sort by

166 publications mentioning mmu-mir-142b (showing top 100)

Open access articles that are associated with the species Mus musculus and mention the gene name mir-142b. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 323
Some of the miR-142-3p mutants acquire novel target regulatory functions vis-à-vis the ZEB1 or ZEB2 transcriptional repressors while some lose their ability to downregulate the known targets RAC1 and ADCY9. [score:9]
To show that the mutation in the miR-142-3p-m1 indeed affect the expression level of their mRNA targets, polyclonal rabbit antibodies against the ZEB2 protein were generated using a bacterially expressed GST-ZEB2 fusion protein as previously described [41]. [score:8]
In our previous study on miRNA expression in DLBCL, we found that both miR-142-3p and-5p were expressed at comparable levels (1.1% and 0.8%, respectively, of the total miRNA count) and they may therefore be of equal importance for the regulation of cellular targets [24]. [score:8]
In contrast to the regulation of the mouse p300 gene/mRNA by miR-142-5p, we were not able to demonstrate a downregulation of human p300 by miR-142-5p, neither by testing the 3′ UTR nor by expression of miR-142 in human cells. [score:7]
Seed-sequence mutations of miR-142-3p result in downregulation of ZEB2 protein expression. [score:7]
In addition, the putative tumor suppressor nasopharyngeal carcinoma -associated gene 6 (NGX6), when expressed in colon carcinoma cell lines, induced the expression of miR-142-3p, whereas miR-146a, which is known to be induced via NFkb by the EBV oncogene LMP1 [57], was reduced by NGX6 [58]. [score:7]
It is thus conceivable that at the seed-sequence mutations in miR-142-3p result in a release of RAC1 suppression with a subsequent block in apoptosis, for instance via binding to BCL-2. It is thus conceivable that some of the mutations described in this communication contribute to the induction of DLBCL via a loss of RAC1 inhibition by the mutated miR-142-3p. [score:7]
The two mutants m1 and m2 which show a “gain of function” vis-à-vis the ZEB1 and ZEB2 3′ UTRs also lose their ability to downregulate a second known target of miR-142-3p, the ADCY9 3′ UTR. [score:6]
Because there are no confirmed human miR-142-5p targets, it was not possible to test whether the larger product (or the other mutants affecting the mature miR-142-5p) was still able to regulate a potential target. [score:6]
We also analyzed the expression levels of the cloned miR-142 genes and found no obvious change in the expression of either miR-142-3p or-5p in the various clones (Fig. 6). [score:5]
MiR-142-3p is downregulated in acute myeloid leukemia [24] and inhibits migration and invasion of hepatocellular carcinoma lines [25]. [score:5]
We therefore asked whether the mutation in the seed sequence of miR-142-3p-m1 or -m2 had an influence on the downregulation of RAC1 by this miRNA. [score:5]
As shown in Figures 4A and S5, the vector expressing miR-142-3p-wt did not change the levels of ZEB2 in 293T cells, whereas the expression of the mutant m1 clearly led to a reduction of about 40% in the amount of endogenous ZEB2. [score:5]
When assayed with the various expression vectors, we found that miR-142-3p-wt downregulated the luciferase activity by about 35% (P = 2.4 exp 7), while both -m1 and -m2 had lost their ability to influence the RAC1 3′ UTR (P = 0.23 and P = 0.133, respectively) (Fig. 5A). [score:5]
The mutation in the seed sequence of miR-142-3p as identified by us generated three novel potential binding sites on the 3′ UTR of the mRNA coding for the transcriptional repressor ZEB2 (SIP1), which is, on one hand, involved in the switch of EBV latent to lytic replication [31], but also plays a role in cancer biology by regulating E-cadherin expression and the ensuing epithelial-to-mesenchymal transition (EMT) [32]. [score:5]
In a previous study, we found no change in the expression levels of both miR-142-5p and-3p when we compared EBV -positive versus EBV -negative cases of DLBCL where both miR-142-5p and-3p were expressed at about equal ratios [24]. [score:4]
However, all lymphomas harboring mutations in miR-142 showed expression of IRF4/Mum1 including those of GCB subtype by IHC (Table S1). [score:4]
Figure 3 Downregulation of the ZEB1 3′ UTR by miR-142-3p-m1 but not m2. [score:4]
Figure 4 Downregulation of the ZEB2 protein by miR-142-3p mutant m1. [score:4]
Downregulation of the ZEB2 protein by miR-142-3p mutant m1. [score:4]
In that study, we found that various cellular miRNAs were up- or downregulated at least twofold due to EBV infection, but no significant change in the levels of miR-142-3p or-5p was observed [23]. [score:4]
Point mutations in the seed sequence of miR-142-3p generate novel target sites in the ZEB1 and ZEB2 3′ UTRs. [score:4]
It might be possible that both miR-142-3p and-5p are involved in the regulation of pathways that eventually converge at (a) final target(s). [score:4]
Since no targets are known for miR-142-5p, we can only speculate about the consequences of the mutations affecting miR-142-5p. [score:4]
Conversely, we were able to demonstrate that the mutations in the seed sequence of miR-142-3p destroyed the ability of the miRNA to inhibit the RAC1 mRNA. [score:4]
We have also found a downregulation of miR-142-3p in EBV -positive nasal NK/T-cell lymphoma [52]. [score:4]
Figure 2 Downregulation of the ZEB2 3′ UTR by miR-142-3p mutant m1. [score:4]
Furthermore, we found that both mutants also lost their potential to downregulate the ADCY9 3′ UTR, while miR-142-3p-wt clearly had an effect toward this 3′ UTR (P = 0.000021 for miR-142-3p-wt, P = 0.027 for -m1, and P = 0.28 for -m2) (Fig. 5B). [score:4]
The mutations in m5 and m6 affected the mature miR-142-3p, and mutations in -m7 and -m10 were present in the mature miR-142-5p, but outside the seed sequence. [score:3]
On the other hand, miR-142 might have a tumor-suppressive role in B cells, and the loss of function could then contribute to the induction of DLBCL. [score:3]
We could clearly demonstrate the downregulation of the ZEB2 mRNA by the miR-142-3p mutant m1 (Fig. 1) both in the reporter assays using the ZEB2 3′ UTR (Fig. 2) and on the ZEB2 protein level (Fig. 3). [score:3]
Figure 6 Expression of miR-142 mutants. [score:3]
This is in contrast to recently published data which identified the 3′ UTR of the mouse p300 gene as a target for miR-142-5p [30]. [score:3]
In addition, it is unclear whether this aberrant miRNA still contained the complete sequence present in miR-142-5p or whether, for instance, the 5′ nucleotides essential for target recognition were absent. [score:3]
We then tested the expression level of ZEB2 in 293T cells transfected with empty vector, the pSG5-miR-142-wt vector, and pSG5-miR-142-3p-m1. [score:3]
The mutations were at different sites within the miR-142 precursor; apparently, this patient suffered two individual mutations. [score:3]
A comparison of the miR-142-5p levels in Burkitt's lymphoma versus DLBCL showed that primary Burkitt's lymphoma expresses significantly less miR-142-5p than primary DLBCL [56]. [score:3]
Of those, the mutant designated m9 had two base changes flanking miR-142-5p, and m10 had three mutations (two flanking and one mutation in the mature miR-142-5p outside the seed sequence). [score:3]
Sharma et al. had previously shown that the mouse p300 gene is a target for miR-142-5p. [score:3]
Figure 7The human p300 mRNA is not a target for miR-142-5p. [score:3]
We did not observe mutations in other miRNAs, which indicates that the mutations are specific for miR-142. [score:3]
Therefore, the impact of the miR-142 mutants on ZEB1 expression was not pursued further. [score:3]
A reduced inhibition of ADCY9 by the mutated miR-142-3p would result in increased cAMP levels. [score:3]
Likewise, it is important to identify targets for miR-142-5p. [score:3]
Finally, when we assayed some of the miR-142-5p mutants on the human p300 3′ UTR, we did not find a downregulation by either the wild-type or the mutant miRNAs. [score:3]
We therefore tested the 3′ UTR of the human p300 gene (accession number NM_001429) for its responsiveness to miR-142-5p-wt and of the mutants m1 (mutation in the miR-142-3p), m3 (mutation in the miR-142-5p seed sequence), and the incorrectly processed 5p mutant m9. [score:3]
Recently, the mRNAs coding for the small GTP -binding protein RAC1 and the adenylate cyclase 9 protein (ADCY9) were shown to be targets for miR-142-3p [25, 26]. [score:3]
It was previously shown that the 3′ UTR of the mRNAs for the small GTP -binding protein RAC1 as well as the ADCY9 represents targets for miR-142-3p [18, 26]. [score:3]
The various miR-142-3p,-5p, or precursor mutants were expressed in HEK 293T cells. [score:3]
MicroRNA expression using RNA mimics was done by transfecting 0.75 nmol per 10 [6] cells miR-142-3p-wt, miR-142-3p-m1, or miR-142-3p-m2 (Applied Biosystems/Ambion, Darmstadt, Germany). [score:3]
Robbiani et al. reported a reciprocal translocation in mature B-cell leukemia involving the miR-142 gene locus and the c-myc gene in transgenic, p53 -deficient mice overexpressing AID [19]. [score:3]
RAC1 was shown to be a target of miR-142-3p in hepatocellular carcinoma cells [26]. [score:3]
Furthermore, reduced levels of miR-29a and miR-142-3p are shown to promote growth of acute myeloid leukemia cells, while overexpression leads to a differentiation of myeloid cells with reduced growth properties [50]. [score:3]
To ascertain that the miR-142-5p and the other mutants were processed correctly, we carried out a analysis comparing the transiently expressed miR-142-5p-wt, -m1, -m3, and -m9 along with RNA from U2932 DLBCL cells [24]. [score:3]
As shown in Figure 7A, the p300 3′ UTR was not responsive to either the miR-142-wt or any of the mutants, while the RAC1 3′ UTR assayed in parallel was clearly downregulated by miR-142-wt. [score:3]
Figure 5 MiR-142-3p mutants m1 and m2 lose their potential to downregulate the RAC1 and ADCY9 3′ UTRs. [score:3]
Recently, the mouse p300 gene was identified as a target for murine miR-142-5p [30]. [score:3]
Human p300 is not a target for miR-142-5p. [score:3]
We had access to normal tissue in four cases that featured a mutation in miR-142 (patients with mutants m3, m7, m9, and m10/11). [score:2]
However, as the mutations occurred both in the mature miR-142-5p and-3p form, we assume that the observed gain of function for miR-142-3p on the ZEB1 or ZEB2 3′ UTR was a fortuitous event. [score:2]
Mutations in miR-142 affect correct processing. [score:2]
Here, we show that 11 of 56 DLBCLs suffered mutations in the gene-encoding miR-142 affecting either miR-142-5p, miR-142-3p, or the 87 nt precursor encompassing both miRNAs. [score:2]
We again hypothesize that the miR-142 mutations will most likely result in a loss rather than a gain of function. [score:2]
As described by Wu et al. [26], miR-142-3p appears to be a negative regulator of cell growth. [score:2]
However, we detected a mutation affecting the seed region of miR-142-3p, which generated a potential novel binding site in the 3′ UTR of the ZEB1 mRNA and three potential novel binding sites in the 3′ UTR of the ZEB2 mRNA. [score:2]
miR-142 mutations found in 56 DLBCLs. [score:2]
At least in some cases of DLBCL, the mutations in miR-142-3p/5p might also influence the tumor cell growth via reduced differentiation. [score:2]
In both cases, the translocation affected the levels of c-myc transcript, whereas point mutations in the miR-142 locus were not reported. [score:2]
In the controls (DNA of 20 healthy blood donors and of 10 benign tonsils), no mutation affecting miR-142 was detected (data not shown). [score:2]
The nature of the genes that are regulated by miR-142 in DLBCL is unknown and needs to be elucidated. [score:2]
Mutations in the seed sequence of miR-142-3p result in a loss of responsiveness of the RAC1 and the ADCY9 3′ UTRs. [score:2]
At present, we favor the idea that the mutations within either miR-142-3p or-5p result in a loss of function, which might result in a growth stimulation in DLBCL. [score:2]
The same holds true for the different miR-142 mutations found. [score:2]
The expression of miR-142-3p m1 and m2 (A and C) or-5p (B) was assayed byting using the indicated probes. [score:2]
In addition, the sequences of the miRNAs obtained from the miRNA profiling data of 10 cases each of prostate carcinoma and normal prostate tissue that were previously obtained [35] also showed no mutation in the mature miR-142-3p or-5p (J. Szczyrba, pers. [score:2]
Thus, the occurrence of the miR-142 mutations cannot be correlated to a certain DLBCL subtype. [score:2]
Mutations affecting miR-142 are found in 20% of DLBCL analyzed. [score:2]
Two point mutations each affected the seed sequences of miR-142-5p (mutants designated -m3 and -m4 in Fig. 1) or-3p (mutants designated -m1 and -m2 in Fig. 1). [score:2]
As none of the C-residues in the miR-142 mutants described in the present paper confers to the WRCY (tryptophan-arginine-cysteine-tyrosine) motif used by AID, we assume that the mutations were not caused by AID but by another mechanism active in DLBCL. [score:2]
We thus analyzed a total of 56 cases of DLBCL for the presence of mutations affecting miR-142 and also assayed the regulation of the above-mentioned 3′ UTRs vis-à-vis the mutant miRNA. [score:2]
In one of the cases, we noted a mutation from T to C at position 8 in the seed sequence of miR-142-3p that was confirmed by DNA sequencing of the original tumor specimen. [score:2]
However, as depicted in Figure 1, we found single mutations within the 87 nt long precursor sequence for miR-142 in 11 (19.64%) of 56 cases of DLBCL. [score:2]
Figure 1 Mutations of miR-142 found in DLBCL. [score:2]
Of the 11 lymphomas with miR-142 mutation, five were of ABC and six of GCB type as determined by immunohistochemistry (IHC) [36]. [score:2]
Of those, four single point mutations were present in the mature miR-142-5p or-3p. [score:2]
None of the miR-142 constructs had an effect on the empty pMIR reporter vector (Fig. 2A, left panel). [score:1]
Lv et al. have shown that miR-142-3p plays an oncogenic role in T-lineage acute lymphoblastic leukemia (T-ALL) [51]. [score:1]
org/) employing the mutated seed sequence of miR-142-3p-m1 shown in Figure 1 indicated that the 3′ UTR of the ZEB2 mRNA contained three potential novel binding sites for m1. [score:1]
HEK 293T cells were transfected with empty pSG5 vector, pSG5-miR-142-3p-wt or the m1 mutant as indicated. [score:1]
The mature human and the mouse miR-142-5p are identical. [score:1]
The correct processing to miR-142-3p was previously demonstrated [42]. [score:1]
Further experiments will be necessary to analyze the function of miR-142-3p and-5p for lymphoma cell growth. [score:1]
Because ZEB2 plays a role in tumorigenesis [32], we wanted to see whether miR-142 was mutated in a larger number of DLBCL cases. [score:1]
As shown in Figure S4, miR-142-5p-wt and m1 migrated to the same position as the endogenous miR-142-5p from the U2932 cells. [score:1]
The mutant m9 showed correct processing to the mature miR-142-3p but exhibited a somewhat larger “mature” miR-142-5p. [score:1]
In the case of miR-142-5p-m9, we observed aberrant processing of the miRNA which led to the generation of a larger final product. [score:1]
As already shown in Figure 6, m3 was not recognized using the probe for miR-142-5p-wt, and the m9 mutant again migrated to a higher position. [score:1]
The sequence of the wild-type (WT)miR-142 precursor is shown on top, sequences of the mature miR-142-5p and-3p are underlined with the seed sequences shown in boldface. [score:1]
As shown in Figure 6, all mutants with the exception of m9 were properly processed to the mature miR-142-5p or-3p. [score:1]
Features of the tumours with mutations in miR-142 (OS: overall survival; BA: break-apart assay; cell of origin: determined according to Ref. [score:1]
For the mutations of the binding sites of the miR-142-3p mutants in the 3′ UTR of ZEB2, the sites 1–3 as shown in Figure S1 were sequentially mutated as described [34] using the primer pairs ZEB2 mut1 5′-ACT CTA CTT ATG TAT AGA TCT AAA CTT TAA AAA AC-3′ and ZEB2 mut1rev 5′-GTT TTT TAA AGT TT A GAT CTA TAC ATA AGT AGA GT-3′; ZEB2 mut2 5′-TTT AAT TGC TCG AGA TCT AAT GCA TCA GTA TTA-3′ and ZEB2 mut2rev 5′-TAA TAC TGA TGC ATT AGA TCT CGA GCA CAT TAA A-3′; ZEB2 mut3 5′-CAT TTT AAA AAG GTG CCC G AG ATC TCA TAC ATC AG-3′ and ZEB2 mut3rev 5′-CTG ATG TAT G AG ATC TCG GGC ACC TTT TTA AAA G-3′. [score:1]
The DLBCL cell line U2932 was transfected with RNA mimics using the miR-142-3p-wt or a scrambled RNA mimic (“NC”) as controls as indicated (C). [score:1]
For the amplification of the miR-142 gene with the proof-reading Phusion DNA polymerase (New England Biolabs, Frankfurt/M. [score:1]
We could also demonstrate an effect of the mutants miR-142-3p-m1 and -m2 on the 3′ UTR of the ZEB1 mRNA. [score:1]
We initially observed no or low signals for miR-142-m3-5p, m7-5p, and m10-5p. [score:1]
Thus, miR-142 can be added to the growing number of genes that are mutated in DLBCL. [score:1]
analysis of the miR-142-mutants -m3, -m4, -5, and m10. [score:1]
A corresponding translocation in human aggressive B-cell leukemia involving the miR-142 locus (there called the bcl3 gene) and c-myc was described earlier [20]. [score:1]
The seed sequence is indicated by bold letters, the binding region for miR-142-5p by a bar. [score:1]
As shown in Figure 6, the miR-142-5p-wt probe did not yield a signal for m3 or m7. [score:1]
The alignment of the predicted and known binding sites for miR-142-5p in the human and the mouse p300 3′ UTRs, respectively, are shown in Figure 7C. [score:1]
We then analyzed the EBV -negative U2932-DLBCL cell line for the influence of miR-142-3p-wt or the -m1 mutant. [score:1]
Zhnag et al. have shown that high levels of miR-375 and low levels of miR-142-5p are a predictor for the outcome of gastric carcinoma [49]. [score:1]
Comparison of transiently transfected miR-142-5p mutants with endogenous miR-142-5p. [score:1]
HEK 293T cells (A) were transfected with empty pSG5 vector, pSG5-miR-142-3p-wt, or the m1 mutant as indicated. [score:1]
The luciferase reporter analysis shown in Figure 2A, right panel, demonstrated that m1 but not the miR-142-3p wild-type nor the miR-142-3p-m3 mutant had a significant effect on the reporter. [score:1]
Schematic representation of the potential binding sites for miR-142-m1 and miR-142-m2 in the ZEB1 and ZEB2 3′ UTRs in the luciferase reporter constructs. [score:1]
[1 to 20 of 117 sentences]
2
[+] score: 314
SOCS1 is a target gene transcribed by STAT6 but that provides negatively feedback to inhibit STAT6 phosphorylation 2. Our data showed that miR-142-5p upregulated by STAT6 suppresses SOCS1, a STAT6 inhibitor, as it reaches its peak of expression at later time points following Th2 stimulation, which is important for the persistent activation of the STAT6 pathway to maintain an M2 signature. [score:14]
Because miRNAs may inhibit target gene expression by blocking protein translation or by degrading mRNA, we evaluated whether miR-142-5p or miR-130a-3p influences the mRNA and protein expression of their target genes. [score:11]
Of the most significantly differentially expressed genes in M(IL-4) when transduced with miR-142-5p ASO or miR-130a-3p mimics, two master regulators of M2 polarization 2, SOCS1 expression was elevated and PPARγ expression was reduced (Fig. 4a), suggesting that these genes are potential targets of miR-142-5p and miR-130a-3p, respectively. [score:10]
Therefore, miR-142-5p upregulation and miR-130a-3p downregulation in M2 macrophages help to maintain M2 signalling by altering SOCS1 and PPARγ expression. [score:9]
MiRanda and TargetScan predicted SOCS1 as the target gene of miR-142-5p, while all three miRNA target prediction databases predicted PPARγ as the target gene of miR-130-3p. [score:9]
Although the functions and targets of miR-142-5p have been not reported previously, the preferential expression of the miR-142 family in hematopoietic tissues with the highest expression in myeloid lineages 36, indicates its role in immune regulation. [score:8]
These findings may have clinical applications, as miR-142-5p is upregulated and miR-130a-3p is downregulated in the macrophages in livers of patients with liver cirrhosis and in those in the BAL fluid of IPF patients. [score:7]
STAT6 is the principal transcriptional factor in mediating M2 gene expression 2. Our data revealed that Th2 cytokine -induced miR-142-5p upregulation helps to maintain long-term STAT6 phosphorylation by silencing its negative regulator, SOCS1. [score:7]
Collectively, our data suggested that miR-142-5p downregulation and miR-130a-3p upregulation synergistically enhance the profibrogenic activities of macrophages. [score:7]
To identify the target genes of miR-142-5p and miR-130a-3p that are involved in M2 polarization, we examined the mRNA expression profile changes after altering miR-142-5p or miR-130a-3p expression in M(IL-4). [score:7]
To further confirm that miR-142-5p targets SOCS1 to maintain M2 macrophage activation, we rescued SOCS1 expression by transfecting M(IL-4) with a SOCS1 expression vector carrying a mutated seed sequence for miR-142-5p (SOCS1-mut) at its 3′ UTR. [score:7]
Transduction of macrophages with either miR-142-5p ASO or miR-130a-3p mimics significantly reduced the expression of M2 markers (Fig. 2b–d and Supplementary Fig. 2c,d) and pinocytosis (Supplementary Fig. 2e) induced by IL-4. Of note, upregulation of the M2 markers and pinocytosis induced by IL-4 was almost completely abrogated when both miR-142-5p ASO and miR-130a-3p mimics were transduced. [score:6]
Knockdown or forced expression of miR-142-5p or miR-130a-3p in fibroblasts had no appreciable effects of TGF-β1 expression or activation (Supplementary Fig. 3f). [score:6]
