sort by

16 publications mentioning ssc-mir-196a-1

Open access articles that are associated with the species Sus scrofa and mention the gene name mir-196a-1. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 238
The miR-196a -mediated upregulation of adipogenic markers suggests it might function through indirect pathways because miRNA normally suppresses its targets. [score:9]
The target genes of miR-196a were predicted with TargetScan and PicTar, 74 overlapped targets were used for KEGG pathway analysis with DAVID. [score:7]
The target genes of miR-196a were predicted with TargetScan and PicTar, 74 overlapped targets were used for GO term enrichment analysis. [score:7]
In a deep sequencing of the miRNAs involved in the development of swine adipose tissue, miR-196a expression was first found to be significantly upregulated in adult pig adipose tissue compared with the piglets (Table 1), which indicated that miR-196a may play an important role in adipocyte development. [score:7]
In the piglets, miR-196a was highly expressed in the kidney and muscle, moderately expressed in the adipose and spleen, and lowly expressed in the heart, lung and liver. [score:7]
Based on the robust increase of miR-196a expression in adipose tissue of adult pigs and the predicted roles of miR-196a on cell development, we proposed that miR-196a may play a role in the regulation of adipocyte development. [score:6]
Consistently, ASO (antisense oligonucleotide) against miR-196a suppressed the expression of PPARγ in mouse SVF (stromal vascular fraction) cells followed by adipogenic induction [50]. [score:5]
Moreover, miR-196a was demonstrated to be involved in regulation of porcine adipose development, and overexpression of miR-196a was shown to promote porcine adipocyte differentiation without affecting proliferation. [score:5]
The TargetScan algorithm [24] and PicTar [25] was used to predict miR-196a targets. [score:5]
To verify the expression of miR-196a, which was identified in the sequencing results, miR-196a expression levels were detected with qPCR in several porcine tissues including adipose, liver, muscle, heart, spleen, lung and kidney. [score:5]
These results suggest that miR-196a appears to be tissue-specific and to display differential expression patterns in piglets and adult pigs, which suggest miR-196a may have important biological functions in the regulation of pig development. [score:5]
To further explore the potential biological roles of miR-196a, the TargetScan and PicTar algorithms were used to predict miR-196a targets. [score:5]
Interestingly, contrary to the low expression in piglets, miR-196a was found to be highly expressed in adipose tissue and liver from adult pigs. [score:5]
To explore the expression profiles and roles of miR-196a in swine, expression pattern examination, bioinformatics function prediction and gain-of-function analysis of miR-196a were carried out with swine tissues and primary preadipocytes. [score:5]
These three pathways and the predicted targets of miR-196a enriched pathways could be the potential targets of miR-196a function. [score:5]
Furthermore, overexpression of miR-196a has been reported to inhibit proliferation and stimulate osteogenic differentiation of human adipose tissue-derived mesenchymal stem cells [22]. [score:5]
Our data demonstrated that miR-196a was wi dely and differentially expressed in pig tissues for the first time, and adenovirus mediated overexpression of miR-196a in porcine adipocytes showed miR-196a enhanced porcine adipocyte differentiation, both in terms of morphology and genetic levels; while no proliferation changes were found in this process. [score:5]
