sort by

9 publications mentioning ssc-mir-182

Open access articles that are associated with the species Sus scrofa and mention the gene name mir-182. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 20
This is consistent with up-regulation of ssc-miR-29a at 14d pi, whereas up-regulation of ssc-miR-182 – another PTEN -targeting miRNA – may be a contributing factor to PTEN down-regulation at 24 h pi given that ssc-miR-29a is itself down-regulated at this time point. [score:15]
Only four miRNAs (hsa-miR-223-5p, ssc-miR-31, ssc-miR-29a, and ssc-miR-182) were differentially expressed at 24 h pi, whereas 10 miRNAs were differentially expressed at 72 h pi (ssc-miR-29b, hsa-miR-203a-3p, hsa-miR-449a, ssc-miR-21, ssc-miR-29a, hsa-miR-23a-3p, ssc-miR-23b, ssc-miR-30c-5p, ssc-miR-423-5p, and hsa-miR-150-5p). [score:5]
[1 to 20 of 2 sentences]
2
[+] score: 15
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-18a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-21, hsa-mir-23a, hsa-mir-31, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-96, hsa-mir-98, hsa-mir-99a, hsa-mir-106a, mmu-let-7g, mmu-let-7i, mmu-mir-23b, mmu-mir-99a, mmu-mir-127, mmu-mir-128-1, mmu-mir-136, mmu-mir-142a, mmu-mir-145a, mmu-mir-10b, mmu-mir-182, mmu-mir-183, mmu-mir-187, mmu-mir-193a, mmu-mir-195a, mmu-mir-200b, mmu-mir-206, mmu-mir-143, hsa-mir-139, hsa-mir-10b, hsa-mir-182, hsa-mir-183, hsa-mir-187, hsa-mir-210, hsa-mir-216a, hsa-mir-217, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-224, hsa-mir-200b, mmu-mir-302a, mmu-let-7d, mmu-mir-106a, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-128-1, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-127, hsa-mir-136, hsa-mir-193a, hsa-mir-195, hsa-mir-206, mmu-mir-19b-2, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-18a, mmu-mir-21a, mmu-mir-23a, mmu-mir-31, mmu-mir-92a-2, mmu-mir-96, mmu-mir-98, hsa-mir-200c, mmu-mir-17, mmu-mir-139, mmu-mir-200c, mmu-mir-210, mmu-mir-216a, mmu-mir-219a-1, mmu-mir-221, mmu-mir-222, mmu-mir-224, mmu-mir-19b-1, mmu-mir-92a-1, mmu-mir-128-2, hsa-mir-128-2, mmu-mir-217, hsa-mir-200a, hsa-mir-302a, hsa-mir-219a-2, mmu-mir-219a-2, hsa-mir-363, mmu-mir-363, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-371a, hsa-mir-18b, hsa-mir-20b, hsa-mir-452, mmu-mir-452, ssc-mir-106a, ssc-mir-145, ssc-mir-216-1, ssc-mir-217-1, ssc-mir-224, ssc-mir-23a, ssc-mir-183, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-128-1, ssc-mir-136, ssc-mir-139, ssc-mir-18a, ssc-mir-21, hsa-mir-146b, hsa-mir-493, hsa-mir-495, hsa-mir-497, hsa-mir-505, mmu-mir-20b, hsa-mir-92b, mmu-mir-302b, mmu-mir-302c, mmu-mir-302d, hsa-mir-671, mmu-mir-216b, mmu-mir-671, mmu-mir-497a, mmu-mir-495, mmu-mir-146b, mmu-mir-708, mmu-mir-505, mmu-mir-18b, mmu-mir-493, mmu-mir-92b, hsa-mir-708, hsa-mir-216b, hsa-mir-935, hsa-mir-302e, hsa-mir-302f, ssc-mir-17, ssc-mir-210, ssc-mir-221, mmu-mir-1839, ssc-mir-146b, ssc-mir-206, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-128-2, ssc-mir-143, ssc-mir-10b, ssc-mir-23b, ssc-mir-193a, ssc-mir-99a, ssc-mir-98, ssc-mir-92a-2, ssc-mir-92a-1, ssc-mir-92b, ssc-mir-142, ssc-mir-497, ssc-mir-195, ssc-mir-127, ssc-mir-222, ssc-mir-708, ssc-mir-935, ssc-mir-19b-2, ssc-mir-19b-1, ssc-mir-1839, ssc-mir-505, ssc-mir-363-1, hsa-mir-219b, hsa-mir-371b, ssc-let-7a-2, ssc-mir-18b, ssc-mir-187, ssc-mir-218b, ssc-mir-219a, mmu-mir-195b, mmu-mir-145b, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, ssc-let-7d, ssc-let-7f-2, ssc-mir-20b-1, ssc-mir-20b-2, ssc-mir-31, ssc-mir-216-2, ssc-mir-217-2, ssc-mir-363-2, ssc-mir-452, ssc-mir-493, ssc-mir-671, mmu-let-7k, ssc-mir-7138, mmu-mir-219b, mmu-mir-216c, mmu-mir-142b, mmu-mir-497b, mmu-mir-935, ssc-mir-9843, ssc-mir-371, ssc-mir-219b, ssc-mir-96, ssc-mir-200b
GSK3β inhibits the expression of miR-96, miR-182 and miR-183 through the β-Catenin/TCF/LEF-1 pathway [51]. [score:5]
Ssc-miR-182, ssc-miR-187, ssc-miR-136, ssc-miR-210, ssc-miR-217 and ssc-miR-10b participate in regulation Neurotrophin signaling pathway by targeting corresponding genes, including BNDF, SHC4, KRAS and FOXO3. [score:4]
We also assessed another three selected miRNAs, ssc-miR-136, ssc-miR-217 and ssc-miR-182, which were found to be more highly expressed in mpiPSCs (Fig 3C). [score:3]