miR-142-5p expression was significantly increased in the macrophages of the cirrhotic liver tissues compared with normal liver tissues resected from patients with hepatic haemangioma, while miR-130a-3p expression was markedly decreased (Fig. 9i), demonstrating the correlation of altered miR-142-5p and miR-130a-3p expression in hepatic macrophages of liver cirrhosis. [score:6]
Collectively, modulating the expression of miR-142-5p and miR-130a-3p in hepatic macrophages inhibits the progression of liver fibrosis. [score:5]
Additionally, TGF-β1 expression and activation in the co-cultured fibroblasts were suppressed by miR-142-5p and miR-130a-3p (Fig. 3g). [score:5]
Transduction of the untreated macrophages with miR-142-5p mimics decreased SOCS1 mRNA and protein expression, whereas transduction of the M(IL-4) with miR-142-5p ASO increased SOCS1 mRNA and protein expression (Fig. 4c,d). [score:5]
To validate whether IL-4 -induced miR-142-5p upregulation results in M2 polarization and profibrogenesis by silencing SOCS1, we knocked down SOCS1 in M(IL-4) that were transduced with miR-142-5p ASO (Supplementary Fig. 4a). [score:5]
Consistent with our findings in human macrophages, IL-4 increased miR-142-5p expression and reduced miR-130a-3p expression in mouse macrophages (Fig. 6b). [score:5]
More importantly, inhibiting miR-142-5p and increasing miR-130a-3p expression with LNA -modified oligonucleotides alleviated both CCL [4] -induced liver fibrosis and bleomycin -induced lung fibrosis, highlighting the therapeutic importance of these miRNAs. [score:5]
Corn oil gavage with carbon tetrachloride (CCL [4]) in mice resulted in massive liver fibrosis (Fig. 9a,f) as reported previously 25, and led to increased miR-142-5p expression and decreased miR-130a-3p expression in the isolated hepatic macrophages (Fig. 9b). [score:5]
Next, we investigated the mechanisms by which IL-4 upregulates miR-142-5p but downregulates miR-130a-3p. [score:5]
Consistent with our findings in mouse lung fibrosis, miR-142-5p expression in the macrophages of BAL fluid from IPF patients was increased, while miR-130a-3p expression was reduced (Fig. 10g). [score:5]
Collectively, increased miR-142-5p and reduced miR–130a-3p expression result in M2 polarization and profibrogenesis by silencing SOCS1 and by relieving PPARγ targeting, respectively. [score:5]
Taken together, these results indicated that aberrant miR-142-5p and miR-130a-3p expression in lung macrophages might be involved in the development of pulmonary fibrosis. [score:4]
Sequence analysis revealed a STAT6 -binding site conserved among humans and mice located at −91 to −83 bp upstream of the miR-142 TSS (Fig. 7b), wherein mutation of three nucleotides, treatment with STAT6 inhibitors (leflunomide and AS1517499) or transfection with STAT6-siRNA abrogated the IL-4 -induced luciferase activities (Fig. 7c). [score:4]
To investigate whether miR-142-5p and miR-130a-3p could directly mediate the TGF-β1 expression in fibroblasts, we examined their expression levels of these miRNAs in fibroblasts. [score:4]
Consistent with our findings, miR-142-5p, was markedly upregulated in renal fibrosis induced by unilateral ureteral obstruction 43. [score:4]
miR-142-5p and miR-130a-3p regulate profibrogenesis by targeting SOCS1 and PPARγ respectively. [score:4]
IL-4 upregulates miR-142-5p via STAT6. [score:4]
Therefore, SOCS1 and PPARγ are target genes of miR-142-5p and miR-130a-3p, respectively. [score:3]
Glioblastoma-infiltrating macrophages, which are activated primarily by M-CSF, display downregulated miR-142-3p compared with GM-CSF -treated cells 42. [score:3]
To determine the clinical relevance of our findings, we examined the expression of miR-142-5p and miR-130a-3p using fluorescence in situ hybridization (FISH) in the liver samples of patients with hepatitis B induced liver cirrhosis. [score:3]
These data suggested that IL-4/STAT6 directly regulate miR-142 transcription via its promoter. [score:3]
Because miRNAs may participate in signal transduction feedback circuits by maintaining the expression of signalling proteins 23, we further evaluated the contributions of miR-142-5p and miR-130a-3p in maintaining SOCS1 and PPARγ levels in M2 macrophages by examining the kinetics of the miRNAs and their target genes in macrophages following IL-4 treatment. [score:3]
Silencing SOCS1 recapitulated the capacity of M(IL-4) to produce M2 cytokines (Supplementary Fig. 4b) and to promote fibrogenesis (Supplementary Fig. 4c,d), which was suppressed by miR-142-5p ASO. [score:3]
Furthermore, combined treatment with both miR-142-5p ASO and miR-130a-3p mimics almost completely abrogated profibrotic marker expression in hepatic macrophages and liver fibrosis (Fig. 9a–f). [score:3]
Transduction of M(IL-4) with miR-142-5p ASO and miR-130a-3p mimics abrogated the ability of macrophages to induce FAP and α-SMA expression in the fibroblasts (Fig. 3b,d). [score:3]
Transduction of miR-142-5p ASO and miR-130a-3p mimics in IL-4 -treated mouse macrophages synergistically inhibited M2 polarization (Fig. 6c,d) and their profibrogenic effect (Fig. 6e,f). [score:3]
Indeed, administration of miR-142-5p ASO or/and miR-130a-3p mimics successfully prevented fibrosis in two major fibrotic disease mouse mo dels. [score:3]
miR-142-5p and miR-130a-3p target the 3′UTRs of SOCS1 and PPAR γ respectively. [score:3]
To determine whether miR-142-5p and miR-130a-3p are involved in human IPF, we isolated macrophages from the bronchial alveolar lavage (BAL) fluid of normal volunteers and IPF patients and examined the expression of miR-142-5p and miR-130a-3p by. [score:3]
Therefore, our findings suggested the therapeutic potential of inhibiting miR-142-5p and elevating miR-130a-3p in macrophages to treat lung fibrosis. [score:3]
Importantly, administration of LNA -modified miR-142-5p ASO and miR-130a-3p mimic failed to inhibit CCL [4] -induced liver fibrosis in Ccr2 [−/−] mice (Supplementary Fig. 6a). [score:3]
After 24 h, the cells were stimulated with IL-4 for 24 h and expression of miR-142-5p and miR-130a-3p was examined by (mean±s. [score:3]
miR-142-5p and 130a-3p target SOCS1 and PPARγ, respectively. [score:3]
Our data showed that their expression levels in fibroblasts were much lower than those in macrophages, particularly the levels of miR-142-5p (Supplementary Fig. 3e). [score:3]
The varied levels of miR-142 expression in different subtypes of activated macrophages may be due to the activation of different signalling pathways and to the induction of transcription factors by different stimulating cytokines. [score:3]
Mechanistically, the elevated miR-142-5p prolongs STAT6 phosphorylation by targeting SOCS1, while miR-130a reduction relieves its repression of PPARγ, a STAT6 coordinator. [score:3]
However, intravenous injection of LNA -modified miR-142-5p ASO or miR-130a-3p mimics following CCL [4] challenge reduced miR-142-5p and increased miR-130a-3p in the hepatic macrophages to normal ranges (Fig. 9b), consistent with previous findings that LNA -modified oligonucleotides alter miRNA expression in immune cells in vivo 27 28. [score:3]
More importantly, treatment with miR-142-5p ASO elevated SOCS1 levels and reduced STAT6 phosphorylation, while treatment with miR-130a-3p mimics repressed PPARγ expression (Fig. 9c). [score:3]
We used locked nucleic acid (LNA) -modified miR-142-5p ASO or/and miR-130a-3p mimic that are more stable in vivo and with less off-target effects 27 28. [score:3]
Furthermore, transducing the M(IL-4) with miR-142-5p ASO and miR-130a-3p mimics synergistically inhibited their ability to stimulate collagen production and proliferation of fibroblasts when co-cultured (Fig. 3d–f and Supplementary Table 2). [score:3]
In parallel, SOCS1 protein levels gradually decreased as miR-142-5p expression levels increased, recovering STAT6 phosphorylation at 24 h after IL-4 stimulation that was sustained for at least 48 h (Fig. 4g). [score:3]
miR-142-5p and miR-130a-3p regulate profibrogenesis of mouse macrophages. [score:2]
miR-142-5p and miR-130a-3p regulate M2 activation of macrophages. [score:2]
DyregulatedmiR-142-5p and miR-130a-3p enhance lung fibrosis. [score:2]
miR-142-5p and 130a-3p regulate Mϕ profibrogenesis. [score:2]
Nevertheless, our data and those of another group 43 indicated that miR-142-5p and miR-130a-3p were dysregulated in multiple organ fibrosis of both humans and mice. [score:2]
DyregulatedmiR-142-5p and 130a-3p enhance lung fibrosis. [score:2]
DyregulatedmiR-142-5p and miR-130a-3p enhance liver fibrosis. [score:2]
How to cite this article: Su, S. et al. miR-142-5p and miR-130a-3p are regulated by IL-4 and IL-13 and control profibrogenic macrophage program. [score:2]
miR-142-5p and miR-130a-3p regulate the profibrogenesis of macrophages. [score:2]
DyregulatedmiR-142-5p and 130a-3p enhance liver fibrosis. [score:2]
Collectively, our data suggest that miR-142-5p and miR-130a-3p mediate M2 polarization and profibrogenic effects in both humans and mice. [score:1]
Interestingly, miR-142-5p gradually increased following IL-4 stimulation, peaked at 24 h, and remained at a high level for at least 48 h (Fig. 4g). [score:1]
Cells were transfected with 10 pmol miR-142-5p mimics, miR-130a-3p mimics or scramble controls (Qiagen) and co -transfected with 0.2 μg per well wild-type SOCS1 3′ UTR-luc, mutant SOCS1 3′ UTR-luc, wild-type PPARγ 3′ UTR-luc or mutant PPARγ 3′ UTR-luc, respectively, using JetPEI transfection reagent (Polyplus transfection, Illkirch, France) according to the manufacturer's instructions. [score:1]
Moreover, our findings that blocking miR-142-5p with ASO together with increasing miR-130a-3p with miRNA mimics almost completely abrogated M2 activation and their profibrogenic effects support the finding that changes in the levels of multiple miRNAs may act synergistically to sustain macrophages in a certain activation status. [score:1]
Our present findings further clarify the role of miR-142 in immune cells as a maintainer of sustained M2 activation. [score:1]
Similar to the findings in liver fibrosis, administering miR-142-5p ASO and miR-130a-3p mimics significantly reduced the degree of lung fibrosis in the bleomycin -treated mice (Fig. 10c,d). [score:1]
IL-4/IL-13 increases miR-142-5p via STAT6 and reduces miR-130a-3p by histone deacetylation in macrophages. [score:1]
Similar to their effects on hepatic fibrogenesis, the transduction of miR-130a-3p mimics and miR-142-5p ASO to M(IL-13) synergistically abrogated the profibrotic effects of these cells in the lungs (Fig. 10b). [score:1]
miR-142-5p and 130a-3p control M2 polarization. [score:1]
In contrast, LNA -modified miR-142-5p ASO and miR-130a-3p mimic did not exert anti-fibrotic effects against bleomycin -induced lung lesion in Ccr2 [−/−] mice (Supplementary Fig. 6b). [score:1]
The seed sequence of miR-142-5p at SOCS1-3′ UTR and that of miR-130a-3p at PPARγ-3′ UTR are conserved among humans and mice (Fig. 6a). [score:1]
A series of pGL3 reporter plasmids carrying sequential deletions of the 5'-flanking region of miR-142-5p cloned upstream of the firefly luciferase gene were tested for IL-4 responsiveness upon transfected into Mono Mac6 (MM6) cells, a human macrophage cell line previously used for M2 gene transcription studies 6 Sequence deletions from −1911 up to −183 bp upstream of the transcription start site (TSS) of miR-142 did not influence IL-4 -induced luciferase activities, while deletion to −61 bp completely abolished these IL-4 -induced effects (Fig. 7a). [score:1]
Here, we demonstrated that increased miR-142-5p and reduced miR-130a-3p in macrophages upon Th2 stimulation help to maintain M2 polarization and their profibrogenic activities. [score:1]
Thus, miR-142-5p and miR-130a-3p reduce the mRNA stability of SOCS1 and PPARγ mRNA in macrophages, respectively. [score:1]
To further explore the therapeutic potentials of LNA -modified oligonucleotides in lung fibrosis, we administered bleomycin intratracheally into wild-type mice and initiated intravenous injection of LNA -modified miR-142-5p ASO or/and miR-130a-3p mimic 16 days after bleomycin challenge, which was then repeated every 3 days until 28d, when the animals were sacrificed for examination. [score:1]
Additionally, co-culturing the fibroblasts with M(IL-4) enhanced the ability of the fibroblasts to contract collagen gel; this enhancement was substantially attenuated when miR-142-5p was reduced or/and miR-130a-3p was increased in the co-cultured macrophages (Fig. 3c). [score:1]
Briefly, 1 × 10 [6] cells were transfected with 200 pmol mouse miR-142-5p ASO or the scramble negative control and 10 pmol mouse miR-130a-3p or scramble negative control (Qiagen). [score:1]
Co-transfection with miR-142-5p mimics specifically reduced the luciferase activity of the SOCS1-3′ UTR transfected cells, while miR-130a-3p mimics reduced that of the PPARγ-3′ UTR transfected cells (Fig. 4b). [score:1]
To determine whether the effects of blocking miR-142-5p and supplementing miR-130a-3p are synergistic, we employed a combination index (CI) to indicate synergistic (CI<1), additive (CI=1) and antagonistic (CI>1) effects of miR-142-5p ASO and miR-130a-3p mimics on M2 cytokine production, respectively. [score:1]
To further confirm the roles of miR-142-5p and miR-130a-3p in M2 polarization, we transduced M(IL-4) with miR-142-5p ASO or/and miR-130a-3p mimics and adjusted their miRNA levels to those in the untreated cells (Supplementary Fig. 2b). [score:1]
A series of nested deletions were generated using miR-142 (−1911/+91)-luc or miR-130a (−1891/+91)-luc as the template and the forward primers listed in Supplementary Table 3. The point mutations were introduced into the by QuikChange Site-Directed Mutagenesis Kit (Stratagene) using primers listed in Supplementary Table 3 according to manufacturer's instructions. [score:1]
For LNA -modified oligonucleotides treatment, intravenous injection of LNA -modified miR-142-5p ASO, miR-130a-3p mimics, scramble control ASO or scramble control mimics (Exiqon) was performed 24 h after the initiation of CCL [4] or 16 days after bleomycin challenge at a dose of 0.15 mg g [−1] body weight and was repeated every 3 days thereafter. [score:1]
Quantification of miR-142-5p [+] and miR-130a-3p [+]macrophages (normal liver group, n=24; cirrhotic liver group, n=39, mean±s. [score:1]
We observed that transduction of the macrophages with miR-142-5p ASO or miR-130a-3p mimics, but not with other oligonucleotides, reduced CCL18 secretion following IL-4/IL-13 treatments (Supplementary Fig. 2a). [score:1]
Our data showed that IL-4/IL-13 increase primary miR-142 transcription via STAT6 signalling, which is not a major signalling pathway of M-CSF 44. [score:1]
These fragments were fused to pGL3-Basic vector (5'KpnI and 3' XhoI, Promega) to generate miR-142 (−1911/+91)-luc and miR-130a (−1891/+91)-luc, respectively. [score:1]
miR-142-5p and 130a-3p mediate Mϕ profibrogenesis in mice. [score:1]
DNA probes containing the STAT6 site of the miR-142 promoter or the SP1 site of the miR-130a promoter (Supplementary Table 3) were labelled at the 3'-end with biotin using a Biotin 3'End DNA Labelling Kit (Pierce), according to the manufacturer's instructions. [score:1]
The wild-type or mutant 3′ UTRs of SOCS1 and PPARγ containing the predicted miR-142-5p or miR-130a-3p binding sites were synthesized (GeneArt, Lifetechnologies, Germany) and cloned into the pGL3.0-control vectors according to the manufacturer's instructions (Promega, Madison, WI). [score:1]
Then, the sections were hybridized with 20 nM 5' digoxigenin -labelled LNA control probe and miR-142-5p or miR-130-3p probe (Exiqon) overnight at 42 °C, then rinsed twice with 5 × SSC at room temperature, washed three times in 2 × SSC/50% formamide at hybridization temperature for 20 min and washed four times in PBS with 0.1% Tween 20 (PBST). [score:1]
Indeed, the therapeutic effects of LNA -modified miR-142-5p ASO and miR-130a-3p mimics against fibrosis were absent in Ccr2 [−/−] mice. [score:1]
To study the particular roles of miR-142-5p and miR-130a-3p in profibrotic macrophages in vivo, we transduced miR-142-5p ASO or/and miR-130a-3p mimics to wild-type M(IL-13) and transferred these cells to Ccr2 [−/−] mice challenged with bleomycin. [score:1]
Collectively, our data suggested that miR-142-5p and miR-130a-3p synergistically control M2 macrophage polarization. [score:1]
The in vivo functions of macrophage-related miR-142-5p and miR-130a-3p were also studied in wild-type and Ccr2 [−/−] mouse mo dels of lung fibrosis induced by bleomycin 31 32. [score:1]
[1 to 20 of 98 sentences]
3
[+] score: 294
The result from this study reveals that CXCL12 could down-regulate the expression of miR-142-3p in human CD4 [+] T cells, which indicates that CXCL12 may act as an up-stream regulator for the expression miR-142-3p in CD4 [+] T cells under ASO condition. [score:9]
To up-regulate the expression miR-142-3p in CD4 [+] T cells, lentivirus expressing miR-142-3p (Lv-miR-142-3p) was used. [score:8]
The down-regulation of miR-142-3p could increase the migration of CD4 [+] T cells into the vascular walls by regulation of actin cytoskeleton via its target genes, RAC1 and ROCK2. [score:7]
Thus, the down-regulated miR-142-3p in CD4 [+] T cells under ASO condition could increase the migration of CD4 [+] T cells by regulation of actin cytoskeleton via its target genes, RAC1 and ROCK2. [score:7]
To identify the direct target genes of miR-142-3p that are related to cell migration, we first performed the bioinformatics analysis and found that RAC1, ROCK2 and WASL could be its potential target genes. [score:6]
As shown in Figure 1C, the expression of miR-142-3p in human CD4 [+] T cells was significantly down-regulated by CXCL12-stimulation (Figure 1C). [score:6]
2. Down-regulation of miR-142-3p in Human CD4 [+] T cells from Patients with ASOThe expression of miR-142-3p in CD4 [+] cells (Purity>97%) was determined by qRT-PCR and in situ hybridization. [score:6]
As miR-142-3p is down-regulated in CD4 [+] T cells from ASO, lentivirus expressing miR-142-3p is constructed and used to determine its biological role. [score:6]
The result shows that up-regulation of miR-142-3p in CD4 [+] T cells could inhibit their migration into aortas or spleens from circulating blood. [score:6]
The relative expression level of miR-142-3p was assessed by qRT-PCR, and an up-regulation of miR-142-3p was seen in Lv-miR-142-3p group (Figure 2C). [score:6]
The decreased miR-142-3p is able to increase the expression of its target genes, RAC1 and ROCK2. [score:5]
In additional other up-stream regulators and their detailed molecular mechanisms responsible for the down-regulation miR-142-3p in CD4 [+] T cells need to be identified in future studies. [score:5]
The results demonstrated that miR-142-3p might inhibit the actin polymerization and polarization through its target genes in CD4 [+] T cells. [score:5]
In contrast, miR-142-3p has a strong inhibitory effect on the expression of RAC1 and ROCK2 at both mRNA and protein levels. [score:5]
Genes related with migration were analyzed by bioinformatics and the potential target genes of miR-142-3p were screened by Targetscan, Miranda, Mirbase, Pic Tar, RNA 22 and PITA, which were further selected according to their positive predictive values. [score:5]
Compared with that from healthy donors, the expression of miR-142-3p in CD4 [+] cells from patients with ASO was significantly down-regulated as determined by the qRT-PCR (Figure 1A). [score:5]
We thus hypothesized that the regulatory effect of miR-142-3p on CD4 [+] T cell migration may be mediated by regulation of actin cytoskeleton via its target genes, RAC1, and ROCK2. [score:5]
The results have revealed that the miR-142-3p expression is down-regulated by 70% in CD4 [+] T cells from patients with ASO compared with that in cells from the healthy donors. [score:5]
CXCL12 inhibits the expression of miR-142-3p in CD4 [+] T cells. [score:5]
Then, each psiCHECK-2 construct along with control vector (vector), miR-142-3p mimics, miR-142-3p inhibitor, mimics control or inhibitor control was transfected into HEK293T cells. [score:5]
2. Down-regulation of miR-142-3p in Human CD4 [+] T cells from Patients with ASO. [score:4]
A hypothesis of the increased migration of CD4 [+] T cells by the down-regulation of miR-142-3p in ASO. [score:4]
In the current study, the down-regulation of miR-142-3p in CD4 [+] T cells from ASO patients is verified by qRT-PCR and is further confirmed by the in situ hybridization. [score:4]
The results demonstrated that both RAC1 and ROCK2 were down-regulated by miR-142-3p at both mRNA (Figure 4A) and protein (Figure 4B) levels. [score:4]
In summary, the current study has identified that miR-142-3p in CD4 [+] T cells is significantly down-regulated in patients with ASO, at least in part, by inflammatory chemokines such as CXCL12 (Figure 6). [score:4]
Taken together, RAC1 and ROCK2 were direct target genes of miR-142-3p. [score:4]
4. Up-regulation of miR-142-3p via Lentivirus -mediated Gene Transfer. [score:4]
Up to date, the mechanisms related to the down-regulation of miR-142-3p in CD4 [+] T cells under the ASO condition are still unknown. [score:4]
MiR-142-3p has recently been identified as a down-regulated miRNA in CD4 [+] T cells in patients with systemic lupus erythematosus, which is associated with the over-activation of CD4 [+] T cells [3]. [score:4]
The down-regulation of miR-142-3p in CD4 [+] cells from patients with ASO was further confirmed by analysis of fluorescence intensity via in situ hybridization (Figure 1B). [score:4]
Taken together, the results indicate that RAC1 and ROCK2 are two direct target genes of miR-142-3p in CD4 [+] T cells. [score:4]
Up-regulation of miR-142-3p by lentivirus -mediated gene transfer. [score:4]