Mature miR-196a was first found to play important roles in mammalian limp development and embryogenesis by targeting the homeobox gene clusters [15, 16]. [score:4]
Our results indicated that miR-196a exhibits developmental and tissue specific expression patterns, and appears to participate in multiple biological processes in swine. [score:4]
The differential expression levels of miR-196a in tissues from piglets and adult pigs show miR-196a may play a role in porcine tissue development. [score:4]
Further bioinformatics function analysis revealed that potential targets of miR-196a were significantly enriched in skeletal system development, organ morphogenesis, the cellular macromolecule metabolic process and the macromolecule metabolic process. [score:4]
The potential function in skeletal system development was coordinated with the high expression of miR-196a in skeletal muscle tissue of piglets. [score:4]
More importantly, miR-196a expression was significantly elevated in cells infected with Ad-miR-196a compared with control cells (Figure 3B), representing an effective overexpression of miR-196a with Ad-miR-196a in porcine primary preadipocytes. [score:4]
Figure 3Overexpression of miR-196a in porcine primary adipocytes with Ad-miR-196a. [score:3]
To test this hypothesis, the proliferation and differentiation of porcine primary adipocytes were detected after overexpressing miR-196a. [score:3]
Figure 5Overexpression of miR-196a promotes porcine adipogenesis. [score:3]
However, little is known about the expression and functions of miR-196a in swine. [score:3]
In this report, for the first time, we demonstrated that miR-196a was wi dely and differentially expressed in swine tissues including heart, liver, lung, kidney, spleen, skeletal muscle and adipose tissue (Figure 1). [score:3]
Afterwards, the infected cells were observed under fluorescence microscope, and the expression of miR-196a was examined with qPCR. [score:3]
Total RNA was isolated from seven different tissues including heart, liver, spleen, lung, kidney, skeletal muscle and subcutaneous adipose tissue, and the expression of miR-196a was analyzed by qPCR and normalized to U6. [score:3]
Tripurani S. K. Lee K. B. Wee G. Smith G. W. Yao J. Microrna-196a regulates bovine newborn ovary homeobox gene (nobox) expression during early embryogenesis BMC Dev. [score:3]
As shown in Figure 1, miR-196a was wi dely expressed in various tissues from 3-day-old piglets and 180-day-old adult pigs. [score:3]
As shown in Figure 4, after five days’ infection with Ad-miR-196a in porcine preadipocytes, no significant proliferation changes were observed suggesting overexpression of miR-196a had no effect on porcine preadipocyte proliferation. [score:3]
However, our results are in disagreement with previous findings [22], which demonstrated that overexpression of miR-196a decreased hASC (human adipose tissue-derived mesenchymal stem cells) proliferation and enhanced osteogenic differentiation, without affecting adipogenic differentiation. [score:3]
Figure 2GO terms analysis of miR-196a biological function based on the predicted targets. [score:3]
In piglets, miR-196a was predominantly expressed in kidney and skeletal muscle tissues. [score:3]
Recently, miR-196a was shown to be differently regulated during tumorigenesis and to be involved in regulating key pathways such as AKT signaling [20], BMP [17] and WNT signaling [21]. [score:3]
In addition, the overlapped targets of miR-196a were enriched in several pathways including glioma, focal adhesion, ECM–receptor interaction, gap junction, prostate cancer, GnRH signaling pathway, melanogenesis, and insulin signaling pathway (Table 3). [score:3]
