific adenovirus -mediated TRAIL expression from the miRNAs with downregulated expression in bladder cancer, including miR-1 [18- 21], miR-99a [22], miR-100 [23], miR-101 [24, 25], miR-125b [23, 26, 27], miR-133a [18, 20, 21, 23, 28- 30], miR-143 [22, 23, 31- 33], miR-145 [21, 23, 29- 31, 34], miR-195-5p [35], miR-199a-3p [36], miR-200 [37, 38], miR-203 [39, 40], miR-205 [37], miR-218 [21, 41], miR-490-5p [42], miR-493 [43], miR-517a [44], miR-574-3p [45], miR-1826 [46] and let-7c [42]. [score:8]
[1 to 20 of 1 sentences]
84
[+] score: 8
We also found that overexpression of miR-145 and miR-103 did not inhibit SIRT1 translation in differentiated 3T3-L1 cells, although luciferase activity was significantly repressed (Supplementary Figure 1). [score:7]
Several miRNAs, such as miR-132 [15], miR-155 [16], miR-130 [17], miR-145 [18], miR-146b [19], and miR-29 [20] have been indentified in obesity -associated inflammation and insulin-resistance in adipocytes. [score:1]
[1 to 20 of 2 sentences]
85
[+] score: 8
The tumour suppressor p53 is known to enhance post-transcriptional maturation of multiple miRNAs, including microRNA-143/microRNA-145 (increased in the sperm from HFD fathers), as a response to DNA damage [63]. [score:3]
Part of the embryonic phenotype (of offspring) may well result from microRNA-145’s regulation of pluripotency, that has been demonstrated in human embryonic stem cells acting via repression of OCT4, SOX2 and KLF4 [55, 56]. [score:2]
MicroRNA-145 regulates OCT4, SOX2, and KLF4 and represses pluripotency in human embryonic stem cells. [score:1]
Overall it remains possible that p53 acts upstream as a result of DNA damage and HFD consumption that ultimately leads to increased microRNA-143/microRNA-145 in sperm in HFD fathers. [score:1]
Interestingly increased DNA damage has been previously reported to result from the mo del of male obesity used in this study [22, 44, 64] and this potentially triggers the increased abundance of p53 and thus microRNA-143/microRNA-145. [score:1]
[1 to 20 of 5 sentences]
86
[+] score: 8
For example, the expression levels of miRNA-181a, miR-155, miR-150, miRNA-221, miR-106a, miRNA-221, miR-146a and miR-146b were increased in OVA -induced mouse mo del of asthma [15– 18]; the miR-126, miR-145 and miR-106a expression levels were increased in house dust mite (HDM) -induced experimental asthma mo del [19– 21]; and miR-21 was up-regulated in lung-specific interleukin (IL)-13 -induced asthma mo del [22]. [score:8]
[1 to 20 of 1 sentences]
87
[+] score: 7
Other miRNAs from this paper: mmu-mir-145a, hsa-mir-145
Kang YJ et al. also reported that the reduced expression of IGF-1R by miR-145 in endometrium inhibited embryo attachment [48]. [score:5]
Kang Y-J MiR-145 suppresses embryo-epithelial juxtacrine communication at implantation by modulating maternal IGF1RJ. [score:2]
[1 to 20 of 2 sentences]
88
[+] score: 7
Myocardin and Kcnmb1 were the strongest up-regulated genes (Fig. 4A, C) together with a consistent up-regulation of several smooth muscle markers such as transgelin (Fig. 4B), smooth muscle actin (Acta2) (Fig. 4D), myh11 (Fig. 4E), caldesmon and miR-145 (Fig. 4A). [score:7]
[1 to 20 of 1 sentences]
89
[+] score: 7
No expression differences were observed in the expression of miR-148a, miR-145 or miR-203 when compared to control vector grafts (Fig. S9). [score:4]
In HPV-infected CC or HNSCC, miR-145, miR-146a, miR-148a, miR-200a, miR-203 and miR-21 (among others) are deregulated, some of them in association with clinical variables [10], [68]– [71]. [score:2]
Figure S9 qRT-PCR for miR-148a, miR-145 and miR-203 miRNAs in E7-transplants. [score:1]
[1 to 20 of 3 sentences]
90
[+] score: 7