0095514.g006 Figure 6A hypothesis of the increased migration of CD4 [+] T cells by the down-regulation of miR-142-3p in ASO. [score:4]
To test the potential target genes of miR-142-3p that are related to its biological effect on CD4 [+] T cell migration, we first performed the bioinformatics analysis of the genes that are related to the regulation of actin cytoskeleton and have the miR-142-3p binding sites in their 3′UTRs. [score:4]
Indeed, our result by actin staining has revealed the attenuation of actin polymerization and polarization in cells after up-regulation of miR-142-3p. [score:4]
However, the detailed molecular mechanisms that are responsible for CXCL12 -mediated downregulation of miR-142-3p in human CD4 [+] T cells are still unclear. [score:4]
Our results show that in the presence of the RAC1 or ROCK2 3′UTR, miR-142-3p mimics significantly decrease the luciferase activity, while miR-142-3p inhibitor show an opposite result. [score:3]
The expression of miR-142-3p in CD4 [+] cells (Purity>97%) was determined by qRT-PCR and in situ hybridization. [score:3]
After stimulation with CXCL12, cells transfected with Lv-NC showed a normal pattern of actin polymerization and polarization (Figure 5A), while an inhibitory result was shown in Lv-miR-142-3p group (Figure 5B). [score:3]
In contrast, no effect of miR-142-3p on the expression of WASL was found. [score:3]
The results showed that in the presence of the RAC1 or ROCK2 3′UTR, miR-142-3p mimics significantly decreased relative luciferase activity while miR-142-3p inhibitor showed an opposite effect (Figure 4C). [score:3]
of the miRNA array in our laboratory have identified that miR-142-3p is down-regulated in patients with ASO compared with that in healthy donors. [score:3]
The current study has identified, for the first time, that miR-142-3p has a strong inhibitory effect on human CD4 [+] T cell migration in cultured system in vitro. [score:3]
7. Actin Cytoskeleton Regulation of miR-142-3p in Human CD4 [+] T cells RAC1 and ROCK2 are two known regulatory genes of actin cytoskeleton. [score:3]
6. Target Gene Identification of miR-142-3p. [score:3]
3. CXCL12-stimulation Decreases the Expression of miR-142-3p. [score:3]
The inhibitory effect of miR-142-3p on cancer cell migration is also demonstrated in hepatocellular carcinoma cells in a recent report [18]. [score:3]
To verify the inhibitory effect of miR-142-3p on CD4 [+] T cell migration in vivo, we have performed the animal trafficking experiment in vivo by using fluorescent labeled mouse CD4 [+] T cells. [score:3]
5. Target Prediction of miR-142-3p. [score:3]
Thus, WASL is not a target gene of miR-142-3p in CD4 [+] T cells. [score:3]
The expression of miR-142-3p in human CD4 [+] cells. [score:3]
As shown in Figure 3A, a significant decrease in migration toward CXCL12 (decrease in chemotaxis index) was identified in CD4 [+] T cells overexpressing miR-142-3p induced by Lv-miR-142-3p. [score:3]
Target gene identification of miR-142-3p. [score:3]
However, miR-142-3p has no effect on the expression of WASL. [score:3]
In addition, the expression of miR-142-3p after transfection is significant increased as determined by qRT-PCR. [score:3]
The results of animal trafficking experiment were summarized in Table 7. These results indicated that miR-142-3p had an inhibitory role in migration of CD4 [+] T cells both in vitro and in vivo. [score:3]
0095514.g001 Figure 1The expression of miR-142-3p in human CD4 [+] cells. [score:3]
Sequences of primers used for dual luciferase assay were summarized in Table 4. Each psiCHECK-2 construct along with vector, miR-142-3p mimics, miR-142-3p inhibitor, mimics control or inhibitor control (RIBOBIO) was transfected into HEK293T cells. [score:3]
Although in this study, we have focused on the RAC1 and ROCK2, other target genes of miR-142-3p that are related cell migration should be tested in future studies to determine whether they are related to miR-142-3p -mediated effect on CD4 [+] T cell migration. [score:3]
At 3 hours after stimulation, the expression of miR-142-3p returned to the basal level. [score:3]
After transfection with Lv-miR-142-3p or control virus (Lv-NC), both mRNAs and proteins in human CD4 [+] T cells were collected to evaluate the expression levels of these predicated target genes. [score:3]
If miR-142-3p -mediated effect on CD4 [+] T cell migration is through its target genes, RAC1 and ROCK2, the actin cytoskeleton should be affected. [score:3]
When the binding sequence in RAC1 or ROCK2 3′UTR was mutated, the regulatory effect of miR-142-3p on luciferase activity was abrogated (Figure 4D). [score:2]
When the binding sequences in RAC1 or ROCK2 3′UTR are mutated, the regulatory effect of miR-142-3p on luciferase activity is abrogated. [score:2]
0095514.g004 Figure 4(A) After transfection with Lv-miR-142-3p, mRNAs of RAC1 and ROCK2 were down regulated, while there was no statistically difference shown in WASL in human CD4 [+] T cells, detected by qRT-PCR. [score:2]
ASO, patients with ASO; Control, healthy donors; n = 8; **P<0.01 compared with the control in A and 0 time point in C. (A) The expression of miR-142-3p in CD4 [+] cells from patients with ASO (n = 8) and from healthy donors (n = 8), detected by qRT-PCR. [score:2]
The followed several reports have also revealed that miR-142-3p may play important roles in the regulation of activation and proliferation of CD4 [+] cells [3]– [5]. [score:2]
Actin cytoskeleton regulation of miR-142-3p in human CD4 [+] T cells. [score:2]
7. Actin Cytoskeleton Regulation of miR-142-3p in Human CD4 [+] T cells. [score:2]
0095514.g005 Figure 5Actin cytoskeleton regulation of miR-142-3p in human CD4 [+] T cells. [score:2]
Moreover, the binding and inhibitory effect of miR-142-3p on RAC1 and ROCK2 is further verified by the luciferase assay. [score:2]
MiR-142-3p may provide a novel molecular mechanism involved in CD4 [+] T cell migration and may represent a novel targets for preventing and treating ASO. [score:2]
Sequences of primers used for lentivirus construction were listed in Table 3. CD4 [+] T cells were transfected with either negative control lentiviral vector (Lv-NC) or lentiviral vector expressing miR-142-3p (Lv-miR-142-3p) at a multiplicity of infection of 1×10 [7] transfecting units per ml in the presence of polybrene (8 µg/ml) [8]. [score:2]
The effect of miR-142-3p on the migration of CD4 [+] T cells. [score:1]
The 3′UTR sequence of RAC1 or ROCK2 containing the putative binding sites of miR-142-3p were cloned into psiCHECK-2 vector. [score:1]
Blue fluorescent represented nuclear and red fluorescent represented miR-142-3p. [score:1]
5. The Effect of miR-142-3p on the Migration of CD4 [+] T cells. [score:1]
After lentivirus transfection, cells in Lv-miR-142-3p or Lv-control (Lv-NC) -treated groups were injected into ApoE [−/−] C57BL/6 mice. [score:1]
ASO, patients with ASO; Control, healthy donors; n = 8; **P<0.01 compared with the control in A and 0 time point in C. To test whether or not the stimulation of chemokine could affect the expression of miR-142-3p in CD4 [+] cells, CXCL12 stimulation assay was performed. [score:1]
To test this hypothesis, the effect of miR-142-3p on actin cytoskeleton in human CD4 [+] T cells was determined by actin staining. [score:1]
Forty-eight hours later, the ratio of CD4 [+] T cells in Lv-miR142-3p group was significantly lower than that in Lv-NC group in either aorta (Figure 3B) or spleen (Figure 3C), while the ratio of cells remaining in blood was higher in Lv-miR-142-3p group (Figure 3D). [score:1]
0095514.g003 Figure 3The effect of miR-142-3p on the migration of CD4 [+] T cells. [score:1]
Although the migration of CD4 [+] T cells from blood to vascular walls and within the vascular walls are prerequisite for CD4 [+] T cells to achieve its immune injury in arteries, no study has been performed to test the potential role of miR-142-3p in CD4 [+] T cell migration. [score:1]
Aorta(%) Spleen(%) Blood(%) Lv-NC group (n = 3) 2.3±0.4 3.5±0.5 8.8±1.2 Lv-miR-142-3p group (n = 3) 1.1±0.2** 2.0±0.3** 13.4±2.1** Ratio is presented as mean±SD. [score:1]
After 0, 1, 2 and 3 hours’ culture, total RNAs of cells were extracted to evaluate the expression of miR-142-3p by qRT-PCR. [score:1]
The current study is thus designed to determine the potential role of miR-142-3p in CD4 [+] T cell migration and the mechanisms involved. [score:1]
[1 to 20 of 86 sentences]
4
[+] score: 291
Other miRNAs from this paper: mmu-mir-142a
Orange boxes: common predicted targets for both isoforms; yellow boxes: predicted targets for both isoforms; green boxes: experimentally validated target of miR-142-3p; red box: experimentally validated target of miR-142-5p. [score:9]
Using genetic tools, we showed that up-regulation of Ctnnb1 signaling specifically in the mesenchyme via the induced expression of a stable form of Ctnnb1 or the deletion of a copy of Apc is sufficient to rescue miR-142-3p morpholino -mediated loss-of-function and that Apc is a critical target of this miRNA. [score:8]
Embryonic miR-142 -null lungs display increased Wnt signaling associated with up-regulation of Apc and p300We previously reported that attenuation of miR-142-3p in lung explants grown in vitro leads to impaired Wnt signaling in the mesenchyme via the up-regulation of Apc [3]. [score:7]
miR-142-3p is a target of Interleukin 6 (IL6) in glioblastoma and it has been proposed that miR-142-3p blocks the expression of IL6, Hmga2 and Sox2 thereby suppressing the stem like properties of glioblastomas [11]. [score:7]
Supporting our in-vitro results obtained with miR-142-3p during lung development [3], it was reported that miR-142-3p, which is up-regulated in human breast cancer stem cells, activates the canonical WNT signaling pathway in a APC-suppression dependent manner [12], resulting in enhanced tumorigenicity. [score:7]
E18.5 miR-142 -null lungs display increased Wnt signaling associated with the up-regulation of Apc and p300, two previously reported targets of miR-142-3p and -5p, respectively. [score:6]
A mutual inhibitory loop between p300 and miR-142-5p has also been described and under mechanical stress, p300 is accumulated in the cardiac cells, which results in the down-regulation of miR-142-5p. [score:6]
In the postnatal heart, miR-142-5p targets p300, a gene encoding a positive regulator of Wnt signaling and increased expression of miR-142-5p is associated with extensive apoptosis and cardiac dysfunction in murine heart failure mo del [15]. [score:6]
Increased Apc expression upon miR-142-3p silencing causes down-regulation of Wnt signaling [3]. [score:6]
We established that miR-142-3p positively regulates Ctnnb1 (ß-catenin) signaling during lung development by targeting Adenomatous polyposis coli (Apc) mRNA for degradation. [score:5]
The expression of Bzrap1, a gene immediately flanking miR-142, is not altered while the expression of a LncRNA embedded within the miR-142 gene is abolished. [score:5]
0136913.g007 Fig 7Predicted targets of miR-142-3p and miR-142-5p using Diana-MicroT and Target Scan software prediction tools. [score:5]
Fig 7B describes the common targets (in orange) for miR-142-3p and 5p as well as unique targets (yellow) for each isoform in regard to the Wnt pathway. [score:5]
RNA viruses can also bind miR-142-3p to suppress innate immunity promoting neurological disease manifestations [14]. [score:5]
Predicted targets of miR-142-3p and miR-142-5p using Diana-MicroT and Target Scan software prediction tools. [score:5]
Blinded quantification of the expression of the respective isoforms of miR-142 confirms the very low level of expression of both miR-142 isoforms (Fig 4I and 4J). [score:5]
Together with the recently reported conditional miR-142 KO, our mouse mo del will be the first generation of tools designed to decipher the role of miR-142 in development and disease. [score:4]
Others and we have previously reported that Apc is a direct target of miR-142-3p [3, 12]. [score:4]
Embryonic miR-142 -null lungs display increased Wnt signaling associated with up-regulation of Apc and p300. [score:4]
Beyond its proposed function in lung development, miR-142-3p is one of the highest expressed miRs in various hematopoietic lineages [5, 6]. [score:4]
We previously described that miR-142-3p is among a few miRs expressed at high level in the lung mesenchyme during early embryonic development [3]. [score:4]
LncRNAs contribute also to gene regulation [18] and in the future, the generation of new mouse mo dels allowing the tissue-specific rescue of miR142-3p/5p expression in the context of the miR-142 KO animals will allow determining the role of this LncRNA. [score:4]
miR-142-3p controls neutrophil development in zebrafish [7], orchestrates a network of actin cytoskeleton regulator during megakaryopoiesis [8] and regulates the specification of definitive hemagioblasts during organogenesis [9]. [score:4]
We previously reported that attenuation of miR-142-3p in lung explants grown in vitro leads to impaired Wnt signaling in the mesenchyme via the up-regulation of Apc [3]. [score:4]
The expression levels of Bzrap1, a gene positioned 3.5kb downstream of miR142, were unchanged in miR-142 heterozygous or null lungs compared to wild type littermates (Fig 3C), indicating that the promoter region of Bzrap1 was not impaired for the expression in the lung. [score:4]
In addition, the expression of both isoforms was completely abolished in miR-142 -null lungs (Fig 3A and 3B). [score:3]
Ctnnb1 mRNA expression is not changed between miR-142 -null and control lungs (Fig 5M). [score:3]
miR-142 deletion abolishes the expression of both miR-142-3p and miR-142-5p. [score:3]
Deletion of miR-142 successfully abrogates miR-142-3p and miR-142-5p expression. [score:3]
The target prediction and pathway intersection for miR-142-3p and miR-142-5p were performed using the software mirPath. [score:3]
miR-142 is highly expressed in hematopoietic cells belonging to both the myeloid and lymphoid lineages. [score:3]
We show that both isoforms of miR-142, the 3p and 5p, are no longer expressed in miR-142 -null mice. [score:3]
Surprisingly, our results indicate increased expression of the activated form of Ctnnb1/ß-catenin (p-S552) in the nuclei of miR-142 -null (Fig 5C and 5D) versus control (Fig 5A and 5B) lungs, suggesting increased Wnt signaling upon loss of miR-142. [score:3]
Using specific digoxygenin-labeled probes for these two microRNAs, in-situ hybridization showed that miR-142-3p and miR-142-5p are expressed in both the mesenchyme and the epithelium of the E18.5 lung (Fig 4A, 4B, 4E and 4F). [score:3]
It is therefore not surprising to find that the loss of miR-142 leads to increased expression of both Apc and p300 (Fig 5). [score:3]
A-B) qPCR analysis on cDNA obtained from E18.5 embryonic lung sample showing that both miR-142-3p and miR-142-5p are down-regulated in miR-142 [+/-] lungs and completely absent in miR-142 -null lungs as compared to WT samples. [score:3]
A) Schematic diagram showing the WT, targeted and KO alleles for the miR-142 locus. [score:3]
0136913.g003 Fig 3Deletion of miR-142 successfully abrogates miR-142-3p and miR-142-5p expression. [score:3]
S1 FigSchematic representation of mir-142 targeting vector. [score:3]
miR-142 -null mice display a wide range of hematological disorder miR-142 is highly expressed in hematopoietic cells belonging to both the myeloid and lymphoid lineages. [score:3]
In order to unveil the role of miR-142 in organogenesis, homeostasis and disease in-vivo, we generated and validated the miR-142 -null mouse. [score:3]
However, and in agreement with our previous report [3], miR-142 -null lungs display increased expression of Apc (Fig 5G and 5H vs. [score:3]
Our validation studies confirm that both miR-142-3p and miR-142-5p are no longer expressed in these mice. [score:3]
Such restricted expression pattern suggested that miR-142-3p could play critical functions in controlling cell lineage formation in the mesenchyme. [score:3]
In order to predict the potential defects observed in miR-142 -null animals, the predicted targets for miR-142-3p and 5p were characterized using Diana-MicroT and Targetscan (Fig 7A). [score:3]
Our results indicate increased expression of p300 in miR-142 -null versus wild type lungs (Fig 5K and 5L vs. [score:3]
Bzrap1: Benzodiazepine receptor (peripheral) associated protein 1. A) Schematic diagram showing the WT, targeted and KO alleles for the miR-142 locus. [score:3]
On the other hand Sharma et al. found that p300 is a target of miR-142-5p. [score:3]
Schematic representation of mir-142 targeting vector. [score:3]
Next, we investigated the expression of p300, a previously validated target of miR-142-5p [15]. [score:3]
The loss of miR-142-5p expression activates genes required for myocyte survival and function [15]. [score:3]
D) Expression of the LncRNA was completely abolished in miR-142 -null lungs. [score:3]
As Apc is a negative regulator and p300 is a positive regulator of Wnt signaling, we expect that upon deletion of miR-142, the balance between Apc and p300 will lead to either no change in Wnt signaling, an increase or a decrease in Wnt signaling. [score:3]
We also show that miR-142 -null embryonic lungs display increased Wnt signaling confirming the functional role of miR-142 during lung development. [score:2]
qPCR analysis showed that the expression of both miRNAs, miR-142-3p and miR-142-5p, was reduced in miR-142 heterozygous lungs compared to wild type lungs. [score:2]
Using an exogenous gene trap technology, Chapnik and colleagues recently reported the phenotypic analysis of miR-142 knockdown mice. [score:2]
In situ hybridization for miR-142-3p (A-D) and miR-142-5p (E-H) showing significant reduction of the corresponding expression levels in miR-142 [-/-] compared to WT E18.5 embryonic lung sections. [score:2]
Similar results were obtained with the miR-142 knockdown mice developed by Chapnik et al., using exogenous gene trap technology [8]. [score:2]
The level of expression of both microRNAs was significantly decreased in miR142 -null samples compared to WT samples (Fig 4C, 4D, 4G, 4H vs. [score:2]
miR-142-3p regulates IL6 production upon lipopolysaccharide stimulation in dendritic cells [13]. [score:2]
Using in-vitro approaches with embryonic lungs cultured in presence of morpholinos for miR-142-3p, we showed that knockdown of miR-142-3p leads to arrested proliferation and premature differentiation of smooth muscle progenitor cells. [score:2]
Genotyping Strategy for miR-142 KO allele. [score:1]
In situ hybridization on E18.5 miR-142 [-/-] embryonic lung sections. [score:1]
0136913.g004 Fig 4 In situ hybridization on E18.5 miR-142 [-/-] embryonic lung sections. [score:1]
While a significant amount of information is available for miR142-3p, our knowledge of miR-142-5p is still scarce. [score:1]
We are the first group to report the generation and validation of classical miR-142 -null mice. [score:1]
This novel, homologous recombination -based, miR-142 -null mouse line will be useful for the scientific community. [score:1]
In order to validate our mouse mo del, we performed total blood count on 8 week-old miR-142 [+/+] and miR-142 [-/-] mice (n = 3 for each genotype). [score:1]
To confirm the successful deletion of miR-142, RNA from E18.5 miR- 142 [+/+], miR-142 [+/-] and miR-142 [-/-] lungs from littermate embryos (n = 3 for each genotype) were extracted. [score:1]
Litters from miR-142 heterozygous crosses were genotyped at E12.5, E18.5 and postnatally. [score:1]
However, we did not observe the decrease in red blood cell numbers as well as the increased level of basophils and reticulocytes (data not shown) initially reported in the homozygous miR-142 gene-trap mice. [score:1]
Interestingly, the expression of this LncRNA has not been investigated in the miR-142 gene-trap line. [score:1]
We therefore used immunofluoresence to examine the status of Wnt signaling and Apc in miR-142 -null versus wild type lungs at E18.5. [score:1]
More recently, a conditional KO for miR-142 was generated by deleting 900 bp of the genomic sequence that encompasses the miR-142 precursor in the germ line [19]. [score:1]
Generation of miR-142 -null miceIn mice, the miR-142 gene (ENSMUSG00000065420) is located in chromosome 11 adjacent to the second exon of a long non-coding RNA (A430104N18Rik ENSMUSG00000084796) (Fig 1). [score:1]
In mice, the miR-142 gene (ENSMUSG00000065420) is located in chromosome 11 adjacent to the second exon of a long non-coding RNA (A430104N18Rik ENSMUSG00000084796) (Fig 1). [score:1]
Similarly to the homozygous miR-142 gene-trap mice, our miR-142 -null mice also display decreased white blood cells, decreased platelets and increased mean platelet volume. [score:1]
miR-142 KO mice display hematological abnormalities. [score:1]
The constitutive and complete deletion of the miR-142 gene was therefore carried out and miR-142 heterozygous mice were generated. [score:1]
Fig 2B shows the genotyping results of E18.5 embryos arising from crossing miR-142 heterozygous mice. [score:1]
The miR-142 -null mutant mouse line was established at the MCI/ICS (Institut Clinique de la Souris, iCS, Infrastructure Nationale PHENOMIN, 1 rue Laurent Fries, 67404 IIIkrich, France). [score:1]
In addition, individual monitoring and genotyping of all the neonates born from different litters up to 4 months of age indicate a normal representation of miR-142 -null mice (20% of the overall postnatal mice (n = 79)). [score:1]
A miR-142 gene-trap allele was recently created by insertion of an exogenous gene trap sequence 50 bp upstream of the murine pre- miR-142 [8]. [score:1]
Generation of miR-142 -null mice. [score:1]
Our results indicate a significant decrease in the number of white blood cells, lymphocytes, eosinophils, monocytes and platelets in miR-142 -null vs. [score:1]
0136913.g002 Fig 2Genotyping Strategy for miR-142 KO allele. [score:1]