Figure 1 Expression of miR-196a in swine tissues from 3-day-old piglets and 180-day-old adult pigs. [score:3]
Our data demonstrated that miR-196a overexpression enhanced adipocyte differentiation (Figure 5), without influencing cell proliferation (Figure 4). [score:3]
Among the identified miRNAs, a robust increase in miR-196a expression was observed in adipose tissues from adult pigs compared with piglets, which suggests miR-196a may play important roles in adipose tissue development. [score:3]
In contrast, miR-196a was mainly expressed in adipose tissue and liver of adult pigs. [score:3]
Expression of miR-196a in Normal Porcine Tissues. [score:3]
To study the potential roles of miR-196a in swine, recombinant adenovirus vector expressing miR-196a (Ad-miR-196a) was prepared. [score:3]
In accordance with the previous report that miR-196a was upregulated in mouse SVF cells during adipogenic differentiation [50], increased levels of miR-196a were observed in adipose tissue from adult pigs compared with piglets (Table 1). [score:3]
Biological Functions of miR-196a Based on Targets Analysis. [score:3]
However, the expression levels of miR-196a varied markedly among different tissue samples. [score:3]
genes-07-00005-t001_Table 1 Table 1 Expression of miR-196a in developing adipose tissues of swine. [score:3]
However, the mRNA levels of adipocytes’ specific genes including PPARγ, C/EBPα and FABP4 were remarkably increased in miR-196a overexpressing cells (Figure 5A). [score:3]
genes-07-00005-t003_Table 3 Table 3 The KEGG pathways that are enriched with predicted targets of miR-196a by DAVID. [score:3]
The previous studies found miR-196a is involved in regulation of BMP [17], WNT [21] and AKT [20] pathways. [score:2]
To investigate whether miR-196a plays a role in regulation of adipocyte development, porcine preadipocytes overexpressing miR-196a were used for cell proliferation and differentiation assay. [score:2]
Roles of miR-196a in Porcine Adipocyte Development. [score:2]
Increased accumulation of lipid droplets and triglyceride levels were observed in Ad-miR-196a infected cells compared with control groups (Figure 5C,D), indicating overexpression of miR-196a stimulates porcine preadipocyte differentiation. [score:2]
In addition, miR-196 was found to be involved in regulation of axolotls tail regeneration [17], immunology, inflammation and virus defense [18, 19]. [score:2]
Especially, the highest levels of miR-196a were found in adult pig adipose tissue and liver, the main locations of fat metabolism, leading us to hypothesize that miR-196a has functions in adipose development. [score:2]
Kim Y. J. Bae S. W. Yu S. S. Bae Y. C. Jung J. S. Mir-196a regulates proliferation and osteogenic differentiation in mesenchymal stem cells derived from human adipose tissue J. Bone Miner. [score:1]
Most miRNAs are well conserved in evolution, including mir-196 family, which are conserved and localized within the Hox gene clusters among vertebrates [33, 34]. [score:1]
miRNAs Gene Location Mature Sequences ssc-mir-196a-1 Chromosome 12 (24,834,774-24,838,853) UAGGUAGUUUCAUGUUGUUGGG ssc-mir-196a-2 Chromosome 5 (19,652,956-19,657,062) UAGGUAGUUUCAUGUUGUUGGG ssc-mir-196b-1 Chromosome 18 (49,834,543-49,838,622) UAGGUAGUUUCCUGUUGUUGGG CGACAGCACGACACUGCCUUCA ssc-mir-196b-2 Chromosome 18 (50,035,507-50,039,584) UAGGUAGUUUCCUGUUGUUGGG CGACAGCACGACACUGCCUUCA The mature sequences of the ssc-mir-196a-1, ssc--mir-196a-2, ssc-mir-196b-1 and ssc-mir-196b-2 were acquired from the miRBase sequence database. [score:1]