Additionally, ssc-miR-216, ssc-miR-217, ssc-miR-142-5p, ssc-miR-96-5p, ssc-miR-182 and ssc-miR-183 have higher expression levels in mpiPSCs than that in hpiPSCs (Fig 3A). [score:3]
[1 to 20 of 4 sentences]
3
[+] score: 15
The genes FASN, SCD, and ESR1, which function to promote lipogenesis, may be regulated by miRNAs with downregulated expression in the DSP-TP, miR-4332, miR-182, miR-92b-3p, and miR-29c, which was coincident with the regulatory mechanism between gene expression and miRNA. [score:10]
In the regulatory networks of lipid deposition, several important lipogenic DEGs, FASN, SCD, and ESR1 were regulated by miR-4332, miR-182, miR-92b-3p, and miR-29c, respectively. [score:3]
Some DE miRNAs, such as miR-29b, miR-122, miR-145-5p, let-7c, miR-4332, miR-182, miR-92b-3p, miR-29c,let-7a, and let-7e, and some DEGs such as CAV2, MYOZ2, FRZB, FASN, SCD, ESR1, and ADORA1, may be factors in the regulation of muscle growth and lipid deposition. [score:2]
[1 to 20 of 3 sentences]
4
[+] score: 10
MiRNAs name Normalized expression level Mature sequences WF BF Goat-miR-146b-5p 186,997.77 158,761.10 ugagaacugaauuccauaggcugu Goat-miR-27b-3p 79,872.78 72,800.46 uucacaguggcuaaguucugc Goat-miR-205-5p 20,575.80 19,911.95 uccuucauuccaccggagucug Goat-miR-181a-2-5p 21,177.16 16,613.29 aacauucaacgcugucggugagu Goat-miR-181a-1-5p 21,176.79 16,613.08 aacauucaacgcugucggugagu Goat-miR-92a-3p 19,003.38 17,003.44 uauugcacuugucccggccugu Goat-miR-182-5p 14,218.79 13,630.30 uuuggcaaugguagaacucacacu Goat-miR-26a-1-5p 14,855.58 12,171.42 uucaaguaauccaggauaggcu Goat-miR-26a-2-5p 14,837.64 12,152.12 uucaaguaauccaggauaggcu Goat-let-7f-5p 10,685.28 8870.12 ugagguaguagauuguauaguu ijms-15-09531-t002_Table 2 Table 2 The five most abundantly expressed novel miRNAs in goat hair follicels. [score:5]
MiRNAs name Normalized expression level Mature sequences WF BF Goat-miR-146b-5p 186,997.77 158,761.10 ugagaacugaauuccauaggcugu Goat-miR-27b-3p 79,872.78 72,800.46 uucacaguggcuaaguucugc Goat-miR-205-5p 20,575.80 19,911.95 uccuucauuccaccggagucug Goat-miR-181a-2-5p 21,177.16 16,613.29 aacauucaacgcugucggugagu Goat-miR-181a-1-5p 21,176.79 16,613.08 aacauucaacgcugucggugagu Goat-miR-92a-3p 19,003.38 17,003.44 uauugcacuugucccggccugu Goat-miR-182-5p 14,218.79 13,630.30 uuuggcaaugguagaacucacacu Goat-miR-26a-1-5p 14,855.58 12,171.42 uucaaguaauccaggauaggcu Goat-miR-26a-2-5p 14,837.64 12,152.12 uucaaguaauccaggauaggcu Goat-let-7f-5p 10,685.28 8870.12 ugagguaguagauuguauaguu ijms-15-09531-t002_Table 2 Table 2 The five most abundantly expressed novel miRNAs in goat hair follicels. [score:5]
[1 to 20 of 2 sentences]
5
[+] score: 10
Activation of the forkhead box O3 (FoxO3) transcription factor also caused skeletal muscle atrophy, and miR-182 attenuated atrophy-related gene expression by targeting FoxO3 in skeletal muscle [17]. [score:5]
Hudson M. B. Rahnert J. A. Zheng B. Woodworth-Hobbs M. E. Franch H. A. Price S. R. miR-182 attenuates atrophy-related gene expression by targeting FoxO3 in skeletal muscle Am. [score:5]
[1 to 20 of 2 sentences]
6
[+] score: 8
Most of the DEGs in the second network were upregulated in the H group compared with the L group, while GADD45G was down-regulated in the H group and could be targeted by miR-182 (Figure 7B). [score:8]
[1 to 20 of 1 sentences]
7
[+] score: 4
In another important human disease, diabetes, the study by Melkman et al. [5] into the effects of miRNAs on insulin synthesis revealed that knocking out miR-24, miR-26, miR-182, or miR-148 reduced the transcriptional activity of the insulin gene promoter, thereby reducing the level of insulin mRNA. [score:4]
[1 to 20 of 1 sentences]
8
[+] score: 4
Of particular note, in this context, are miR-182 and miR-486, which were found to attenuate atrophy-related gene expression in skeletal muscle [38, 56]. [score:3]
Seven miRNAs (i. e., miR-7140-3p, miR-4335, miR-129b, miR-296-5p, miR-4334-5p, miR-4339, and miR-182) showed 2-fold or greater increases after LA pacing. [score:1]
[1 to 20 of 2 sentences]
9
[+] score: 3
In particular, we analyzed the expression levels of miR-204 and miR-124, as well as of miR-182. [score:3]
[1 to 20 of 1 sentences]