Another aspect related to the reported miR-142 -null mouse is the deletion of the LncRNA together with the miR-142 gene. [score:1]
The miR-142 locus also contains many GC-rich repeat regions, which render PCR amplification and screening difficult. [score:1]
Slides were blocked twice for 5 min with Dako (DAB Emission +Dual Linksystem HRP, Life Technologies) and then incubated with digoxygenin labeled LNA probes (Exiqon, miRCURY LNA Detection probe, Vedback, Denmark) specific for miR142-3p and miR142-5p. [score:1]
Benzodiazepine receptor (peripheral) associated protein 1 (Bzrap1, ENSMUSG00000034156) is also another gene found downstream of miR-142. [score:1]
Increased levels of miR-142-3p in the serum are associated with recurrence of adenocarcinoma in humans [10]. [score:1]
The authors reported that miR-142 -null mice are born at the expected Men delian ratio and appear healthy and fertile with no apparent internal organ defects, similarly to the findings described in this report. [score:1]
In the process of deleting miR-142, one exon for the LncRNA, close to miR-142, was also deleted. [score:1]
They also described a highly penetrant splenomegaly that is also observed in our miR142 -null mice (data not shown). [score:1]
As expected, exon 2 of the LncRNA, which is located within the deleted region of miR142, was not detected in both miR-142 heterozygous and null embryos (Fig 3D). [score:1]
miR-142 -null pups are born alive and do not display obvious abnormalities. [score:1]
The respective increase in Apc and p300 in miR-142 -null lungs was also validated at the mRNA level (Fig 5N and 5O). [score:1]
Adult miR-142 -null animals are viable and display impaired hematopoietic lineage formation. [score:1]
miR-142 -null pups are born alive and are normally represented indicating absence of embryonic lethality. [score:1]
Peripheral blood cell count in 8 week old miR-142 [-/-] mice (n = 3) showing a significant decrease in circulating white blood cells (B), lymphocytes (C), platelets (D), eosinophils (E) and monocytes (G) in addition to an increase in mean platelet volume (F). [score:1]
As the miR-142 conventional KO leads to the deletion of both miR-142-3p and miR-142-5p, it might be challenging to tease out the activity of each isoform. [score:1]
5 miR-142 -null lungs. [score:1]
miR-142 gene is located in the vicinity of an exon belonging to a LncRNA (A430104N18Rik ENSMUSG00000084796) on chromosome 11. [score:1]
In the Mfd diagnostics facility, about 250 μL of whole blood was retro-orbitally drawn from 8 weeks-old sex-matched miR-142 -null and wild type littermates into glass capillary tubes containing 5 μL of 0.5 M EDTA, to prevent coagulation. [score:1]
In this paper, we report the generation and validation of a miR-142 -null mouse line that will be useful for the scientific community working on miR-142. [score:1]
miR-142 -null mice display a wide range of hematological disorder. [score:1]
Another important conclusion from these data is that miR-142 -null embryos are not dying in utero. [score:1]
In the miR-142 -null group, only one 4 month-old mouse died while three animals died in the miR-142 heterozygous group between the ages of 3 and 4 months. [score:1]
Schematic Representation of the miR-142 locus in the mouse genome. [score:1]
0136913.g006 Fig 6 miR-142 KO mice display hematological abnormalities. [score:1]
B-C) PCR analysis of the genomic DNA obtained from the embryos at E18.5 from miR-142 [+/-] male and female intercrossing. [score:1]
In conclusion, we report the generation and validation of a novel homologous recombination -based miR-142 KO mouse mo del. [score:1]
0136913.g001 Fig 1Schematic Representation of the miR-142 locus in the mouse genome. [score:1]
miR-142 -null mouse line establishment. [score:1]
miR-142 -null pups are born alive and do not display obvious abnormalitiesLitters from miR-142 heterozygous crosses were genotyped at E12.5, E18.5 and postnatally. [score:1]
miR-142 -null mouse line establishmentThe miR-142 -null mutant mouse line was established at the MCI/ICS (Institut Clinique de la Souris, iCS, Infrastructure Nationale PHENOMIN, 1 rue Laurent Fries, 67404 IIIkrich, France). [score:1]
Deletion of miR-142 led to the deletion of the LncRNA exon as well as part of the 5’ UTR of Bzrap1. [score:1]
miR-142 -null adult mice display various hematological abnormalities such as decreased platelet and white blood cell count and increased mean platelet volume indicating that these mice suffer from thrombocytopenia. [score:1]
Overall, our data indicate very low death rate in the miR-142 -null group postnatally. [score:1]
[1 to 20 of 119 sentences]
5
[+] score: 258
qRT-PCR and analysis showed that Ulk1 expression levels were all down-regulated reciprocally with miR-142-5p in the primary cortical neurons after PHEV treatment, and that Ulk1 mRNA expression was nearly 1.2-fold lower compared to the expression in normal neurons within 60 hpi (Figure 4B). [score:9]
In the current study, we discovered that the upregulation of miR-142-5p (Accession number: MIMAT0000154) severely stunted neuronal morphogenesis during PHEV infection by targeting the unc-51-like-kinase1 (Ulk1, NCBI Reference Sequence: NM_009469.3) mRNA 3′ untranslated region (3′UTR), which suggested that PHEV largely exploited spatiotemporal control of host microRNAs for neurological disorders. [score:8]
Taken together, these data indicated that miR-142-5p inhibited Ulk1 expression by binding to a single site present in the Ulk1 mRNA 3′UTR, and Ulk1 was a nerve injury associated mRNA down-regulated by miR-142-5p in PHE. [score:8]
To substantiate this hypothesis, miR-142-5p inhibitors were used to promoting Ulk1 expression in PHEV-infected neurons (Figure 7B), and we found that miR-142-5p inhibitors efficiently rescued the shortened axon elongations caused by loss function of Ulk1 (Figure 7C). [score:7]
Potential targets of miR-142-5p were predicted using the microRNA target prediction databases, including TargetScan, miRBase, and and miRwalk. [score:7]
Moreover, analysis of Ulk1 expression in lysates from miR-142-5p mimics transfected primary cortical neurons showed a dose -dependent decrease in the level of endogenous Ulk1 protein, whereas delivery of its inhibitor led to an increase in protein expression (Figure 5D). [score:7]
The effectiveness and specificity of the antagomir in inhibiting endogenous miR-142-5p expression and enhancing Ulk1 expression has been demonstrated in mice (Figure 9A). [score:7]
miR-142-5p expression was time -dependently upregulated in response to PHEV infection in mice (Figure 1A), consistent with the microarray analysis. [score:6]
Thus, we concluded that Ulk1 mRNA is a downstream element of miR-142-5p in the regulation of axon outgrowth, and that inhibiting miR-142-5p expression in neurons should be able to improve the axon defect caused by PHEV. [score:6]
These data suggest that miR-142-5p RNA expression was significantly up-regulated in neurons infected with PHEV. [score:6]
Of the up-regulated microRNAs, miR-142-5p, the expression of which increased over 5-fold, was selected for confirmation by quantitative real-time polymerase chain reaction (qRT-PCR). [score:6]
The effect of miR-142-5p on translation of the luciferase mRNA was dependent on the presence of the miR-142-5p cognate binding site within the 3′UTR, and expression of a luciferase reporter containing the mutant-type Ulk1 3'UTR was unaffected by the presence of exogenous miR-142-5p (Figure 5B, white bars). [score:5]
Representative images showed that both control neurons and inhibitor -transfected neurons (Figure 3B) mostly grew with two main axons that extended over a long distance, but significantly decreased axon elongation in neurons was detected when miR-142-5p was overexpressed (Figure 3B, lower panels). [score:5]
qRT-PCR showed that endogenous miR-142-5p was specially inhibited by antagomirs, and that Ulk1 expression was significantly enhanced. [score:5]
miR-142-5p inhibitors restricted PHEV replication In vitroTo achieve efficient overexpression of exogenous miR-142-5p, microRNA mimics were transfected into primary cortical neurons. [score:5]
In contrast, miR-142-5p inhibitors led to a statistically increased expression of wild-type Ulk1 3'UTR reporter (Figure 5C, black bars), but less effect on the mutant one (Figure 5C, white bars). [score:5]
Transfection with miR-142-5p mimics in neurons specifically decreased the activity of a luciferase reporter gene fused to the wild-type Ulk1 3′UTR, whereas overexpression of the unrelated miR-21a-5p microRNA had no significant effect on the expression of this reporter construct (Figure 5B, black bars). [score:5]
mir-142-5p inhibited translation of Ulk1 mRNA. [score:5]
Alternatively, miR-142-5p function was suppressed by transfecting a microRNA inhibitor that interfered with endogenous miR-142-5p activity in a sequence-specific manner (Hutvagner et al., 2004). [score:5]
Taken together, Ulk1 plays a key role in the branched dendrite outgrowth and dendritic spine formation, and Ulk1 down-regulation by miR-142-5p is responsible for the nerve damage caused by PHEV. [score:4]
To gain insight into the mechanisms by which miR-142-5p regulates axon morphology during PHEV infection, we sought to identify miR-142-5p target mRNAs. [score:4]
These findings suggested that miR-142-5p overexpression negatively affect cortical neuron development and morphogenesis. [score:4]
Figure 5 miR-142-5p negatively regulated Ulk1 expression. [score:4]
Expression analysis also supported a role for miR-142-5p in the early stages of neuronal development and neurite formation. [score:4]
We concluded that miR-142-5p acted as a negative regulator of axon elongation in primary cortical neurons and was involved in the regulation of axon development and/or functional responses to PHEV. [score:4]
All transfection efficiency was first tested in neurons, and we found that 100 nM of the mimics greatly enhanced exogenous miR-142-5p expression (Figure 2A), whereas 200 nM of the inhibitors led to a statistically significant decrease compared to the negative group (Figure 2B). [score:4]
Figure 1Validation of miR-142-5p expression in vivo and in vitro. [score:3]
For example, Trobaugh et al. (2014) noted that the North American eastern equine encephalitis virus (EEEV) adapts to use the antiviral properties of vertebrate miR-142-3p to limit replication in particular cell types, a restriction that can lead to exacerbation of disease severity. [score:3]
Luciferase activity was detected 48 h after the co-transfection of the luciferase construct (with either wild-type or mutant-type miR-142-5p binding sites), the miR mimics/inhibitors or control (RiboBio, Guangzhou, China), and a Renilla luciferase vector in HEK293T cells. [score:3]
Therefore, we hypothesized that Ulk1 mRNA was a putative miR-142-5p target gene and may be involved in PHEV -induced neuronal damage. [score:3]
Meanwhile, PHEV-infected primary cortical neurons also induced a significant increase in miR-142-5p RNA expression (Figure 1B). [score:3]
To achieve efficient overexpression of exogenous miR-142-5p, microRNA mimics were transfected into primary cortical neurons. [score:3]
Algorithms predicted target mRNAs for the miR-142-5p. [score:3]
But, Ad5-Ulk1 and miR-142-5p inhibitor treatments made less significance. [score:3]
Figure 2 Impact of miR-142-5p mimics and inhibitors on PHEV replication. [score:3]
Neurons transfected with miR-142-5p inhibitors had similar morphologies as normal neurons. [score:3]
miR-142-5p inhibitors restricted PHEV replication In vitro. [score:3]
Figure 7 Enhanced Ulk1 by miR-142-5p inhibitors rescued axon elongation. [score:3]
miR-142-5p expression was induced in response to PHEV infection. [score:3]
miR-142-5p expression normalized to U6 was examined, and the data are presented as the means ± SEM (n = 6). [score:3]
We performed deep sequencing and bioinformatics analyses, demonstrating that miR-142-5p could target the Ulk1 mRNA 3′UTR in vitro and in vivo. [score:3]
These data indicated that miR-142-5p inhibitors contribute to PHEV replication restriction. [score:3]
We used an in situ hybridization (ISH) protocol to examine the localization of miR-142-5p RNA and found widespread expression of microRNAs in the cerebral cortexes of the mice, especially near the prefrontal cortex and hippocampus (Figure 1C). [score:3]
Co -expression of miR-142-5p and Ulk1 was found in the neurite shifts and/or growth cones with a prominent signal in primary neurons (Figure 7A), which provided evidence for miR-142-5p -mediated Ulk1 repression as a possible explanation for the reduction in axonal elongation. [score:3]
Of these microRNAs identified by microarray (data was not published), we found that miR-142-5p expression was strongly induced by PHEV over 8-fold at 5 dpi, and that altering miR-142-5p activity resulted in disordered neuronal morphogenesis in primary cortical neurons. [score:3]
In this paper, we found that miR-142-5p disrupts neuronal morphogenesis underlying PHEV infection by targeting Ulk1, whether the molecular mechanism is associated with endocytosis is still unknown. [score:3]
For both gain-of-function and loss-of-function study, 5~100 nM miR-142-5p mimics or 50~200 nM inhibitors were transfected into neurons using X-tremeGENE HP DNA Transfection Reagent (Roche, Sweden), and these oligonucleotides were designed as follows: mimic sense primer, 5′CAUAAAGUAGAAAGCACUACU3′; mimic anti-sense primer, 3′ GTAUUUCAUCUUUCGUGAUGA5′; inhibitor oligonucleotides, 5′mAmGmUmAmGmUmGmCmUmUmUmCmUmAmCmUmUmUmAmTmG3′. [score:3]
Therefore, we attempted to explore the mechanism of nervous system dysfunction caused by PHEV from the perspective of the host's differentially expressed microRNA miR-142-5p. [score:3]
Figure 3 miR-142-5p negatively regulated axon elongation in cortical neurons. [score:2]
The presence of miR-142-5p in axons suggested that this microRNA might be involved in the regulation of embryonic cortical neuron morphology in response to PHEV in vivo and in vitro. [score:2]
To further confirm the regulation of Ulk1 by miR-142-5p, the luciferase pmirGLO reporter (Promega, Madison, USA) was constructed and then confirmed by sequencing. [score:2]
Further characterization of the downstream mRNAs targeted by miR-142-5p showed that Ulk1, a serine/threonine kinase, is one of the prospective PHEV-regulated mRNAs that are relevant to nerve dysfunction. [score:2]
Compared with only PHEV infection group, miR-142-5p antagomir treatment significantly induced ulk1 protein expression in PHEV-infected or healthy mice at 6 dpi (Figure 9B). [score:2]
Mutation of the miR-142-5p binding site was achieved using the Multisite-Quickchange kit (Stratagene, USA) according to the manufacturer's protocol. [score:2]
Our data demonstrated that functional mRNA repression by miR-142-5p is an important mechanism for abnormal neuronal development in primary cortical neurons during PHEV infection, and that Ulk1 are required for axonal elongation and plasticity. [score:2]
Sequence of the mmu MUT-Ulk1 3'UTR containing mutations (blue) in the miR-142-5p binding site was listed below. [score:2]
mir-142-5p regulated neuron morphology. [score:2]
The survival times of the antagomir -treated mice were significantly extended compared to PHEV-infected or control -treated mice (Figure 9C), and they exhibited less prodrome (ruffled fur, hunched posture and standing walk), likely due to the lower miR-142-5p expression in the brain. [score:2]
For the binding assays, the following RNA and DNA oligonucleotides (Sigma-Aldrich, Madrid, Spain) were designed and used: miR-142, an RNA sequence corresponding to the mature form of miR-142-5p; Ulk1-UTR, a 23-mer RNA sequence for the 3′UTR corresponding to Ulk1 with the target site for miR-142-5p; anti-miR-142, a modified antisense oligodeoxynucleotide complementary to the sequence of the mature form of miR-142-5p; and anti-miR-142MIS, an antisense oligodeoxynucleotide containing 11 mismatches compared to anti-miR-142. [score:1]
miR-142-5p antagomir blocked PHEV proliferation In vivoTo determine if miR-142-5p functions in PHEV infection, miR-142-5p antagomirs, also known as anti-miRs or blockmirs are a class of chemically engineered and modified oligonucleotides that prevent other molecules from binding to a desired site on an mRNA molecule, was injected into the cerebral cortex of infected mice with a stereotaxic apparatus to silence endogenous microRNA. [score:1]
Lower panel: Sequence conservation of miR-142-5p binding site within Ulk1 3'UTR of mouse (mmu), rat (rno), pig (ssc), and human (hsa). [score:1]
Further investigation determined that Ulk1 level was inhibited in vivo after the miR-142-5p antagomir was injected into the brains of mice with a stereotaxic apparatus (Figure 9A, left panel). [score:1]
miR-142-5p -mediated Ulk1 repression controls dendritic formation underlying PHEV infection. [score:1]
Of these microRNAs identified by microarray, we found that miR-142-5p was highly induced after PHEV infection. [score:1]
At 24 h after PHEV infection, the inoculated mice were anesthetized with 3.5% chloral hydrate (1.0 mL/100 g; Sigma, USA), and 10 nmoL miR-142-5p antagomirs or negative control antagomirs were then positioned in the cerebral cortex with a stereotaxic apparatus (David Kopf Instruments, Tujunga, CA, U. S. A) using previously described methods (Kirby et al., 2012; Wu et al., 2012). [score:1]
Thus, we proposed that miR-142-5p -mediated Ulk1 repression might lead to a breakthrough in the understanding of the mechanism of neurological dysfunction induced by PHEV. [score:1]
Hybridization with the miR-142-5p-specific probe in primary cortical neurons revealed that miR-142-5p localization occurred in a punctuate pattern along the axon shaft and within dendrite protrusions, especially at branching points (Figure 1D). [score:1]
miR-142-5p antagomir blocked PHEV proliferation In vivo. [score:1]
Lane 1 represented the binding and competition between miR-142-5p and the Ulk1 3'UTR. [score:1]
Thus, we proposed that miR-142-5p -mediated Ulk1 repression acted locally at individual neutrites and/or intracellular membranous structures, which contributed to NGF signaling and transsynaptic communication of the neurotropic virus mainly via the vesicle -mediated secretory pathway. [score:1]
Also, the signal intensities confirmed significantly higher levels of the miR-142-5p in PHEV-infected neurons (Figure 1E). [score:1]
Moreover, the co-localization of miR-142-5p and PHEV within neurites suggested that there is a possible functional role for this microRNA in PHEV -induced nerve cell injury. [score:1]
The y-axis is the average miR-142-5p intensity using arbitrary fluorescence unit (AFU), ** P < 0.01. [score:1]
Figure 9 miR-142-5p antagomir blocked PHEV proliferation in mice. [score:1]
miR-142-5p -mediated Ulk1 repression controls axon elongation underlying PHEV infection. [score:1]
Some co-localization was observed in the axon and dendrite through two-color immunofluorescence staining of both miR-142-5p and PHEV (Figure 1F). [score:1]
After transfection of miR-142-5p mimics, the neurons showed monstrous morphology that was similar to virus-infected neurons at the same stage (Figure 8C). [score:1]
Nevertheless, even if miR-142-5p might control translation of nerve injury associated mRNAs in PHE have yet to be investigated. [score:1]
Among these mRNAs, Ulk1 was of particular interest and was found to contain conserved 3'UTR sequence elements that were partially complementary to mouse miR-142-5p. [score:1]
Thus, we presume that miR-142-5p antagonism is a potential novel strategy for PHEV therapeutic, which supported by antagonizing miR-142-5p resulted in PHEV replication restriction and prolonged survival times in PHEV-infected mice. [score:1]
Furthermore, co-localization of miR-142-5p and Ulk1 along axon shafts and/or within growth cones supported the functional involvement of these structures in modulating the neuron morphogenesis response to PHE. [score:1]
To determine if miR-142-5p functions in PHEV infection, miR-142-5p antagomirs, also known as anti-miRs or blockmirs are a class of chemically engineered and modified oligonucleotides that prevent other molecules from binding to a desired site on an mRNA molecule, was injected into the cerebral cortex of infected mice with a stereotaxic apparatus to silence endogenous microRNA. [score:1]
How might miR-142-5p molecules exert their functions? [score:1]
Taken together, these results suggested a potential role for the miR-142-5p antagomir in blocking PHEV neurovirulence in the host, which prolonged the survival times and decreased the prodromal signs. [score:1]
Consequently, we concluded that the abundance of miR-142-5p could repress Ulk1 mRNA, resulting in limited synthesis of new Ulk1 protein and restricted neuronal morphogenesis in underlying PHEV infection. [score:1]
[1 to 20 of 85 sentences]
6
[+] score: 257
Since DNA methylation has been found to be both upregulated 30– 33 and downregulated 34– 36; in a number of cancer types including PDAC, we reasoned that dysregulated methylation may be responsible for the observed changes in miR-142-3p expression. [score:10]
Error bars represent the standard deviation Low miR-142-3p expression and high DNMT1 expression correlate with poor survival in human cancersThe data we present here identify a novel mechanism by which mutant p53 [R172H] is able to decrease expression of miR-142-3p in a mouse mo del of PDAC, through genomic hypermethylation due to increased expression of DNMT1. [score:9]
Statistical significance is represented as * p < 0.05 The miR-142 genomic locus is hypermethylated in mutant p53 [R172H] -expressing primary cell linesAs direct depletion of Dnmt1 and a methylation-inhibiting drug were both shown to induce miR-142-3p expression, direct analysis of CpG dinucleotides in the miR-142 genomic locus was carried out. [score:9]