These data indicate that miR-196a exhibits various biological functions. [score:1]
Further research is needed to better understand the mechanisms of miR-196a mediated adipogenesis in swine. [score:1]
In Sus Scrofa, four mir-196 precursor sequences have been identified including mir-196a-1, mir-196a-2, mir-196b-1 and ir-196b-2 [15, 16, 35]. [score:1]
Although some of miR-196a’s potential functions have been confirmed in previous reports, particularly in respect to cell proliferation and differentiation, tumorigenesis, tail regeneration, immunology and virus defense [15, 16, 17, 18, 19, 20, 21, 22], none of these potential biological roles have been well studied in pigs. [score:1]
Sehm T. Sachse C. Frenzel C. Echeverri K. Mir-196 is an essential early-stage regulator of tail regeneration, upstream of key spinal cord patterning events Dev. [score:1]
Porcine primary preadipocytes were then infected with Ad-miR-196a or Ad-Null for two days. [score:1]
Chen C. Zhang Y. Zhang L. Weakley S. M. Yao Q. Microrna-196: Critical roles and clinical applications in development and cancer J. Cell. [score:1]
Among the precursors, mir-196a-1 and mir-196a-2 share the same functional mature sequence miR-196a, whereas mir-196b-1 and mir-196b-2 have two mature sequences: miR-196b-3p and miR-196b-5p (Table 2) [36, 37] In addition, the same mature sequences of miR-196a from the miRBase database were observed within Homo sapiens, Mus musculus and Sus scrofa, suggesting miR-196a was highly conserved across species and may play similar roles within the species mentioned above. [score:1]
The present study provides new insights into the biological roles of miR-196a, and detailed functional analyses need to be conducted to understand the molecular aspects of miR-196a in porcine adipogenesis in the future. [score:1]
However, the mechanisms by which miR-196a affect adipogenesis in swine are still not clear. [score:1]
Generation and Identification of Recombinant Adenovirus Ad-miR-196a. [score:1]
Our results were consistent with previous studies in which miR-196a was enriched in the kidney and reproductive tissues of bovine and mouse [16, 49]. [score:1]
Consistent with this, an obvious increase of protein levels of PPARγ and FABP4 were also detected in Ad-miR-196a infected cells by Western blotting, while the protein levels of C/EBPα and LPL genes showed no obvious change (Figure 5B). [score:1]
These data demonstrated that miR-196a promotes porcine preadipocyte differentiation without affecting proliferation. [score:1]
Schimanski C. C. Frerichs K. Rahman F. Berger M. Lang H. Galle P. R. Moehler M. Gockel I. High mir-196a levels promote the oncogenic phenotype of colorectal cancer cells World J. Gastroenterol. [score:1]
genes-07-00005-t002_Table 2 Table 2 miR-196a genes and mature sequences. [score:1]
The recombinant adenovirus vector encoding miR-196a (Ad-miR-196a) was constructed as previously described [31]. [score:1]
* = p < 0.05; ** = p < 0.01; *** = p < 0.001; (B) Protein levels of PPARγ, C/EBPα, FABP4 and LPL genes examined with Western blotting; (C) The morphological changes and lipid accumulation of porcine differentiated adipocytes observed by Oil Red O staining (a–c, ×200): a, Blank control; b, Ad-Null control; c, Ad-miR-196a group; (D) Cellular lipid content detected by Oil Red O extraction method. [score:1]
Whereas, in adult pigs, the highest miR-196a levels were found in the adipose tissue and liver, moderate levels were detected in the heart, spleen and muscle, and low levels were observed in the kidney and lung. [score:1]