We confirmed that six of the eight selected down-regulated hsa-miRNAs (miR-145, miR-497, miR-150, miR-342-5p, miR-34b* and miR-100) were significantly down-regulated in NPC tissues, whereas miR-195 and miR-143 exhibited no significant difference between the two groups of subjects (Fig. 1D). [score:7]
[1 to 20 of 1 sentences]
91
[+] score: 7
While there seems to exist a correlation between miR-145 [25] expression and Cgi-58 down-regulation, no such miRNA -based regulation of Atgl is currently known, to the best of our knowledge. [score:7]
[1 to 20 of 1 sentences]
92
[+] score: 7
Likewise, miR-143 and miR-145 inhibit cell growth, with this action, in part, attributed to through inhibition of target genes such as DNMT3A, IRS-1, YES1, STAT1, and FLI1 [21], [46]– [50]. [score:7]
[1 to 20 of 1 sentences]
93
[+] score: 7
In particular, miR-143 and miR-145 were found to be down-regulated in the colon biopsies of UC patients [41], and miR-7 was observed to be down-regulated in the mucosa of CD patients [42]. [score:7]
[1 to 20 of 1 sentences]
94
[+] score: 7
Vascular smooth muscle cell proliferation is suppressed by increased expression of miR-145 and miR-143 through inhibition of Kruppel-like factor4 and Elk 1, respectively [9]. [score:7]
[1 to 20 of 1 sentences]
95
[+] score: 7
A post-transcriptional mechanism of upregulation of KLF4 linked to the downregulation of cellular miR-145 has been reported during infection of keratinocytes with human papillomavirus [45]. [score:7]
[1 to 20 of 1 sentences]
96
[+] score: 7
Other miRNAs from this paper: mmu-mir-146a, hsa-mir-146a, hsa-mir-146b, mmu-mir-146b
The lentiviral vector for miR-146b-5p inhibition (146b_KD) is the pEZX-AM03 vector (Tebu-bio) and expresses the specific miRNA inhibitor against hsa-miR-145b-5p. [score:7]
[1 to 20 of 1 sentences]
97
[+] score: 7
Other miRNAs from this paper: mmu-mir-145a, hsa-mir-145
Three other SNPs (SNP 6, 9, and 10) were nominally significant, possibly due to their correlations with SNP 7. Interestingly, one of these SNPs, SNP 9 (rs3735440), is located within a potential microRNA (miR-145) binding site in the 3′ untranslated region of human SP4 gene, and displayed nominally significant (p = 0.019) overtransmission of the “C” allele. [score:3]
Interestingly, the overtransmitted “C” allele was localized in the putative binding site of microRNA (miR-145), which recognizes a seed sequence eight nucleotides downstream of the SNP9, in the 3′ untranslated region of the human SP4 gene (Figure 5b). [score:3]
However, both “T/C” alleles cannot base-pair with the corresponding sequence of miR-145. [score:1]
[1 to 20 of 3 sentences]
98
[+] score: 7
It was already demonstrated that p53 directly regulated the expression of tumor-suppressor miRNAs as the miR-34 family members [34], or mir-16 and mir-145, through a Drosha -mediated mechanism [35]. [score:7]
[1 to 20 of 1 sentences]
99
[+] score: 7
The dysregulation of miRNAs in CRC has been reported using miRNA expression profiling studies with different miRNAs identified either as enhancers (miR-21, miR-31, miR-103, miR-107) or suppressors (miR-135, miR-145, miR-200c) in the initiation and evolution of tumor metastasis [8- 13]. [score:6]
Arndt GM, Dossey L, Cullen LM, Lai A, Druker R, Eisbacher M, Zhang C, Tran N, Fan H, Retzlaff K, Bittner A, Raponi M: Characterization of global microRNA expression reveals oncogenic potential of miR-145 in metastatic colorectal cancer. [score:1]
[1 to 20 of 2 sentences]
100
[+] score: 6
Other miRNAs from this paper: mmu-mir-145a, mmu-mir-143, hsa-mir-143, hsa-mir-145
Expression of miR-143 and miR-145 has been shown to down-regulate levels of ERK5 [52– 53]. [score:6]
[1 to 20 of 1 sentences]