Statistical significance is represented as * p < 0.05 and *** p < 0.005. c A representative western blot showing the expression of Dnmt1, Pten, p53 and β -actin in the primary cell lines As we observed an inverse correlation between miR-142-3p and Dnmt1 expression, we asked if inhibiting DNA methylation had an impact on miR-142-3p expression levels. [score:9]
Murine primary pancreatic tumour tissues and primary cell lines, as well as ectopic expression of human mutant p53 [R175H] in TP53 null cells, all showed that miR-142-3p is downregulated in mutant p53 [R172H] or p53 [R175H] -expressing PDAC. [score:8]
Statistical significance is represented as * p < 0.05 As direct depletion of Dnmt1 and a methylation-inhibiting drug were both shown to induce miR-142-3p expression, direct analysis of CpG dinucleotides in the miR-142 genomic locus was carried out. [score:7]
These findings are very much in line with our data which show that Dnmt1 inhibition increases miR-142-3p expression and that increasing miR-142-3p expression reduces the invasive potential of tumour cells. [score:7]
As 5-aza-DC is a functional inhibitor of all members of the DNMT family [38], we asked if specific inhibition of Dnmt1 was also able to affect miR-142-3p expression. [score:7]
This suggests that miR-142-3p and miR-340-5p expression is directly affected by mutant p53 [R172H] expression. [score:6]
RT-qPCR validation confirmed that the expression of miR-142-3p and miR-340-5p does not differ between the two control conditions (Kras p53 [flox] and Kras Pten [flox]), but both miRNAs are significantly downregulated in the Kras p53 [R172H] tissues (Fig.   1c). [score:6]
A recent study found that miR-142-3p is downregulated in human PDAC when compared to paired adjacent normal tissue and in pancreatic cancer cell lines, and showed that hypoxia-inducible factor (HIF1α) is a direct target of miR-142-3p in PDAC [29]. [score:6]
As there is no wild-type p53 expressed in these cells for the mutant p53 [R175H] to act upon in a dominant -negative manner, this strongly suggests that miR-142-3p is being downregulated due to the gain-of-function activity of this mutant. [score:6]
These results taken together with our findings identify both direct and downstream secondary targets by which miR-142-3p functions in human patients and link its expression to invasion and metastasis. [score:6]
Ectopic expression of mutant p53 [R175H] led to a downregulation of miR-142-3p, which confirmed our results for the mouse protein. [score:6]
Dnmt1 is dysregulated by mutant p53 [R172H] in PDACOur investigations of the PDAC mo dels did not uncover any global changes in mature miRNA expression, so we focused on regulatory mechanisms pertaining to the specific dysregulation of miR-142-3p expression. [score:6]
Zhang Y Lui Y Xu X Upregulation of miR-142-3p improves drug sensitivity of acute myelogenous leukemia through reducing P-glycoprotein and repressing autophagy by targeting HMGB1Transl. [score:6]
RT-qPCR of the cells lines showed that expression of miR-142-3p follows the profile observed in the tissue samples, with no difference between the control conditions (Kras p53 [flox] and Kras p53 [R172H]) and a significant downregulation in the mutant Kras p53 [R172H] cells (Fig.   2b). [score:6]
Previous findings of the impact of miR-142-3p on tumour progression along with the data presented in this study, linking mutant p53 [R172H] and DNMT1 expression, suggest that DNMT1 may be a potential therapeutic target in PDAC. [score:5]
A two-tailed Mann–Whitney U-test was used to assess for statistically significant differences between the two bisulphite sequencing groups Overexpression of miR-142-3p inhibits p53 [R172H] -driven invasion in vitroGiven that mutant p53 [R172H] has been shown to drive invasion and metastasis in PDAC [6], we investigated the impact of overexpression of miR-142-3p on cell invasion. [score:5]
Error bars represent the standard deviation The data we present here identify a novel mechanism by which mutant p53 [R172H] is able to decrease expression of miR-142-3p in a mouse mo del of PDAC, through genomic hypermethylation due to increased expression of DNMT1. [score:5]
Here we show that mutant p53 [R172H] inhibits expression of miR-142-3p, a microRNA known to drive invasion and metastasis in PDAC [29]. [score:5]
Additionally, two recent studies have shown that increasing miR-142-3p expression in acute myelogenous leukaemia [41] and non-small cell lung cancer [42] improves chemosensitivity by decreasing autophagy due to translational repression of HMGB1. [score:5]
All data sets which show a statistically significant correlation are reported, all of which show a correlation between high DNMT1 expression and poor patient survival a The data set in the YM500v3 database shows a clear correlation between low miR-142-3p expression and poor survival in human PDAC. [score:5]
Statistical significance is represented as * p < 0.05 Our investigations of the PDAC mo dels did not uncover any global changes in mature miRNA expression, so we focused on regulatory mechanisms pertaining to the specific dysregulation of miR-142-3p expression. [score:5]
miR-142-3p overexpression inhibits mutant p53 -driven invasion in vitro. [score:5]
The data presented in this study identifies a potential new mechanism by which mutant p53 [R172H] is able to affect gene expression in a gain-of-function manner, through increased expression of DNMT1 which in turn leads to hypermethylation of miR-142-3p and perhaps other genes. [score:5]
Low miR-142-3p expression and high DNMT1 expression correlate with poor survival in human cancers. [score:5]
Overexpression of miR-142-3p inhibits p53 [R172H] -driven invasion in vitro. [score:5]
MiR-142-3p expression can be rescued by inhibition of methylation. [score:4]
However, the previously published data does not connect dysregulation of miR-142-3p to gain-of-function mutations in TP53 nor does it identify a mechanism by which miR-142-3p is dysregulated. [score:4]
Mackenzie TN Triptolide induces the expression of miR-142-3p: a negative regulator of heat shock protein 70 and pancreatic cancer cell proliferationMol. [score:4]
Chen Y Zhou X Qiao J Bao A MiR-142-3p overexpression increases chemo-sensitivity of NSCLC by inhibiting HMGB1 -mediated autophagyCell Physiol. [score:4]
Statistical significance is represented as * p < 0.05. c The average change in miR-142-3p expression in cells transfected with the miR-142-3p expression vector compared to cells transfected with empty vector. [score:4]
Therefore, we wished to determine whether miR-142-3p or DNMT1 expression correlates with human patient survival. [score:3]
The YM500v3 database was interrogated to see how miR-142-3p expression correlated with human patient survival. [score:3]
a The data set in the YM500v3 database shows a clear correlation between low miR-142-3p expression and poor survival in human PDAC. [score:3]
Meanwhile, low expression of miR-142-3p correlated with an increased incidence in lymphatic metastasis. [score:3]
As in the case of 5-aza-DC treatment, expression of miR-142-3p was significantly increased following depletion of Dnmt1 in the Kras p53 [R172H] cell line (Fig.   5a, b). [score:3]
Conditions with overexpression of miR-142-3p included a preceding day, where cells were transfected with either an empty vector or one containing the miR-142 primary microRNA sequence. [score:3]
Kras p53 [flox] (n = 2), Kras p53 [R172H] + empty vector (n = 4) and Kras p53 [R172H] + miR-142 expression vector (n = 4) mouse primary PDAC cells were analysed for their invasive potential. [score:3]
In addition, these data show that the human orthologue of the TP53 mutant is also able to affect the expression of miR-142-3p. [score:3]
Statistical significance is represented as * p < 0.05, ** p < 0.01 and *** p < 0.005 Table 1 ▓▓▓▓ microRNA FDR FC Pten [flox] vs p53 [R172H] FC p53 [flox] vs p53 [R172H] mmu-miR-142-3p 0.015912686 −3.7405517 −4.579501 mmu-miR-30c-2-3p 0.046220515 −15.577352 −10.701015 mmu-miR-340-5p 0.03768438 −1.9938585 −2.1791608 mmu-miR-378b 0.04617887 −2.1360645 −1.9538167 This analysis provides information about miRNA expression changes in the physiological context of the primary tumour environment in mouse mo dels. [score:3]
Statistical significance is represented as * p < 0.05, ** p < 0.01 and *** p < 0.005 Table 1 ▓▓▓▓ microRNA FDR FC Pten [flox] vs p53 [R172H] FC p53 [flox] vs p53 [R172H] mmu-miR-142-3p 0.015912686 −3.7405517 −4.579501 mmu-miR-30c-2-3p 0.046220515 −15.577352 −10.701015 mmu-miR-340-5p 0.03768438 −1.9938585 −2.1791608 mmu-miR-378b 0.04617887 −2.1360645 −1.9538167This analysis provides information about miRNA expression changes in the physiological context of the primary tumour environment in mouse mo dels. [score:3]
This revealed a strong correlation between poor survival and low miR-142-3p expression in human PDAC (Fig.   8a). [score:3]
The miR-142 genomic locus is hypermethylated in mutant p53 [R172H] -expressing primary cell lines. [score:3]
Importantly, overexpression of miR-142-3p in the Kras p53 [R172H] cells leads to a significant reduction in the invasive potential of these cells in vitro (Fig.   7a–c). [score:3]
A two-sample, two-tailed, paired t-test was used to compare the average percentage of invasion between biological repeats (n = 4) for Kras p53 [R172H] + empty vector and Kras p53 [R172H] + miR-142-3p expression vector. [score:3]
Importantly, we show that both DNMT1 and miR-142-3p expression correlate with patient survival, which may provide opportunities for therapeutic intervention. [score:3]
Methyl primer Express software (Applied Biosystems) was used to interrogate a sequence of DNA 700 bp both up and downstream of the miR-142 precursor sequence. [score:2]
Lu Y MiR-142 modulates human pancreatic cancer proliferation and invasion by targeting hypoxia-inducible factor 1 (HIF-1α) in the tumor microenvironmentsBiol. [score:2]
A CpG island which overlaps the miR-142 genomic locus was identified using Methyl Primer Express software (Applied Biosystems, Waltham, MA, USA) (Fig.   6). [score:2]
The other miRNAs under investigation showed mild to no change in expression following Dnmt1 depletion, demonstrating selectivity for miR-142-3p. [score:1]
Fig. 8Low miR-142-3p and high DNMT1 correlate with a poor prognosis in human PDAC. [score:1]
Treatment of the Kras p53 [R172H] cell line for 24 h with 1 μM of 5-aza-DC led to a significant induction of miR-142-3p while having no effect on the expression of other miRNAs investigated in this study (Fig.   4). [score:1]
Using the definition of a CpG island as a sequence with a CpG observed/expected ratio >0.6, a 590 bp CpG island was observed overlapping the miR-142-3p precursor sequence. [score:1]
Low miR-142-3p and high DNMT1 correlate with a poor prognosis in human PDAC. [score:1]
A total of four miRNAs, miR-142-3p, miR-30c-2-3p, miR-340-5p and miR-378b, were found to be dysregulated in the Kras p53 [R172H] tissues compared to both the Kras p53 [flox] and Kras Pten [flox] tissues. [score:1]
Triptolide has been shown to be efficacious in treatment of PDAC through induction of miR-142-3p [56]. [score:1]
A two-tailed Mann–Whitney U-test was used to assess for statistically significant differences between the two bisulphite sequencing groups Given that mutant p53 [R172H] has been shown to drive invasion and metastasis in PDAC [6], we investigated the impact of overexpression of miR-142-3p on cell invasion. [score:1]
It is possible that the same mechanism is inducing Dnmt1 transcription in this PDAC mo del, leading to subsequent hypermethylation of miR-142-3p. [score:1]
Transfected cells not used for the invasion assay were used to quantify the degree of miR-142-3p overexpression using Taqman assays. [score:1]
We show that this occurs through a DNMT1 -dependent mechanism leading to increased genomic methylation around the miR-142-3p genomic locus. [score:1]
[1 to 20 of 62 sentences]
7
[+] score: 248
In our study, we developed a new strategy for tTreg efficiency based on miR-142-3p—ATG16L1—FoxP3 axis that revealed: (1) whereas FoxP3 expression remained stable the anti-apoptosis genes (Mcl-1, c-myc) and pro-apoptosis genes (BAX, BID) changed such that tTreg showed more apoptosis status with weaker proliferative ability; (2) miR-142-3p directly targets ATG16L1 mRNA, and in human tTreg cells miR-142-3p negatively regulates an ATG16L1 -mediated autophagy effect; (3) knock-down of miR-142-3p upregulates ATG16L1 expression, and these tTreg cells showed higher FoxP3 expression and suppressive function than control tTreg cells; (4) knock-down of miR-142-3p prolonged tTreg survival associated with increased anti-apoptosis and decreased pro-apoptosis gene expression; (5) tTreg cells with attenuated miR-142-3p expression demonstrated better protective effects in a xenogeneic mo del of GVHD. [score:22]
Knock-down of miR-142-3p in ex vivo expanded tTregs upregulated ATG16L1 expression and such tTreg cells showed stronger FoxP3 expression and suppressive function in vitro. [score:11]
FOXP3 drives miR-142-3p expression in Treg cells and downregulation of miR-142-3p confers heightened Treg suppressor function by increasing the levels of AC9 and cAMP; thus, miR-142-3p might represent a “negative function biomarker” in Tregs [35]. [score:8]
We show that miR-142-3p regulates these tTreg function by targeting autophagy through ATG16L1 mRNA downregulation, and conversely that miR-142-3p knockdown improves tTreg survival and function as assessed both in vitro and vivo. [score:8]
ATG16L1 is a direct target of miR-142-3p and knock-down of miR-142b-3p increased ATG16L1 expression in human tTreg cells. [score:7]
Based on our previous studies in which we compared miRNA expression profiles between ex vivo expanded tTreg and conventional T cells, we identified the top ten differentially expressed miRNAs, of which miR-142-3p was the second mostly highly upregulated in tTregs vs T cells [17]. [score:7]
Guo F microRNA-142-3p inhibits apoptosis and inflammation induced by bleomycin through down-regulation of Cox-2 in MLE-12 cellsBraz. [score:6]
Interestingly, we did not see that treatment with a miR-142-3p agomir decreased FoxP3 expression, which may indicate that endogenous miR-142-3p are sufficient to achieve maximal downregulation. [score:6]
Zhang Y Liu Y Xu X Upregulation of miR-142-3p improves drug sensitivity of acute myelogenous leukemia through reducing P-glycoprotein and repressing autophagy by targeting HMGB1Transl. [score:6]
Thus, we tested ATG16L1 gene, which is a potential target of miR-142-3p and regulates FOXP3 expression in tTreg cells. [score:6]
As a target of miR-142-3p, knock-down of this miRNA results in enhanced ATG16L1, leading to augmented autophagy, better suppressive function in vitro and superior tTreg mediated protection of GVHD lethality after in vivo adoptive tTreg cell transfer. [score:6]
tTreg cells treated with miR-142b-3p antagomir show enhanced autophagy status, FoxP3 expression, with suppressive function. [score:5]
Interestingly, some studies confirm that miR-142-3p inhibits cell proliferation and induces apoptosis 38– 40, while others demonstrate that miR-142-3p promotes proliferation but is irrelevant in the apoptosis process [41] and even inhibits apoptosis 42, 43. [score:5]
As suggested in Fig.   2b, expanding tTregs increased miR-142-3p expression, which might be related to attenuated ATG16L1 expression. [score:5]
Both miR-142-3p/ATG16L1 genetic variations are associated with inflammatory bowel diseases (IBD) [25], next we tried to find if ATG16L1 expression is associated with miR-142-3p level in tTreg cells. [score:5]
Although previous studies suggest that miR-142-3p restricts cAMP production Treg cells by targeting AC9 mRNA, it does provide insights as to how miR-142-3p affects Treg function and whether regulation of miR-142-3p would improve the therapeutic potential of Treg adoptive cell therapy 34, 35. [score:4]
As might be anticipated for the high differential expression of miR-142-3p in ex vivo expanded tTregs vs conventional T cells, we found that FOXP3 mean fluorescence intensity was negatively regulated by miR-142-3p and increased by antagomir exposure (Fig.   3d,e). [score:4]
Similar to FoxP3 levels, overexpression of miR-142-3p did not change Ki67 expression compared to control group. [score:4]
Thus, we conclude that miR-142-3p negatively regulates ATG16L1 expression in ex vivo expanded human tTreg cells. [score:4]
miR-142-3p—ATG16L1 axis controls tTreg function by regulating FoxP3 expression and proliferation in vitro. [score:4]
These results support our hypothesis that miR-142-3p can directly target ATG16L1 mRNA. [score:4]
miR-142-3p negatively regulates ATG16L1 expression in tTreg cells. [score:4]
Knock-down of miR-142-3p with an antagomir did increase Ki67 expression (Figs.   3f and 4g). [score:4]
One such miR, miR-142-3p, is known to negatively regulate T cell activation in systemic lupus erythematosus (SLE) patients and hence may be a candidate for miR targeting [16]. [score:4]
In our study, we confirm that miR-142-3p regulates FOXP3 and suppressive function via ATG16L1 pathway. [score:4]
Though the down-regulation of miR-142-3p, autophagy -mediated anti-apoptosis genes (Mcl-1 and c-myc) and pro-apoptosis genes (BAX and BID) changed, resulting in greater expansion and tTreg cell survival. [score:4]
Wang Y Ouyang M Wang Q Jian Z MicroRNA-142-3p inhibits hypoxia/reoxygenationinduced apoptosis and fibrosis of cardiomyocytes by targeting high mobility group box 1Int. [score:4]
Dou L MicroRNA-142-3p inhibits cell proliferation in human acute lymphoblastic leukemia by targeting the MLL-AF4 oncogeneMol. [score:4]
However, freshly isolated tTreg cells show less miR-142-3p expression compared to conventional T cells, which indicates that FOXP3 is not necessary for miR-142-3p expression [37]. [score:4]
Ding S Decreased microRNA-142-3p/5p expression causes CD4+ T cell activation and B cell hyperstimulation in systemic lupus erythematosusArthritis Rheum. [score:3]
c Schematic representation of the miR-142-3p target sequence within the 3′UTR of ATG16L1. [score:3]
Of these only miR-142-3p was noted to be differentially expressed in our prior screen [17]. [score:3]
Therefore, the suppressive function of tTreg could be enhanced by miR-142-3p antagomir and miR-142-3p—ATG16L1—FoxP3 pathway plays a necessary role in vitro. [score:3]
In accord with mRNA levels, miR-142-3p inversely correlated with ATG16L1 protein expression in tTreg cells (Fig.   2f). [score:3]
org) were utilized to predict the potential mRNAs which targets ATG16L1 mRNA, miR-142-3p was involved in tTreg function with highest possibilities. [score:3]
Treatment with miR-142-3p antagomir increases cell viability, proliferative ability, anti-apoptotic and decreases pro-apoptotic gene expression and enhances tTreg persistence and expansion. [score:3]
Huang B miR-142-3p restricts cAMP production in CD4+CD25- T cells and CD4+CD25+ TREG cells by targeting AC9 mRNAEMBO Rep. [score:3]
b RNA was purified and qRT-PCR used to determine the expression of b miR-142-3p. [score:3]
As shown in Fig.   2e, overexpression of miR-142-3p decreased ATGL1 mRNA while the inverse effects were detected after antagomir treatment. [score:3]
We sought to determine whether miR-142-3p controls tTreg biological properties such as proliferation, survival, and suppressor function. [score:3]
Values indicate mean ± SEM of these experiments (* P < 0.05 and ** P < 0.01) Fig. 4Treatment with miR-142-3p antagomir increases cell viability, proliferative ability, anti-apoptotic and decreases pro-apoptotic gene expression and enhances tTreg persistence and expansion. [score:3]
Overexpression of miR-142-3p induced early apoptosis in tTreg cells while antagomir treatment delayed apoptosis (Figs.   4a,b). [score:3]
Thus, we sought to determine whether miR-142-3p controls tTreg biological properties such as proliferation, survival, and suppressor function. [score:3]
To assess whether human miR-142b-3p targets ATG16L1 mRNA, HEK293 cells were transduced with plasmids carrying wild type (WT) or mutant (MUT) 3′UTR sequences from ATG16L1 linked to a luciferase reporter gene. [score:3]
However, we cannot exclude the contribution of other targets for miR-142-3p in the control of Tregs such as ATF7IP, CFL2, RAB2, TFG, and CPEB2. [score:3]
In our study, we show that although FOXP3 expression remained high during ex vivo expansion, miR-142-3p increased with time. [score:3]
These results indicate that miR-142-3p negatively regulates tTreg ex vivo expansion, viability, and survival. [score:2]
Knock-down of miR-142-3p improves tTreg survival and promotes cell expansion. [score:2]
In our previous study using TaqMan Low Density Array, we found that miR-142-3p was the second most highly differentially expressed miRNA in ex vivo expanded human tTreg cells as compared to naïve T cells [17]. [score:2]
Data shown are representative of two independent xGVHD experiments Thus, knock down of miR-142-3p in tTregs increases in vivo efficacy and can be exploited to improve the efficacy of adoptive Treg therapy for the prevention of human GVHD. [score:2]
To conclude, miR-142-3p negatively regulates tTreg apoptosis status. [score:2]
Data shown are representative of two independent xGVHD experiments Thus, knock down of miR-142-3p in tTregs increases in vivo efficacy and can be exploited to improve the efficacy of adoptive Treg therapy for the prevention of human GVHD. [score:2]
As shown in Fig.   3a,b, knock-down of miR-142-3p with an antagomir strengthened autophagy activity, while agomir treatment reversed this effect. [score:2]
Knock-down of miR-142-3p antagomir treatment significantly prolongs the survival and Treg persistence in a xenogeneic mo del of GVHD. [score:2]