Mori M. Nakagami H. Rodriguez-Araujo G. Nimura K. Kaneda Y. Essential role for mir-196a in brown adipogenesis of white fat progenitor cells PLoS Biol. [score:1]
[1 to 20 of 79 sentences]
2
[+] score: 30
As examples, the liver-specific miR-122 promotes the replication of hepatitis C virus (HCV) [17], [18], while miR-196, miR-199, miR-296, miR-351, miR-431 and miR-448 inhibit HCV genome propagation [19], [20]; miR-32 effectively restricts the accumulation of primate foamy virus type 1 (PFV-1) in human cells [21]; miR-323, miR-491 and miR-654 inhibit the replication of the H1N1 influenza A virus by binding to the viral PB1 gene [22]; miR-28, miR-125b, miR-150, miR-223 and miR-382 target the 3′ end of human immunodeficiency virus (HIV) mRNA, thereby restricting HIV production [23]; miR-199a-3p and miR-210 limit the hepatitis B virus (HBV) surface antigen and polymerase production by degrading and/or inhibiting translation of viral mRNAs encoding these proteins [24]; overexpression of miR-24 and miR-93 suppresses vesicular stomatitis virus (VSV) replication through targeting the viral genes encoding RNA -dependent RNA polymerase (L protein) and phosphoprotein (P protein), respectively [25]; in macrophages, upregulation of miR-155 suppresses VSV replication, while inhibition of miR-155 had the opposite effect. [score:24]
To screen the potential miRNAs which can reduce PRRSV replication, the mimics or inhibitors of 10 miRNAs (Table S1), including miR-24, miR-93, miR-122, miR-125b, miR-146a, miR-155, miR-181, miR-196, miR-351, and miR-365, were chosen and synthetized. [score:3]
The mimics and inhibitors of miR-24, miR-93, miR-122, miR-125b, miR-146a, miR-155, miR-181, miR-196, miR-351, and miR-365 (shown in Table S1) were obtained from GenePharma (Shanghai, China). [score:3]
[1 to 20 of 3 sentences]
3
[+] score: 11
0003225.g002 Figure 2 Expression levels of five miRNAs (miR-150, miR-193b, miR-196a, miR-187b and miR-495) were detected by Real time PCR (right) and microarray (left). [score:3]
The expression levels for miR-150, miR-193b, miR-187b and miR-196a, as determined by RT-PCR, were in concordance with the normalized microarray data (Pearson correlation coefficient >0.9, q value<0.001, Figure 2). [score:3]
Expression levels of five miRNAs (miR-150, miR-193b, miR-196a, miR-187b and miR-495) were detected by Real time PCR (right) and microarray (left). [score:3]
Five representative differentially expressed miRNAs (miR-150, miR-193b, miR-196a, miR-187b and miR-495) were chosen for validation by the stem–loop RT–PCR based real-time PCR method [6] using three independent samples (The primer sequences are available in Table S6). [score:2]
[1 to 20 of 4 sentences]
4
[+] score: 10
In inter-breed comparison, 2 DE miRNAs (miR-1249 and miR-196a) in LW pigs were up-regulated compared with LC pigs after sexual maturity, whereas only miR-31 was down-regulated. [score:6]
miR-196a also had a higher expression in LW pigs than in LC pigs at 200 days, which is associated with the zinc finger proteins and homeodomain proteins that are closely related to fetal testicular development and the subsequent adult fertility 55. [score:4]
[1 to 20 of 2 sentences]
5
[+] score: 7
Finally, we found higher expression of ssc-miR-196a in HG-IEN; human miR-196a contributes to cell growth promotion, migration and invasion of colorectal cancer cells [25– 27]. [score:3]
Ten differentially expressed miRNAs were validated by qRT-PCR: ssc-let-7e, ssc-miR-98, ssc-miR-126-3p, ssc-miR-146a-5p, ssc-miR-146b, ssc-miR-155-5p, ssc-miR-181b, ssc-miR-183, ssc-miR-191 and ssc-miR-196a. [score:3]