In summary, we demonstrate that miR-142-3p—ATG16L1—FOXP3 pathway plays a vital role in tTreg expansion, survival and function in vivo and vitro, and focusing on miRNA might become a new starting point in Treg clinical trials. [score:1]
As shown in Fig.   2d, 3′-UTR-NC control with unloaded plasmid, 3-UTR-WT and 3′-UTR-MUT groups were treated with miR-142-3p mimic. [score:1]
Fig. 5Naïve PB tTreg were sort purified, expanded in vitro and were either left untreated, or were incubated with scramble RNA or miR-142-3p antagomir for 2 days. [score:1]
Finally, to confirm the effects of miR-142-3p on proliferation, we sorted fresh CD4+CD25+CD127− tTreg cells by MACS and treated them with agomir or antagomir on day 0 (renewed with new media). [score:1]
Naïve PB tTreg were sort-purified, expanded in vitro, and were treated miR-142-3p antagomir or agomir as previously described. [score:1]
We demonstrate here that miR-142-3p negatively correlates with tTreg cell expansion and survival. [score:1]
Naïve PB tTreg were sort purified, expanded in vitro and were either left untreated, or were incubated with scramble RNA or miR-142-3p antagomir for 2 days. [score:1]
Fluorescence confocal microscopy was used to confirm whether the ATG16L1 autophagy effects are controlled by miR-142-3p. [score:1]
Two nucleotides (complementary to nucleotides 6 and 8 of miR-142-3p) were mutated in the 3′ UTR of ATG16L1. [score:1]
To determine whether increased miR-142-3p levels are related to attenuated viability, proliferative ability or survival during ex vivo tTreg expansion, tTregs on day 14 were treated with a miR-142-3p agomir or antagonist for 2 days. [score:1]
Holmstrom K Pedersen AE Gad M Analysis of miR-146a and miR-142-3p as potential markers of freshly isolated or in vitro-expanded human Treg cellsScand. [score:1]
In this study, we have shown that nanoparticle -mediated delivery of miR-142-3p antagomir to in vitro expanded tTreg is an easy and efficient way of overcoming these challenges, which may be useful in clinical applications. [score:1]
[1 to 20 of 66 sentences]
8
[+] score: 244
Based on the observation that CLOCK-BMAL1 abundance fluctuates in the mouse SCN with peak levels occurring at CT 0 [37], it appears that the putative timing of these positive transcriptional regulatory complexes is appropriately phased in advance of the zenith in SCN miR-142-3p expression at CT 3. Relative to other miRNA-target relationships, miR-142-3p and Bmal1 are thus unique because the miRNA represses its target gene but the target also drives expression of the miRNA. [score:12]
Based on preliminary observations derived from fluorescence microscopy examining the expression of the eGFP reporter encoded in both pEZX-MR04 vectors (miR-142 expression and scrambled, non -targeting control), the transfection efficiency in mPer2 [Luc] SCN cells ranged from 40–50%. [score:7]
, Tewksbury MA) and 24 h later were co -transfected with pEZX-MR04 miR-142 expression vector (miExpress Precursor miRNA expression clone; Genecopoeia, Inc. [score:7]
The rhythmic peak of miR-142-3p expression in mPer2 [Luc] SCN cells at 12 h was significantly greater (p<0.01) than the minima observed at 20 h. Circadian variation in Bmal1 expression was also observed in the same mPer2 [Luc] SCN cultures (p<0.01), with circadian peaks in Bmal1 mRNA levels at 0 h and 24 h that were significantly greater (p<0.01) than the nadir observed at 8 h. The Bmal1 and miR-142-3p rhythms in mPer2 [Luc] SCN cells were marked by overt phase differences such that the oscillation in Bmal1 mRNA levels was antiphasic to the circadian profile in miR-142-3p expression (Fig. 2A). [score:7]
The objectives of our experimental analysis were to determine whether: 1) miR-142-3p is rhythmically expressed in the SCN in vivo and in an immortalized SCN cell line; 2) the repression of Bmal1 3′ UTR activity in response to miR-142-3p overexpression is abated by mutagenesis of specific miRNA binding sites; and 3) miR-142-3p overexpression affects the endogenous BMAL1 protein rhythm in SCN cells in vitro. [score:7]
Experiment 2: Mutagenic Analysis of Putative Binding Sites Mediating miR-142-3p -induced Repression of Bmal1 3′ UTR ActivitymiTarget™ miRNA Target Sequence 3′ UTR Expression Clone containing Bmal1 3′ UTR sequence (Accession: NM_007489.3) inserted in the pEZX-MT01 vector was purchased from GeneCopoeia, Inc (Rockville, MD). [score:7]
Experiment 3: Effects of miR-142-3p Overexpression on the Circadian Regulation of BMAL1 Protein Levels in SCN cells in vitro The effects of miR-142-3p overexpression on endogenous levels of mBMAL1 protein were examined in cultures of mPer2 [Luc] SCN cells that were derived from a single passage. [score:6]
For in vitro analysis, immortalized SCN cell lines generated from mPer2 [Luc] knockin and from mice with targeted disruption of Per1 and Per2 (Per1 [ldc/]Per2 [ldc]) were used to profile the temporal pattern of miR-142-3p expression. [score:6]
Because Bmal1 is wi dely expressed and rhythmically regulated in most cells and tissues throughout the body [39], miR-142-3p may play a similar modulatory role in the post-transcriptional regulation of core molecular components in peripheral clocks. [score:5]
To verify that the observed miR-142-3p rhythm in SCN cells is under control of the circadian clock, the temporal profile of miR-142-3p expression was analyzed in a SCN cell line derived from mice with targeted disruption of Per1 and Per2 genes (Per1 [ldc]/Per2 [ldc]). [score:5]
Experiment 3: Effects of miR-142-3p Overexpression on the Circadian Regulation of BMAL1 Protein Levels in SCN cells in vitro To investigate functional implications of miR-142-3p in the regulation of SCN clock gene oscillations, we next determined whether constitutive overexpression of miR-142-3p in immortalized mPer2 [Luc] SCN cells affects the circadian rhythm in endogenous BMAL1 protein levels. [score:5]
Representative Western blot results and densitometric determinations of BMAL1 protein levels at 4-hour intervals in cultures (n = 4–5) of mPer2 [Luc] SCN cells transfected with pEZX-MR04 control miRNA expression vector (CONT) or pEZX-MR04 miR-142 expression vector (miR-142). [score:5]
Combined deletion of both 3′ UTR target sites (c. 1_7 del+ c. 335_357 del) completely abolished repression of the Bmal1 3′ UTR in response to miR-142-3p-overexpression as no significant differences in bioluminescence (p = 0.33) were observed in cells transfected with control vector or the c. 1_7 del+ c. 335_357 del construct (Fig. 3B). [score:5]
In addition, miR-142-3p modulates Bmal1 expression in the mouse SCN and plays a role in the circadian control of this clock gene as over -expression abolishes the rhythm in BMAL1 protein accumulation. [score:5]
Consistent with our previous results [26], miR-142-3p overexpression produced significant decreases (p<0.01) of ∼60% in luciferase-reported bioluminescence in WT Bmal1 3′ UTR -expressing HEK293 cells relative to that found in cells transfected with the control vector (Fig. 3B). [score:5]
The phase relationship between circadian oscillations in Bmal1 mRNA and miR-142-3p expression in the mouse SCN is noteworthy; the rising phase and peak of the Bmal1 rhythm occurred in advance of peak miR-142-3p expression in the SCN, raising the possibility that Bmal1 may play a role in the activation of miR-142-3p transcription. [score:5]
The plasmid with targeted deletions of both miR-142-3p target sites on the Bmal1 3′ UTR (Bmal1 c. 1_7 del+ c. 335_357 del) was propagated and sequenced to verify these deletions as described above. [score:5]
Experiment 1: Temporal Profiling of miR-142-3p Expression in SCN cells in vivo and in vitro Prior to determining whether miR-142-3p expression in SCN cells fluctuates on a circadian basis, we analyzed the promoter region of this miRNA for evidence of E-box or CRE-box elements which are known to mediate clock- and light-controlled transcription, respectively. [score:5]
Because miRNAs function as molecular switches controlling expression of hundreds of genes [42], [43], the impact of miR-142-3p and its circadian modulation may extend beyond the regulation of Bmal1. [score:4]
Site-directed deletion of both putative MREs at nucleotides 1–7 and 335–357 completely abolished miR-142-3p -induced, but not miR-494 -mediated, inhibition of Bmal1 3′ UTR activity. [score:4]
In conjunction with evidence that miR-142-3p is a bona-fide clock-controlled gene, the localization of a conserved, canonical E-box (CA NNTG) element ∼1.5 kb upstream of the miR-142 locus suggests that its clock gene target may feed back and positively regulate the transcription of this miRNA through the formation of CLOCK-BMAL1 heterodimer complexes. [score:4]
Similar to many of its endogenous biological processes, SCN expression of miR-142-3p fluctuates rhythmically and circadian regulation of this miRNA is dependent on the integrity of the molecular clockworks. [score:4]
Experiment 3: Effects of miR-142-3p Overexpression on the Circadian Regulation of BMAL1 Protein Levels in SCN cells in vitro. [score:4]
Because identification of an E-box element in the promoter region of miR-142 suggests that its transcription may be clock-controlled, we next examined the temporal profile of miR-142-3p expression in the SCN in vivo. [score:3]
In HEK293 cells co -transfected with either the c. 1_7 del or c. 335_357 del Bmal1 3′ UTR, overexpression of miR-142-3p similarly induced a significant (p<0.05) reduction in luciferase -mediated bioluminescence relative to control transfections but the amplitude of this effect was diminished (∼30%) in comparison to that observed for the full-length Bmal1 3′ UTR. [score:3]
Temporal patterns of miR-142-3p and Bmal1 expression in immortalized SCN cells in vitro. [score:3]
0065300.g001 Figure 1Temporal patterns of miR-142-3p and Bmal1 expression in the mouse SCN. [score:3]
Experiment 1: Temporal Profiling of miR-142-3p Expression in SCN cells in vivo and in vitro. [score:3]
To determine whether miR-142-3p expression fluctuates rhythmically in the SCN in vivo, mice were maintained in LD 12∶12 for 3 weeks prior to experimental analysis and then exposed to constant darkness (DD) beginning at lights-off in the LD 12∶12 cycle (1800 h). [score:3]
The rhythmic peak in SCN expression of miR-142-3p at CT 3 was significantly (p<0.05) and about 2-fold greater than the succeeding minima observed during the early subjective night at CT 15. [score:3]
MiR-142-3p expression in the same cultures remained largely at constant levels and showed no significant evidence of circadian rhythmicity (p>0.05) (Fig. 2B), indicating that the miR-142-3p oscillation observed in immortalized SCN cells in vitro is indeed clock-controlled. [score:3]
Effects of miR-142-3p overexpression on the circadian rhythm of BMAL1 protein content in immortalized SCN cells in vitro. [score:3]
Circadian fluctuations in miR-142-3p and Bmal1 mRNA expression were identified by cosine curve-fitting analysis using GraphPad Prism software. [score:3]
0065300.g002 Figure 2Temporal patterns of miR-142-3p and Bmal1 expression in immortalized SCN cells in vitro. [score:3]
Prior to determining whether miR-142-3p expression in SCN cells fluctuates on a circadian basis, we analyzed the promoter region of this miRNA for evidence of E-box or CRE-box elements which are known to mediate clock- and light-controlled transcription, respectively. [score:3]
In this regard, miR-142-3p has also been shown to modulate cAMP levels by targeting adenylate cyclase 9 in T-cells [43], [44]. [score:3]
Importantly, this miR-494 -mediated repression of the Bmal1 3′ UTR with combined deletion of the putative miR-142-3p binding sites was similar to that observed for the full-length 3′ UTR construct, suggesting that both mutagenized loci are specific targets for the action of miR-142-3p. [score:3]
The effects of miR-142-3p overexpression on endogenous levels of mBMAL1 protein were examined in cultures of mPer2 [Luc] SCN cells that were derived from a single passage. [score:3]
In the SCN, miR-142-3p levels reached peak values during the early subjective day when Bmal1 expression was low. [score:3]
Similar to the temporal profile observed in the mouse SCN, miR-142-3p expression (normalized to U6 snRNA) oscillated with a circadian periodicity (p<0.01) in cultures of mPer2 [Luc] SCN cells (Fig. 2A). [score:3]
0065300.g004 Figure 4Effects of miR-142-3p overexpression on the circadian rhythm of BMAL1 protein content in immortalized SCN cells in vitro. [score:3]
During exposure to DD, the relative abundance of miR-142-3p (normalized to U6 snRNA) in the mouse SCN was marked by circadian variation (p<0.01) with peak expression occurring early in subjective day and low levels throughout the early and middle portions of the subjective night (Fig. 1). [score:3]
Temporal patterns of miR-142-3p and Bmal1 expression in the mouse SCN. [score:3]
Experiment 1: Temporal Profiling of miR-142-3p Expression in SCN cells in vivo and in vitro Experimental subjects were 40 male C57BL/6J mice at 6–8 weeks of age (JAX Mice & Services, Bar Harbor, ME). [score:3]
Prior to experimentation, cells were seeded onto laminin-coated 6-well plates and 24 h later, cultures were transfected with pEZX-MR04 miRNA expression vector for miR-142 (final conc. [score:3]
Symbols denote real-time PCR determinations (mean ± SEM) of miR-142-3p (red) and Bmal1 mRNA (black) levels at 4-hour intervals in cultures (n = 4–5) of mPer2 [Luc] SCN cells (A) and immortalized SCN cells (Per1 [ldc]/Per2 [ldc]) with targeted disruption of Per1 and Per2 (B). [score:3]
Based on target prediction algorithms, this miR-142-3p -mediated repression is predicted to occur via two consensus binding sites on the Bmal1 3′ UTR. [score:3]
The disruption of rhythmicity induced by miR-142-3p overexpression was associated with a significant decrease (p<0.05) in BMAL1 protein levels at 20 h relative to peak values observed at this timepoint in control cultures. [score:3]
Hence, miR-142-3p may play a role in the circadian physiology of the SCN by regulating not only the core clock gene, Bmal1, but also clock-controlled outputs like cAMP so as to provide feedback capable of resetting and/or fine-tuning the clock mechanism. [score:2]
miR-142-3p -mediated regulation of Bmal1 3′ UTR was analyzed in human embryonic kidney (HEK293) cells using established methods [26]. [score:2]
Because miR-142-3p is distinguished by robust modulation of Bmal1 3′ UTR activity in mammalian peripheral oscillators [26] and by the presence of a canonical, CACGTG E-box element in its promoter region that may provide for clock control of miR-142 transcription, the present study focused on the role of this miRNA in the post-transcriptional regulation of Bmal1 in the master circadian clock within the SCN. [score:2]
To investigate functional implications of miR-142-3p in the regulation of SCN clock gene oscillations, we next determined whether constitutive overexpression of miR-142-3p in immortalized mPer2 [Luc] SCN cells affects the circadian rhythm in endogenous BMAL1 protein levels. [score:2]
To evaluate the specificity and relative contribution of these predicted miR-142-3p binding sites, we analyzed luciferase-reported Bmal1 3′ UTR activity in HEK293 cells co -transfected with the pEZX-MR04 miR-142 expression vector and constructs for either full-length Bmal1 3′ UTR (WT) or mutants with independent site-directed deletions of nucleotides 1–7 (c. 1_7 del) or nucleotides 335–357 which includes the second seed region and putative 3′ supplementary or compensatory elements (c. 335_357 del) or combined deletions of both loci (c. 1_7 del+ c. 335_357 del) (Fig. 3A). [score:2]
The presence of a canonical, CACGTG E-box element was identified ∼1.5 Kb upstream of the miR-142 locus and analysis of syntenic regions indicated that this regulatory element is highly conserved among mammalian lineages. [score:2]
Deletions in predicted miR-142-3p binding sites on the Bmal1 3′ UTR were generated using QuikChange II XL Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA) according to the manufacturer’s protocols. [score:2]
In the context of the present study, the possible modulation of this second messenger by miR-142-3p is intriguing because cAMP levels in the rat SCN fluctuate on a circadian basis with bimodal peaks during the late subjective day and late subjective night [45] and cAMP pathways are involved in regulating the SCN circadian rhythms [45], [46]. [score:2]
Studies using immortalized mPer2 [Luc] SCN cells were subsequently conducted to determine whether levels of mature miR-142-3p are also rhythmically regulated in vitro because this cell line has been shown to retain the endogenous oscillatory properties of the SCN in vivo (ensemble rhythms of Farnell et al. [29]). [score:2]
The high degree of conservation for miR-142-3p and the two MREs on the Bmal1 3′ UTR suggest that miR-142-3p may contribute to the feedback modulation of Bmal1 and perhaps other core elements of the molecular clockworks in the SCN across different mammalian species. [score:1]
Beginning 12 h later, control- and miR-142-3p -transfected cultures (n = 5) were harvested at 4 h intervals for 24 h by trypsinization and cell pellets were flash frozen in liquid nitrogen. [score:1]
Our previous findings indicate that miR-142-3p represses Bmal1 3′ UTR activity [26]. [score:1]
In the Bmal1 3′ UTR, nucleotides 1–7 are complementary to seed region of miR-142-3p. [score:1]
Effects of binding site mutagenesis on miR-142-3p -induced repression of Bmal1 3′ UTR activity. [score:1]
Symbols denote real-time PCR determinations (mean ± SEM) of miR-142-3p (red) and Bmal1 mRNA (black) levels at 4-hour intervals in the SCN (n = 4-5) of mice exposed to constant darkness (DD). [score:1]
Identical methods were also used to delete nucleotides 335–357 corresponding to a second predicted miR-142-3p binding site on the Bmal1 3′ UTR complementary to the seed region along with additional nucleotides that may function as a 3′ supplementary or compensatory element and aid in miRNA biological activity [33]– [35]. [score:1]
Consequently, we examined the effects of miR-494 on full-length and mutant (c. 1_7 del+ c. 335_357 del) Bmal1 3′ UTR activity to verify the specificity of the miR-142-3p binding sites at nucleotides 1–7 and 335–357. [score:1]
Experiment 2: Mutagenic Analysis of Putative Binding Sites Mediating miR-142-3p -induced Repression of Bmal1 3′ UTR Activity. [score:1]
In addition to miR-142-3p, miR-494 has also been shown to repress Bmal1 3′ UTR activity [26], potentially by interacting with nucleotides 473-495. [score:1]
The plotted values correspond to the ratios of miR-142-3p signal normalized to U6 snRNA levels and of Bmal1/ Ppia mRNA signal in which the maximal value for each gene was set at 100%. [score:1]
Experiment 2: Mutagenic Analysis of Putative Binding Sites Mediating miR-142-3p -induced Repression of Bmal1 3′ UTR ActivityOur previous findings indicate that miR-142-3p represses Bmal1 3′ UTR activity [26]. [score:1]
The phase relationship between miR-142-3p and Bmal1 rhythms in the SCN is compatible with our evidence for the function of this miRNA as a post-transcriptional repressor of Bmal1. [score:1]
Briefly, miR-142-3p from individual samples was reverse transcribed using Taqman MicroRNA Reverse Transcription Kit and the cDNA equivalent of 1.5 ng of total RNA was PCR amplified in an ABI PRISM 7500 Fast sequence detection system using the following standard conditions: 1) heating at 95°C for 10 min, and 2) amplification over 40 cycles at 95°C for 15 sec and 60°C for 1 min. [score:1]
Thus, these observations provide primary evidence indicating that two independent MREs on the Bmal1 3′ UTR are responsible for binding miR-142-3p and both contribute equally to its modulatory effects on 3′ UTR activity. [score:1]
This phase relationship between Bmal1 mRNA and miR-142-3p rhythms in SCN cells in vitro differed from that observed in the SCN in vivo. [score:1]
Consistent with the predicted significance of seed region interactions in functional mRNA–miRNA pairing, deletion of the first seven nucleotides in the Bmal1 3′ UTR abated miR-142-3p -mediated repression by ∼50%. [score:1]
In addition to this portion of the 3′ UTR, deletion of a highly conserved, canonical miRNA recognition element (MRE) at nucleotides 335–357 encompassing an octamer complementary to the seed region of miR-142-3p also yielded a comparable reduction (∼50%) in the repressive effect of this miRNA on Bmal1 3′ UTR activity. [score:1]
Collectively, these findings indicate that both of the putative miR-142-3p binding sites contribute equally to the repression of the Bmal1 3′ UTR. [score:1]
In comparison with control cultures, the BMAL1 rhythm was abolished in miR-142-3p -transfected mPer2 [Luc] SCN cultures as content of this clock gene protein remained at intermediate levels with no significant variation (p>0.05). [score:1]
The amplitude of this circadian rhythm in miR-142-3p levels was robust, with 3- to 4-fold differences between peak and trough values. [score:1]
0065300.g003 Figure 3Effects of binding site mutagenesis on miR-142-3p -induced repression of Bmal1 3′ UTR activity. [score:1]
[1 to 20 of 79 sentences]
9
[+] score: 238
The potential targets of mir-142-3p and-5p were predicted using the TargetScan and PicTar algorithms, and the targets predicted by both algorithms were listed in Additional file 4. The conserved E-box (CACGTG) in the upstream regulatory sequence of mir-142 was analyzed using DNAman, and the conservation track was obtained from the UCSC genome browser (http://genome. [score:8]
These results showed that mir-142-3p could regulate the expression of Bmal1 by directly targeting its 3’UTR. [score:7]
The over -expression (in 293ET and NIH3T3 cells) and knockdown (in U87MG cells) of mir-142-3p reduced and up-regulated the Bmal1/BMAL1 mRNA and protein levels, respectively. [score:7]
Here in this study, we found that mir-142-3p directly targeted Bmal1 and its expression was regulated by CLOCK/BMAL1 heterodimers. [score:7]
The expression levels of mir-142-3p in control NIH3T3 (mir-NC) and 293ET (pcDNA3.1) cells were normalized against that in mir-142-3p/mir-142-pcDNA3.1 -transfected cells which were set at 1. Note that, because the mir142-3p expression was low in control 293ET cells (pcDNA3.1) and was increased more than 1000-fold when cells were transfected with mir-142-pcDNA3.1, the relative expression level of mir-142-3p in control group (pcDNA3.1) was very low. [score:7]
Mir-142-3p is a Bmal1 -targeting miRNABy computational prediction using three algorithmic methods (TargetScan, PicTar and MicroCosm), we found two miRNAs that putatively target Bmal1 (Figure 1A). [score:7]
Taken together, CLOCK/BMAL1 heterodimers can bind to the E-box in the upstream regulatory sequence and activate the expression of mir-142; one product of mir-142, mir-142-3p, can act as a negative regulator of Bmal1 by targeting its 3’ UTR. [score:7]
To confirm that mir-142-3p can regulate the expression of Bmal1, mir-142-3p was over-expressed in the NIH3T3 and 293ET cells or knocked down in U87MG cells, and the mRNA and protein levels of human BMAL1 and mouse Bmal1 were determined. [score:7]
By over -expression of mir-142-3p in NIH3T3 cells, we showed mir-142-3p can regulate the expression of Bmal1. [score:6]
Although mir-142-3p has been reported to be a potential Bmal1 -targeting miRNA based on a luciferase reporter assay [17], the present report is the first confirmation that mir-142-3p can directly regulate the expression of Bmal1 both in mouse and human cells. [score:6]
The over -expression of mir-142-3p led to reductions in the levels of both Bmal1 (BMAL1) mRNA and protein in NIH3T3 (Figure 2B) and 293ET cells (Figure 2C), and knocking down mir-142-3p with antagomirs increased the expression of BMAL1 mRNA and protein in U87MG cells (Figure 2D). [score:6]
Moreover, the simultaneous ectopic expression of Clock and Bmal1 (but not Clock or Bmal1 alone) significantly induced the expression of mir-142-3p in NIH3T3 cells (Figure 5D). [score:5]
We also found that over -expression of mir-142 could significantly reduce the luciferase reporter RNA levels (Additional file 1B), suggesting that mir-142 was able to accelerate target mRNA degradation. [score:5]
The mir-142-pcDNA3.1 and mir-448-pcDNA3.1 expression plasmids were first transfected into 293ET cells and the expressions of mature miRNAs were verified by quantitative RT-PCR (Additional file 1A). [score:5]
Moreover, the expression level of mir-142-3p oscillated in serum-shocked NIH3T3 cells and the results of ChIP and luciferase reporter assays suggested that the expression of mir-142-3p was directly controlled by CLOCK/BMAL1 heterodimers in NIH3T3 cells. [score:5]
In our concise mo del, CLOCK/BMAL1 heterodimers enhance the transcription of mir-142, the product of which, in turn, inhibits the expression of Bmal1. [score:5]
The luciferase activity of (M1 + M2) was still decreased by about 30% with mir-142 over -expression, which may be ascribed to the background of luciferase reporter experiments for that mir-142 over -expression also led to an approximately 25% reduction of luciferase activity of the empty reporter vector (LUC) (Figure 1E). [score:5]
Mir-142-3p regulates the Bmal1 mRNA and protein levelsTo investigate the regulatory effect of mir-142-3p on the expression of endogenous Bmal1, we detected the expression level of mir-142-3p and Bmal1 protein level in six cell lines (NIH3T3, 293ET, MCF-7, U87MG, T98G and U251) generally used in our laboratory. [score:5]
In this study, we found that mir-142-3p directly targeted the 3’UTR of human BMAL1 and mouse Bmal1. [score:4]
However, a further study on the effects of knocking down mir-142-3p in appropriate murine cell mo dels (with high level of mir-142-3p) will help to confirm the relationship between mir-142-3p and its target at the physiological conditions. [score:4]
To investigate the regulatory effect of mir-142-3p on the expression of endogenous Bmal1, we detected the expression level of mir-142-3p and Bmal1 protein level in six cell lines (NIH3T3, 293ET, MCF-7, U87MG, T98G and U251) generally used in our laboratory. [score:4]
We have identified mir-142-3p as a potential regulator of Bmal1; therefore, it is of interest to explore the possibility that if this Bmal1 -targeting miRNA is under circadian control. [score:4]
The other product of mir-142, mir-142-5p, was also predicted to target numerous genes, the most interesting one of which is Clock, the other master regulator of the molecular clock (Additional file 4). [score:4]
Our study demonstrates that mir-142-3p can directly target the 3’UTR of Bmal1. [score:4]
In luciferase reporter assays, mutating each of the two mir-142-3p binding sites significantly reduced the repression effect of mir-142 over -expression on luciferase activity, and double mutations (M1 + M2) showed greater effect than single mutation (M1 or M2) (Figure 1E). [score:4]
Our study demonstrates that mir-142-3p can directly target the 3’UTR of Bmal1. [score:4]
In this study, we showed that the clock-controlled mir-142-3p can directly target its circadian activator, Bmal1. [score:4]
Besides the conserved canonical E-box, there is an unconserved non-canonical E’-box in the upstream regulatory sequence of mir-142 gene which might contribute to the induction of luciferase activity of P142-MT-LUC by co -expression of Clock and Bmal1 (Additional file 2). [score:4]
The 293ET cells were transfected with the mir-142 expression plasmid (mir-142-pcDNA3.1) or control vector (pcDNA3.1) (C). [score:3]
Predicting the targets of mir-142-3p and mir-142-5p. [score:3]
In addition, the expression of mir-142-3p is controlled by CLOCK/BMAL1 heterodimers, suggesting a potential negative feedback loop consisting of the miRNAs and the core clock genes. [score:3]
Other genes were also predicted to be targets of mir-142-3p (Additional file 4), and two of them (foxo1 and Nr3c1) are involved in the circadian clock [22, 23]. [score:3]
Click here for file Predicting the targets of mir-142-3p and mir-142-5p. [score:3]
In a synchronized NIH3T3 cell mo del, we found that the level of mir-142-3p oscillated rhythmically, with the peak levels (24 h and 48 h) phase lagging the crests (4 h and 28 h) of Bmal1 mRNA (Figure 3), suggesting the expression of mir-142-3p might be under circadian control. [score:3]
And then the expression patterns of Bmal1 mRNA and mir-142-3p were determined by quantitative RT-PCR (mean ± SD, n = 3). [score:3]
The expression level of mir-142-3p and BMAL1 mRNA in U87MG cells were determined by quantitative RT-PCR (mean ± SD, n = 3) and normalized against controls set at 1. All of the western blotting results were quantified from the pixel values in grayscales (mean ± SD, n = 3) and normalized against controls set at 1. Inserts are the representative western blotting results. [score:3]
Recently, a report showed that mir-494 and mir-142-3p, two circulating miRNAs, can target the Bmal1 3’ UTR in mice [17]. [score:3]
In contrast, NIH3T3, 293ET, MCF-7, T98G and U251 cells with low mir-142-3p levels expressed high levels of Bmal1 protein (Figure 2A). [score:3]
In addition to Bmal1, mir-142-3p was reported to target several genes, including ADCY9, whose product controls cAMP levels [21]. [score:3]
Figure 3 The expression of mir-142-3p oscillates in serum shocked NIH3T3 cells. [score:3]
The over -expression of mir-142-3p in NIH3T3 and 293ET cells was first verified, and then the Bmal1/ BMAL1 mRNA and protein levels were detected by quantitative RT-PCR (mean ± SD, n = 3) and western blotting, respectively. [score:3]
Figure 1 mir-142-3p can target Bmal1 3’UTR. [score:3]
The results confirmed that the over -expression of Clock and Bmal1 enhanced the transcription of mir-142. [score:3]
Over -expression of mir-142 but not mir-448 significantly repressed the activity of the Bmal1/ BMAL1 3’UTR-luciferase reporter (Figure 1B). [score:3]
Figure 5 CLOCK/BMAL1 heterodimers activate the expression of mir-142. [score:3]
Mir-142-3p is a Bmal1 -targeting miRNA. [score:3]
Even though we showed that mir-142 is transcriptionally controlled by CLOCK/BMAL1 heterodimers only in a mouse fibroblast cell line (NIH3T3), the E-box in the upstream regulatory sequence of mir-142 gene is perfectly conserved among mammals (Figure 4B). [score:2]
In our study, we identified mir-142-3p as a regulator of Bmal1 both in human and mouse cells. [score:2]
Click here for file There is an unconserved non-canonical E-box (E’-box) in the upstream regulatory sequence of mir-142 gene. [score:2]
Mir-142 expression is under clock control. [score:2]
There is an unconserved non-canonical E-box (E’-box) in the upstream regulatory sequence of mir-142 gene. [score:2]
Further studies are needed to confirm these prediction results and to uncover the regulatory role of the mir-142 gene in the circadian clock. [score:2]
The upstream regulatory sequence of mir-142 together with pre-mir-142 was inserted upstream of the luciferase reporter gene. [score:2]
Figure 2 mir-142-3p regulates the Bmal1 mRNA and protein levels. [score:2]
Figure 4 The upstream regulatory sequence of mir-142 gene contains a CLOCK -binding E-box. [score:2]
The top sketch modified from the miRBase shows that the pre-mir-142 can produce two mature miRNAs, mir-142-3p and-5p. [score:1]
Indeed, the results confirmed that mir-142-3p but not mir-142-5p repressed the Bmal1/ BMAL1 3’UTR-luciferase reporter activity (Figure 1C, bottom). [score:1]
Interestingly, by analyzing the 5’ flank sequence of the mir-142 gene we found a conserved canonical E-box (CACGTG) (Figure 4A). [score:1]
mir-142 reduces the mRNA level of reporter genes. [score:1]
For further study, a 1.6 kb upstream regulatory sequence of mir-142 gene containing the E-box together with pre-mir-142 was then used for a luciferase reporter assay (Figure 5A). [score:1]
The sequence of the synthetic mir-142-3p antagomirs is 5’-UCCAUAAAGUAGGAAACACUACA-3’. [score:1]
mir-142-3p: 5’-UGUAGUGUUUCCUACUUUAUGGA-3’; mir-142-5p: 5’-CAUAAAGUAGAAAGCACUACU-3’. [score:1]
The sequences of the synthetic mir-142-3p and mir-142-5p mimics are as follows. [score:1]
As there are two mir-142-3p binding sites in the 3’ UTR of Bmal1, we mutated one or both of them to determine which site was functional, even though the first binding site (position1-7) is poorly conserved among mammals (Figure 1D). [score:1]
Briefly, the NIH3T3 cells untreated or transfected with synthetic mir-142-3p mimics or control miRNA mimics were maintained in normal DMEM until the cells reached confluence. [score:1]
For the mutagenesis experiment, the mir-142-3p binding site was replaced with a random sequence by bridge PCR. [score:1]
Click here for file mir-142 reduces the mRNA level of reporter genes. [score:1]
Mir-142-3p regulates the Bmal1 mRNA and protein levels. [score:1]
293ET cells were co -transfected with luciferase reporter plasmids and mir-142 or mir-448 expression plasmids or control vector, and the normalized firefly luciferase activity was measured (mean ± SD, n = 3). [score:1]
Due to the low transfection efficiency of plasmids, the NIH3T3 cells were transfected with synthetic mir-142-3p mimics (mir-142-3p) or control mimics (mir-NC) (B). [score:1]
The schematic representation of the binding sites for mir-142-3p and mir-448 in the 3’ UTR of Bmal1 is shown on the bottom. [score:1]
[1 to 20 of 71 sentences]
10
[+] score: 231
Of the differentially expressed genes following anti-miR-142-5p treatment listed in Table 5, and S1 and S2 Tables, only a few were found to be known direct targets of miR-142-5p according to the TargetScan prediction database. [score:8]
Of the selected upregulated genes in S1 and S2 Tables, several genes are predicted to be directly regulated by miR-142-5p (targetscan. [score:8]
Genes that were differentially expressed upon miR-142-5p inhibition (Table 5) largely reflected a directional change towards a gene expression profile more similar to non-colitic mice (Table 5, Fig 7). [score:8]
Genome-wide expression analyses were also performed in order to detect candidate target genes of miR-142-5p, of which inhibition resulted in most effective amelioration of colitis. [score:7]
[34] Upregulation could thus result in an anti-inflammatory immune response in the gut and therefore, during colitis, blocking the miR-142-5p -mediated Cyp2c55 regulation might prove crucial to decreasing disease severity. [score:7]
By studying tissue mRNA expression after miRNA silencing, both in vivo target genes and pathways targeted by miR-142-5p have been determined. [score:7]
Treatment with anti-miR-142-5p prevented wasting disease and ameliorates disease severity of transfer-colitic mice, and modulated downstream targets of the IL10RA pathway, corresponding with IL10RA activation. [score:7]
Differentially expressed genes are likely to be either directly or indirectly regulated by miR-142-5p. [score:6]
Three of the genes directly regulated by IL10RA are in the top-20 genes upregulated upon anti-miR-142-5p treatment: MEP1A, ALDOP, and DPEP1. [score:6]
Taken together, in vivo blocking of miR-142-5p results in the up- or downregulation of candidate target genes in the colon. [score:6]
While the CD4+CD45RO+ [hi] transfer colitis mo del showed a gene expression profile concordant with inhibition of IL10RA, treatment with anti-miR-142-5p was concordant with induction of IL10RA and reduction in colitis. [score:5]
A selection of genes, based on highest fold change after anti-miR-142-5p treatment with potential relation to inflammatory intestinal disorders or gut physiology, is shown in Table 5 (second and third column, respectively) and Fig 7. Of this table, Cyp2c55 and MAL (MyD88 adaptor-like) are the only genes predicted to be directly regulated by miR-142-5p (targetscan. [score:5]
Inhibition of these candidate miRNAs showed that miR-142-5p is the most effective in reducing colitis, and could potentially be a new target in the treatment of IBD. [score:5]
Anti-miR-142-5p reduced colitis and related wasting disease when administered in the T-cell transfer mo del, reflected in reduced weight loss and a lower disease activity index (DAI). [score:5]
Moreover, by genome-wide expression analyses, we found downstream activation of the anti-inflammatory IL10RA pathway, including three genes also found in the top-20 candidate target genes of miR-142-5p. [score:5]
Each miRNA has the potential to repress the expression of many different genes, and the observed phenotype of the mice receiving anti-miR-142-5p can be the result of interplay of multiple repressed targets. [score:5]
By analyzing the top-250 differently expressed genes, we found that the most significant predicted upstream regulator that affects a similar gene set as anti-miR-142-5p treatment is IL10RA. [score:4]
The gene that is most upregulated following anti-miR-142-5p treatment (Table 5) is Cyp2c55. [score:4]
[3]In order to identify putative direct upstream regulators following induction of colitis (experiment #1) or after anti-miR-142-5p treatment in colitic mice (experiment #4), IPA Upstream Regulator Analysis was used. [score:4]
Based on these results, antagomirs were created against the top-4 upregulated miRNAs in this colitis-transfer mo del (miR-142-5p, miR-146b, miR-203, and miR-223; experiment #2). [score:4]
S1 Table Overview of most significantly upregulated genes in the colon after anti-miR142-5p treatment versus scrambled LNA treatment in CD45RB transfer colitic mice. [score:4]
[3] In order to identify putative direct upstream regulators following induction of colitis (experiment #1) or after anti-miR-142-5p treatment in colitic mice (experiment #4), IPA Upstream Regulator Analysis was used. [score:4]
Thus, mice treated with anti-miR-142-5p revealed a directional change towards a gene expression profile similar to non-colitic mice. [score:4]
S2 Table Overview of most significantly downregulated genes in the colon after anti-miR142-5p treatment versus scrambled LNA treatment in CD45RB transfer colitic mice. [score:4]
Top 20 downregulated genes in anti-miR142-5p treated mice. [score:4]
Among them are three genes that are found in the top-20 significantly upregulated genes after anti-miR-142-5p treatment (S1 Table): MEP1A, DPEP1 and ALDOB. [score:4]
Reversal of expression profile toward a healthy state after anti-miR-142-5p treatment. [score:3]
This suggests that IL10RA is a key target of anti-miR-142-5p treatment and plays an important role in the improvement of intestinal inflammation. [score:3]
The strongest disease marker influenced by anti-miR-142-5p treatment was body weight loss: even more so than the reduction in histological inflammation. [score:3]
[32] Several other genes were also affected by anti-miR-142-5p treatment, meaning that they are possibly indirectly regulated by miR-142-5p. [score:3]
Furthermore, when assessing the DAI, mice treated with anti-miR-142-5p exhibit hardly any active disease (Fig 3B). [score:3]
Differential expression between transfer-colitic and control mice at each of the three time points and between anti-miR-142-5p and scrambled anti-miR treated mice, respectively, was assessed via an empirical Bayes moderated t-test. [score:3]
[26] MiR-223, miR-146a and miR-142-5p were among miRNAs expressed in colon biopsies and saliva shown to differentiate CD from UC. [score:3]
Disease parameters in anti-miR-142-5p -treated mice. [score:3]
To find candidate target genes of miR-142-5p, we treated transfer-colitic SCID mice with anti-miR-142-5p or the scrambled anti-miR for 5 days daily, after establishing 5% weight loss (experiment #4). [score:3]
0185097.g005 Fig 5 Disease parameters in RAG1-/- mice treated with anti-miR-142-5p. [score:3]
Disease parameters in RAG1-/- mice treated with anti-miR-142-5p. [score:3]
In experiment #1, the anti-inflammatory IL10RAis predicted to be inhibited in colitic mice (IPA activation Z-score -4.600; p = 5.45E-28) while in experiment #4 anti-miR-142-5p treatment in colitic mice is predicted to result in activation of IL10RA (IPA activation Z-score 2.828, p = 4.45E-11). [score:3]
[32]Several other genes were also affected by anti-miR-142-5p treatment, meaning that they are possibly indirectly regulated by miR-142-5p. [score:3]
Gene targets of miR-142-5p. [score:3]
Identifying candidate target genes of anti-miR-142-5p treatment. [score:3]
anti-miR-142-5p X To assess colonic mRNA expression profiles following blocking of miR-142-5p in transfer-colitic mice. [score:3]
Blocking miR-142-5p reduced colitis and prevented wasting disease, possibly by activation of the IL10RA pathway. [score:3]
[25]In IL-10 knockout mice, another experimental animal mo del of Th1 -mediated IBD, five out of the 11 miRNAs described in our current study (miR-223, miR-142-5p, miR-142-3p, miR-21 and miR-146a) were significantly elevated in severely inflamed colon. [score:2]
When comparing anti-miR-142-5p -treated to scrambled -treated transfer-colitic mice, we see an opposite relationship: IL10RA is predicted to be activated as an upstream regulator of genes affected by anti-miR-142-5p treatment. [score:2]
Several miRNAs were induced in the colon during colitis development, most significantly miR-223, miR-142-5p, miR-146B and miR-203. [score:2]
[25] In IL-10 knockout mice, another experimental animal mo del of Th1 -mediated IBD, five out of the 11 miRNAs described in our current study (miR-223, miR-142-5p, miR-142-3p, miR-21 and miR-146a) were significantly elevated in severely inflamed colon. [score:2]
[27] In miR-142 -deficient mice, this miRNA was identified as a specific regulator for CD4 [+] dendritic cell homeostasis and was demonstrated to cause a defect in priming of CD4 [+] T cells. [score:2]
To learn more about possible pathways involved in this beneficial effect, we isolated RNA from the colon of untreated mice and mice treated with anti-miR-142-5p. [score:1]
Validation of treatment results of anti-miR-142-5p. [score:1]
0185097.g004 Fig 4 (A) Non-colitic mouse (B) Scrambled -treated mouse (C) Anti-miR-142-5p -treated mouse. [score:1]
In conclusion, CD4+CD45RB [hi]-transfer colitis induces miR-142-5p. [score:1]
Silencing miR-142-5p. [score:1]
no cell transfer vehicle/PBS scrambled anti-miR-203 anti-miR-142-5p anti-miR-146banti-miR-223 X X XTo assess clinical impact of blocking selected miRNAs in transfer-colitic mice. [score:1]
[38] Colitic mice treated with anti-miR-142-5p seemed healthy and groomed, unlike the general unhealthy appearance of mice treated with other compounds. [score:1]
Volcano plot of genes affected by colitis and anti-miR-142-5p treatment. [score:1]
In experiment #4 we aimed to study the effect in the colon on a transcriptional level of blocking miR-142-5p. [score:1]
Volcano plot for the comparison of LNA anti-miR-142-5p treated mice versus scrambled LNA controls. [score:1]
In addition, anti-miR-142-5p treatment lowered colonic inflammation (p = 0.034, Fig 5D) and resulted in a significantly lower DAI (p = 0.016, Fig 5E). [score:1]
Other genes affected by therapeutic blocking of miR-142-5p as listed in S1 and S2 Tables that could also interfere with cross-talk interactions that NF-κB is a part of, are Nr5a2,[43] Cftr,[44] TNFRSF11b,[45] Adora1 (adenosine A1 receptor)[46] and PLAT. [score:1]
[47] In conclusion, in our mo del of blocking miR-142-5p in transfer-colitic mice, it is possible that systemic effects of the treatment are responsible for maintaining a healthy body weight, possibly by preventing immune -mediated cachexia. [score:1]
One mouse in the scrambled and one mouse in the anti-miR-142-5p group had to be humanely euthanized before antagomir treatment, as they reached the humane endpoint. [score:1]