In summary, we have detected several miRNAs (ssc-let-7e, ssc-miR-98, ssc-miR-126-3p, ssc-miR-146a-5p, ssc-miR-146b, ssc-miR-183 and ssc-miR-196a) associated with early-stage colorectal neoplasia in APC [1311] pigs. [score:1]
[1 to 20 of 3 sentences]
6
[+] score: 6
Other miRNAs from this paper: mmu-mir-1a-1, mmu-mir-127, mmu-mir-134, mmu-mir-136, mmu-mir-154, mmu-mir-181a-2, mmu-mir-143, mmu-mir-196a-1, mmu-mir-196a-2, mmu-mir-21a, rno-mir-329, mmu-mir-329, mmu-mir-1a-2, mmu-mir-181a-1, mmu-mir-181b-1, mmu-mir-181c, mmu-mir-375, mmu-mir-379, mmu-mir-181b-2, rno-mir-21, rno-mir-127, rno-mir-134, rno-mir-136, rno-mir-143, rno-mir-154, rno-mir-181c, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-196a, rno-mir-181a-1, mmu-mir-196b, rno-mir-196b-1, mmu-mir-412, mmu-mir-370, oar-mir-431, oar-mir-127, oar-mir-432, oar-mir-136, mmu-mir-431, mmu-mir-433, rno-mir-431, rno-mir-433, ssc-mir-181b-2, ssc-mir-181c, ssc-mir-136, ssc-mir-196a-2, ssc-mir-21, rno-mir-370, rno-mir-412, rno-mir-1, mmu-mir-485, mmu-mir-541, rno-mir-541, rno-mir-493, rno-mir-379, rno-mir-485, mmu-mir-668, bta-mir-21, bta-mir-181a-2, bta-mir-127, bta-mir-181b-2, bta-mir-181c, mmu-mir-181d, mmu-mir-493, rno-mir-181d, rno-mir-196c, rno-mir-375, mmu-mir-1b, bta-mir-1-2, bta-mir-1-1, bta-mir-134, bta-mir-136, bta-mir-143, bta-mir-154a, bta-mir-181d, bta-mir-196a-2, bta-mir-196a-1, bta-mir-196b, bta-mir-329a, bta-mir-329b, bta-mir-370, bta-mir-375, bta-mir-379, bta-mir-412, bta-mir-431, bta-mir-432, bta-mir-433, bta-mir-485, bta-mir-493, bta-mir-541, bta-mir-181a-1, bta-mir-181b-1, ssc-mir-1, ssc-mir-181a-1, mmu-mir-432, rno-mir-668, ssc-mir-143, ssc-mir-181a-2, ssc-mir-181b-1, ssc-mir-181d, ssc-mir-196b-1, ssc-mir-127, ssc-mir-432, oar-mir-21, oar-mir-181a-1, oar-mir-493, oar-mir-433, oar-mir-370, oar-mir-379, oar-mir-329b, oar-mir-329a, oar-mir-134, oar-mir-668, oar-mir-485, oar-mir-154a, oar-mir-154b, oar-mir-541, oar-mir-412, mmu-mir-21b, mmu-mir-21c, ssc-mir-196b-2, ssc-mir-370, ssc-mir-493, bta-mir-154c, bta-mir-154b, oar-mir-143, oar-mir-181a-2, chi-mir-1, chi-mir-127, chi-mir-134, chi-mir-136, chi-mir-143, chi-mir-154a, chi-mir-154b, chi-mir-181b, chi-mir-181c, chi-mir-181d, chi-mir-196a, chi-mir-196b, chi-mir-21, chi-mir-329a, chi-mir-329b, chi-mir-379, chi-mir-412, chi-mir-432, chi-mir-433, chi-mir-485, chi-mir-493, rno-mir-196b-2, bta-mir-668, ssc-mir-375
For example, miR-273 and the lys-6 miRNA have been shown to be involved in the development of the nervous system in nematode worm [3]; miR-430 was reported to regulate the brain development of zebrafish [4]; miR-181 controlled the differentiation of mammalian blood cell to B cells [5]; miR-375 regulated mammalian islet cell growth and insulin secretion [6]; miR-143 played a role in adipocyte differentiation [7]; miR-196 was found to be involved in the formation of mammalian limbs [8]; and miR-1 was implicated in cardiac development [9]. [score:6]
[1 to 20 of 1 sentences]
7
[+] score: 6
Other miRNAs from this paper: ssc-mir-196a-2
Pin AL Houle F Fournier P Guillonneau M Paquet ER Simard MJ Annexin-1 -mediated endothelial cell migration and angiogenesis are regulated by vascular endothelial growth factor (VEGF) -induced inhibition of miR-196a expressionJ Biol Chem. [score:6]
[1 to 20 of 1 sentences]
8
[+] score: 5
MiR-196a displays a tissue-specific expression pattern in porcine and plays a role in porcine adipose development via inducing the expression of adipocyte specific markers, lipid accumulation and triglyceride content [64]. [score:5]
[1 to 20 of 1 sentences]
9
[+] score: 4
Other miRNAs from this paper: ssc-mir-196a-2, ssc-mir-130a
Although previous studies have discovered some key regulators in IMF development, such as fibroblast growth factor 21 (Wang et al., 2015), miRNA-196a/b (Liu L. et al., 2017), miR-130a (Wei et al., 2017), PU. [score:3]
Discovery of porcine miRNA-196a/b may influence porcine adipogenesis in longissimus dorsi muscle by miRNA sequencing. [score:1]
[1 to 20 of 2 sentences]
10
[+] score: 3
The expressions of five genes (IRS1, CARNS1, MYOZ2, ANKRD2, and PLIN2) and four miRNAs (miR-4332, miR-451, miR-196a, and miR-29b) were significantly different between the DSP and the YY (S5 and S6 Figs). [score:3]
[1 to 20 of 1 sentences]
11
[+] score: 2
A typical example is miR-196, which can direct the cleavage of HOXB8 mRNA in mouse embryos [8]. [score:2]
[1 to 20 of 1 sentences]
12
[+] score: 1
On the other hand, one of the known human mir-196 paralogs is located in the 5'UTR of a HoxA9 transcript [54]. [score:1]
[1 to 20 of 1 sentences]
13
[+] score: 1
Other miRNAs from this paper: ssc-mir-122, ssc-mir-135-1, ssc-mir-135-2, ssc-mir-148a, ssc-mir-19a, ssc-mir-20a, ssc-mir-224, ssc-mir-24-1, ssc-mir-323, ssc-mir-140, ssc-mir-183, ssc-mir-214, ssc-mir-27a, ssc-mir-325, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-103-1, ssc-mir-107, ssc-mir-136, ssc-mir-153, ssc-mir-18a, ssc-mir-186, ssc-mir-196a-2, ssc-mir-204, ssc-mir-21, bta-mir-18b, bta-let-7f-2, bta-mir-101-2, bta-mir-103-1, bta-mir-148a, bta-mir-18a, bta-mir-20a, bta-mir-21, bta-mir-221, bta-mir-27a, bta-mir-27b, bta-mir-107, bta-mir-140, bta-mir-20b, bta-mir-215, bta-let-7d, bta-mir-17, bta-mir-186, bta-mir-199b, bta-mir-210, bta-mir-214, bta-mir-450a-2, bta-let-7g, bta-mir-24-2, bta-let-7a-1, bta-let-7f-1, bta-mir-122, bta-let-7i, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-15a, bta-mir-19a, bta-mir-204, ssc-mir-15a, ssc-mir-17, ssc-mir-199b, ssc-mir-210, ssc-mir-221, bta-mir-101-1, bta-mir-133a-2, bta-mir-133a-1, bta-mir-135a-2, bta-mir-135a-1, bta-mir-135b, bta-mir-136, bta-mir-146b, bta-mir-153-1, bta-mir-153-2, bta-mir-183, bta-mir-24-1, bta-mir-196a-2, bta-mir-196a-1, bta-mir-196b, bta-mir-224, bta-mir-323, ssc-mir-101-1, ssc-mir-101-2, ssc-mir-133a-1, ssc-mir-450a, ssc-mir-146b, ssc-mir-215, bta-mir-1343, bta-mir-2320, bta-mir-2326, bta-mir-2366, bta-mir-2411, bta-mir-2483, bta-mir-450a-1, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-103-2, ssc-mir-27b, ssc-mir-24-2, ssc-mir-196b-1, ssc-mir-450b, ssc-mir-450c, ssc-mir-133a-2, ssc-let-7a-2, ssc-mir-18b, ssc-mir-1343, ssc-mir-2320, bta-mir-450b, ssc-let-7d, ssc-let-7f-2, ssc-mir-20b-1, ssc-mir-20b-2, ssc-mir-196b-2, ssc-mir-2366-1, ssc-mir-2366-2, ssc-mir-2411, ssc-mir-2483
Moreover, published report showed that miR-196, miR-214, miR-199b, miR-186, miR-101 and miR-27a were related to bovine backfat thickness [36]. [score:1]
[1 to 20 of 1 sentences]
14
[+] score: 1
While the largest increase in abundance was observed with let-7c in both ORF1 and ORF3 libraries, and with miR-411-5p in the ORF2 library, miR-196a, miR-361-3p, and miR-1224-5p showed the largest decrease in abundance in the ORF1, ORF2 and ORF3 libraries, respectively. [score:1]
[1 to 20 of 1 sentences]
15
[+] score: 1
Matching of the miRNA’s nt 13–17 can compensate for a single-nucleotide bulge or mismatch in the seed region, as illustrated by the experimentally validated let-7 sites in LIN41 [34] and the miR-196 site in HOXB8 [35]. [score:1]
[1 to 20 of 1 sentences]
16
[+] score: 1
Liu L. Qian K. Wang C. Discovery of porcine miRNA-196a/b may influence porcine adipogenesis in longissimus dorsi muscle by miRNA sequencingAnim. [score:1]
[1 to 20 of 1 sentences]