[28] Silencing of miR-142-5p resulted in less weight reduction, a better survival and a reduced DAI score in our colitic mice, although histological inflammation seemed less pronounced in SCID than in RAG1-/- mice. [score:1]
receiving PBS or the scrambled LNA anti-miRNA showed most weight loss (Fig 3A), while the anti-miR-142-5p -treated and non-colitic mice showed least weight loss. [score:1]
When comparing the colon weight after sacrifice, we see a trend to lower colon-to-body-weight ratio in the anti-miR-142-5p -treated group (p = 0.058, Fig 5C). [score:1]
anti-miR-142-5p X X X To validate the clinical impact of blocking miR-142-5p in transfer-colitic mice from a different background and gender. [score:1]
In this experiment we also observed a clear effect of blocking miR-142-5p on the development of colitis as antagomir -treated mice demonstrated enhanced survival (Fig 5A) and less body weight loss (Fig 5B) compared to the scrambled -treated mice. [score:1]
Again we clearly observed the healthy appearance of the anti-miR-142-5p -treated mice. [score:1]
Interesting to note is that, while inflammation has not fully disappeared in anti-miR-142-5p treated mice, the body weight curve is similar to that of healthy animals (Fig 3A). [score:1]
Scrambled -treated mice showed apparent histological inflammation (Fig 6A), with crypt elongation, abscesses and immune cell infiltrates, while anti-miR-142-5p -treated mice display healthier intestinal mucosa (Fig 6B). [score:1]
It is however important to note that the DAI consists of three separate scores: while the weight loss was reduced to the level of healthy mice, there was no difference in stool score between anti-miR-142-5p and other treatments (S1 Fig). [score:1]
0185097.g007 Fig 7Volcano plot for the comparison of LNA anti-miR-142-5p treated mice versus scrambled LNA controls. [score:1]
The body weight curve of anti-miR-142-5p -treated mice is similar to the control mice that have not received any cell transfer, i. e. without induced colitis. [score:1]
In experiment #3, the antagomir showing the largest reduction in colitis, anti-miR-142-5p, was administered in male mice from a RAG1-/- background until death or sacrifice, using the scrambled antagomir as a control. [score:1]
Despite that anti-miR-142-5p seemed to result in strongest amelioration of colitis, no significant differences were found when comparing antagomir -treated mice to scrambled LNA antagomir -treated mice. [score:1]
By microscopically scoring all H&E-stained intestines of mice for granulocytes and mononuclear cells, we can estimate that, on a scale from 0 (no presence of cells) to 3 (extensive presence of cells), there were less granulocytes (1,75 in scrambled -treated mice, 1,25 in anti-miR-142-5p -treated mice) and less mononuclear cells (2,8 in scrambled -treated mice, 2,0 in anti-miR-142-5p -treated mice) present. [score:1]
Mice treated with anti-miR-142-5p show an improved survival. [score:1]
We also see that these cells have not infiltrated as deeply into the different layers of the colon; while we see both granulocytes and mononuclear cells within the muscular layer and serosa of the scrambled -treated mice, these cells are limited to the mucosa, submucosa and in one case also the muscular layer of the intestine of anti-miR-142-5p -treated mice. [score:1]
[1 to 20 of 78 sentences]
11
[+] score: 214
Here, we showed that (i) a number of miRNAs are significantly changed during the differentiation of mesodermal and cardiac progenitor cells from ESCs; (ii) miR-142-3p is highly expressed in undifferentiated ESCs, while it is downregulated during early ESC differentiation and its expression is significantly lower in T-GFP [+] cells and FLK1 [+]/CXCR4 [+] CPCs than in corresponding T-GFP [−] cells and FLK1 [−]/CXCR4 [−] cells; (iii) ectopic expression of miR-142-3p does not affect the self-renewal and germ layer specification of ESCs, whereas it suppresses cardiomyocyte formation; (iv) this inhibition is associated with the downregulation of the expression of cardiac mesodermal marker gene Mesp1 and the downstream cardiac progenitor marker genes Nkx2.5, Tbx5, and Mef2c; and (v) miR-142-3p targets the 3′UTR of Mef2c. [score:21]
This is supported by the findings that (i) miR-142-3p is downregulated in mesodermal and CPC populations; (ii) miR-142-3p does not affect the formation of nascent mesoderm; (iii) miR-142-3p inhibits the expression of Mesp1 and the downstream cardiac progenitor genes; and (iv) miR-142-3p directly targets Mef2c, though further validation at the protein level is needed. [score:11]
Knockdown of miR-142-3p during the development of zebrafish disrupts normal cardiac formation and function [20], while in the present study, miR-142-3p overexpression suppresses cardiomyocyte formation. [score:7]
To further determine the role of miR-142-3p in the self-renewal of ESCs, we suppressed the expression of miR-142-3p by using commercialized inhibitor (Supplementary Figure S2A). [score:7]
Moreover, qRT-PCR analysis showed that the expression levels of cardiac myofilament genes Myh6, Myl7, and Tnnt2 were markedly suppressed by miR-142-3p overexpression (Figure 4(d)). [score:7]
The effect of miR-142 overexpression on the self-renewal of ESCs during differentiation was further examined, and there were no significant changes in the expression levels of pluripotency marker Rex1, Oct4, and Nanog in miR-142 overexpression cells compared with wt and control cells during differentiation (Figure 3(d)). [score:6]
miR-142-3p overexpression did not significantly affect the expression of ectodermal (Fgf5, Nestin), endodermal (Fox2, Sox17, and Afp), and mesodermal (T, Eomes, and Flk1) marker genes (Figures 5(a), 5(b), and 5(c)). [score:5]
In undifferentiated status, the expression level of miR-142-3p in the overexpression cell lines (clones miR-142-3 and miR-142-9) was about 2- to 5-fold higher than those in wt and control cells (Figure 2(b)). [score:5]
The cells transfected with scramble or miR-142-3p inhibitor showed similar levels of ALP activity (Supplementary Figure S2B, a-b), protein expression of pluripotency markers OCT4 and NANOG (Supplementary Figure S2B, c–f), pluripotency marker genes Oct4, Nanog, and Rex1 (Supplementary Figure S2C), and the percentage of SSEA1 [+] cells (Supplementary Figure S2D). [score:5]
Since Mesp1 is the earliest marker of cardiovascular development [30], we examined whether miR-142-3p directly targets Mesp1. [score:5]
For the inhibition of miR-142-3p, ESCs were transfected with the commercialized miR-142-3p inhibitors or scramble (RiboBio, China) using Lipofectamine 2000 (Invitrogen, USA) according to the manufacturer's instructions. [score:5]
During differentiation, the expression level of miR-142-3p in the overexpression cell lines remain the same as in undifferentiated status (Figure 2(b)). [score:5]
However, when the 3′UTR of Mesp1 was cloned into the luciferase reporter, miR-142-3p had no effect on the luciferase activity (Supplemental Figure S3B), indicating that miR-142-3p does not directly target Mesp1. [score:4]
To elucidate the mechanisms by which miR-142-3p regulates cardiac differentiation, we searched for potential targets of miR-142-3p by using miRanda [28] and RNAhybrid [29]. [score:4]
Among these miRNAs, miR-142-3p was downregulated in both T-enriched mesoderm and FLK1 [+]/CXCR4 [+] CPCs. [score:4]
Downregulation of miR-142-3p during ESC differentiation is required for the specification of mesodermal cells to CPCs. [score:4]
miR-142-3p does not directly target to the 3′UTR of Mesp1. [score:4]
Flow cytometry analysis further confirmed that miR-142-3p overexpression decreased the percentage of TNNT2 [+] cardiomyocytes at differentiation day 10 (Figure 4(c)). [score:3]
Immunofluorescence staining confirmed that the positive area of cardiac myofilament protein TNNT2 was significantly smaller in miR-142-3p overexpression EBs than that in wt and control (Figure 4(b)). [score:3]
In wt and control ESCs, spontaneously contracting cardiomyocytes were visible at day 6, and the percentage of EBs containing spontaneously contracting cardiomyocytes increased gradually over time and reached over 90%, while in miR-142-3p overexpression ESCs, it dropped to 20% to 35% (Figure 4(a)). [score:3]
To elucidate which differentiation stage is affected by miR-142-3p, we analysed the expression of germ layer and cardiac precursor genes by qRT-PCR. [score:3]
These findings provide insights into the novel role of miR-142-3p in the regulation of cardiac lineage commitment and add information for the further development of cell therapy and drug discovery. [score:3]
We then examined the function of miR-142-3p on ESC self-renewal and cardiac differentiation and identified the potential targets. [score:3]
To generate miR-142-3p -overexpressing ESC lines, the miR-142 stem-loop flanked by 170 nucleotides on each side was amplified by polymerase chain reaction (PCR) from mouse genomic DNA and inserted into pCDH-EF1-MCS-T2A-Puro lentiviral vector. [score:3]
3.4. miR-142-3p Suppresses ESC Differentiation into CPCs but Not Mesoderm Formation. [score:3]
Moreover, qRT-PCR analysis showed that the expression of Mef2c was decreased by miR-142-3p (Figure 4(d)). [score:3]
We found that miR-142-3p may function upstream of Mesp1 through an indirect regulatory way. [score:3]
Taken together, these results suggest that Mef2c may be the target of miR-142-3p. [score:3]
3.3. miR-142-3p Suppresses Cardiomyocyte Differentiation. [score:3]
To determine the role of miR-142-3p in self-renewal and differentiation, we established ESC lines stably expressing miR-142-3p by using lentivirus (Figure 2(a)). [score:3]
They also reported that constitutive expression of miR-142 locks ESCs in an undifferentiated state when exposed to differentiation cues [19]. [score:3]
Ectopic Expression of miR-142-3p Does Not Affect Self-Renewal of ESCs. [score:3]
However, we did not observe a significant delay of decrease of pluripotency genes upon differentiation in miR-142-3p overexpression cells. [score:3]
As shown in Figure 2(b), in wild-type (wt) cells, miR-142-3p was highly expressed in undifferentiated ESCs and declined at differentiation day 1, reaching nadir at differentiation day 4 and then gradually returned to baseline. [score:3]
3.5. miR-142-3p Targets Mef2c in Cardiac Differentiation of ESCs. [score:3]
ESCs were transfected with 100 nM miR-142-3p inhibitor or scramble control for 48h. [score:3]
The expression pattern of miR-142-3p in control cells transfected with the blank vector was comparable with the wt cells either in undifferentiated ESCs or in differentiating ESCs (Figure 2(b)). [score:3]
In the microarray results, some miRNAs showed similar expression pattern to that of miR-142-3p, such as miR-125b-5p, miR-124, and let-7g. [score:3]
Further analysis showed that the 3′UTR of Mef2c, a key regulator of cardiomyocyte formation [31], had a miR-142-3p binding site (Figure 6(a)). [score:2]
These findings reveal a novel role of miR-142-3p in the regulation of cardiac lineage fate decision and provide its potential mechanism underlying the control of cell lineage decision and cardiogenesis. [score:2]
These data indicate that miR-142-3p negatively regulates cardiac differentiation. [score:2]
However, it is unknown whether miR-142-3p regulates mammalian cardiogenesis. [score:2]
Notably, no further increase in the cardiac differentiation is observed by knockdown of miR-142-3p, suggesting that the endogenous decline of miR-142-3p reaches the saturation level to allow sufficient CPC differentiation and subsequent cardiomyocyte formation. [score:2]
miR-142-3p negatively regulates the differentiation of cardiomyocyte through affecting the specification of cardiac mesodermal cells and CPCs. [score:2]
Our data showed that miR-142-3p negatively regulates the formation of cardiac mesoderm and CPCs, and the subsequent cardiomyocyte differentiation. [score:2]
Knockdown of miR-142-3p does not affect the self-renewal and cardiomyocyte differentiation of ESCs. [score:2]
Our data showed that miR-142-3p is an important regulator for early cardiac differentiation of ESCs. [score:2]
It needs to be determined whether these miRNAs might work together with miR-142-3p in the regulation of cardiac differentiation of ESCs. [score:2]
In addition, miR-142-3p is reported to regulate heart formation in zebrafish [20]. [score:2]
miR-142-3p, an evolutionally conserved miRNA of vertebrates, is a hematopoietic-specific miRNA [14] and regulates cell fate decision in the vertebrate hematopoietic system [15– 17]. [score:2]
However, the number of EBs containing spontaneously contracting cardiomyocytes was indistinguishable between scramble and miR-142-3p-knockdown cells (Supplemental Figure S2E). [score:2]
To confirm whether ectopic expression of miR-142-3p would affect the self-renewal property of ESCs, we compared characteristics of undifferentiated wt, control, and miR-142-3p overexpression ESCs. [score:2]
miR-142-3p is also a multifaceted regulator in organogenesis, homeostasis, and tumorigenesis [18]. [score:2]
Recently, miR-142-3p is reported to balance self-renewal and differentiation in mESCs via regulating KRAS/ERK signalling [19]. [score:2]
By contrast, miR-142-3p did not affect the activity of the luciferase reporter bearing mutant 3′UTR of Mef2c (Figure 6(b)). [score:1]
This is consistent with the recent report that in undifferentiated ESCs, there are high miR-142 and low miR-142 populations, while the two populations are indistinguishable by pluripotency markers [19]. [score:1]
Taken together, these data indicate that miR-142-3p appears to be dispensable for maintaining self-renewal of ESCs. [score:1]
Taken together, these data suggest that miR-142-3p decreases the populations of cardiac mesoderm and progenitor cells but not mesoderm formation of ESCs. [score:1]
Interestingly, the role of miR-142-3p in cardiac lineage commitment seems different between zebrafish and mESCs. [score:1]
Such difference suggests a species -dependent role of miR-142-3p. [score:1]
miR-142-3p reduced the activity of the luciferase reporter bearing wt 3′UTR of Mef2c. [score:1]
In this study, we screened miRNAs that might be involved in the differentiation of mESCs into mesoderm and CPCs by miRNA microarray and identified the changes of miR-142-3p abundance during mesodermal and early cardiac differentiation. [score:1]
Our results show that both gain and loss of function of miR-142-3p do not affect the self-renewal of undifferentiated ESCs. [score:1]
miR-142-3p was predicted to bind to the 3′UTR of Mesp1 (Supplemental Figure S3A). [score:1]
[1 to 20 of 64 sentences]
12
[+] score: 210
Other miRNAs from this paper: hsa-mir-17, mmu-mir-142a, hsa-mir-142, mmu-mir-17
Taken together, these results suggest that miR-142-3p is suppressed by DNA methylation in fibroblasts but that the downregulation of miR-142-3p during EB formation might be regulated by a different mechanism. [score:7]
This study revealed that miR-142-3p is expressed in undifferentiated iPS cells, but not in fibroblasts, and DNA methylation might play a pivotal role in suppressing miR-142-3p expression in fibroblasts. [score:7]
The expression of as-miR-142-3p did not affect the expression of Fgf5 or Gata4, although as-miR-17 enhanced expression of Fgf5, as expected (Figures 1(g) and 1(h)). [score:7]
Data revealed that as-miR-142-3p, but not as-miR-17, suppressed the expression of T brachyury, which is expressed specifically in cells of the mesodermal lineage [22] (Figure 1(i)). [score:7]
We observed that Klf4 upregulated luciferase activity but that Klf4 did not enhance the expression of endogenous miR-142-3p in 3T3 cells. [score:6]
TGF- βR1 and TGF- βR2 were both predicted to be targets of miR-142-3p [31], and TGF- βR1 was identified as a direct target in non-small-cell lung cancer [32]. [score:6]
The expression of miR-142-3p was upregulated by 5-aza-dC treatment (Figures 2(a) and 2(b)). [score:6]
In the current study, 5-aza-dC did not enhance the expression of miR-142-3p in mouse P1 thymocytes, supporting the hypothesis that DNA methylation is not a major mechanism that regulates the expression of miR-142-3p in hematopoietic cells. [score:6]
miR-142-3p was reported to be upregulated in the human melanoma cell line WM1552C after treatment with 5-aza-dC [27], suggesting that the expression of miR-142-3p was attenuated by DNA methylation not only in fibroblasts, but also in melanocyte lineage cells. [score:6]
The expression of miR-142-3p might be desilenced by the suppression of DNA demethylation and stimulated by other genes that play roles in the late phase of reprogramming. [score:5]
We also examined the effects of 5-aza-dC on miR-142-3p in EBs and found that 10  μM 5-aza-dC rather suppressed the expression (Figure 2(f)). [score:5]
Our data suggest roles for the methylation of CpG motifs in the 5′ genomic region of miR-142-3p in suppressing its expression in fibroblasts. [score:5]
We then analyzed the effects of overexpressing these transcription factors on the expression of endogenous miR-142-3p in 3T3 cells, but no effects were observed (Figure 3(i)). [score:5]
The expression of miR-142-3p is suppressed by DNA methylation of its CpG motifs in the 5′ genomic region in fibroblasts. [score:5]
miR-142-3p was expressed at a high level in undifferentiated iPS cells, whereas fibroblasts such as 3T3, mouse embryonic fibroblasts (MEFs), and tail-tip fibroblasts (TTF) expressed only very low levels (Figure 1(a)). [score:5]
We hypothesized that miR-142-3p expression is regulated epigenetically by DNA methylation in iPS cells and fibroblasts. [score:4]
To further elucidate the role of CpG sites and DNA methylation in regulating the expression of miR-142-3p, we analyzed the methylation status of the CpG sites identified in the region up to 700 bp upstream of the pre-miR-142-5p core region (Supplementary Figure 2) using bisulfite conversion. [score:4]
Although no similarity was found in the mouse and human upstream genomic regions (~2000 nt) of miR-142-3p, miR-142 expression is regulated by CpG methylation in both species. [score:4]
The expression of miR-142-3p in hematopoietic cells is regulated by various transcription factors that also play important roles in hematopoiesis [17, 18]. [score:4]
Levels of miR-142-3p were upregulated slightly by 10  μM of 5-aza-dC, but to a much lesser extent than observed in fibroblasts (Figure 2(g)). [score:4]
In hematopoietic cells, specifically, Spi1, Cebpb, Runx1, and LMO2 have all been reported to regulate miR-142 expression [17, 18]. [score:4]
5-Aza-2′-deoxycytidine Treatment Upregulates miR-142-3p in Fibroblasts. [score:4]
Luciferase analysis of the isolated genomic region of miR-142-3p supports the idea that the expression of miR-142-3p in cells including fibroblasts and iPS is regulated, at least partially, by DNA methylation. [score:4]
However, these transcription factors are mostly hematopoietic cell-specific, suggesting that the expression of miR-142 in undifferentiated iPS cells involves regulation of other factors. [score:4]
The identification of miR-142-3p target genes in the TGF- β and Wnt signaling pathways further supports the hypothesis that miR-142-3p is involved in the regulation of iPS cell physiology. [score:4]
To assess the transcriptional regulation of miR-142-3p expression, we examined its 5′ genomic sequence and identified 25 CpG motifs in a region covering ~1000 base pairs (bp) upstream of the miR-142-5p core sequence (Supplementary Figure 2). [score:4]
In addition, the expression of human miR-142 was recently reported to be regulated by the methylation of a CpG in its enhancer region in mesenchymal cells [8]. [score:4]
In contrast, the levels of miR-17 were rather reduced but not significantly by 5-aza-dC (Figure 2(c)), whereas the expression of neither miR-142-3p nor miR-17 was changed significantly by 5-aza-dC in undifferentiated iPS cells (Figures 2(d) and 2(e)). [score:3]
Supplemental Fig. 1: miR142-5p was strongly expressed in all the examined mouse iPS cell lines when cells keep immature state. [score:3]
We next constructed an expression plasmid encoding antisense miR-142-3p (as-miR-142-3p) and enhanced green fluorescent protein (EGFP; Figure 1(b)). [score:3]
Therefore, we hypothesize that a molecular environment related to reprogramming, which 3T3 cells lack, might be required for miR-142-3p expression. [score:3]
We previously characterized the expression pattern of miRNAs in mouse and human iPS and ES cells using miRNA arrays and found that miR-142-3p, but not miR-142-5p, was expressed at high levels in iPS cells (see Supplementary Figure 1 available online at http://dx. [score:3]
Morphology of colonies of iPS cell was indistinguishable between control and as-miR-142-3p expressing samples (Figure 1(f)). [score:3]
MEFs and 3T3 cells were treated for 3 days with 5 or 10  μM of 5-aza-2′-deoxycytidine (5-aza-dC), a DNA methyltransferase inhibitor (Dnmt), and the levels of miR-142-3p were assessed using real-time qPCR. [score:3]
Therefore, the combination of these transcription factors in a wider genomic region might cooperate for the full induction of miR-142-3p expression. [score:3]
CpGs were also hypomethylated in day 5 EBs (Figure 3(g)), even though the expression of miR-142-3p was much lower than in undifferentiated iPS cells (Figure 1(a)). [score:3]
The population of Ki67 -positive cells was slightly, but significantly, lower in as-miR-142-3p -expressing iPS cells (Figure 1(d)). [score:3]
We first confirmed the expression pattern of miR-142-3p using quantitative reverse transcription-polymerase chain reaction (qRT-PCR). [score:3]
The effect of expressing as-miR-142-3p on endogenous miR-142-3p was then examined and confirmed in mouse iPS cells (Figure 1(c)). [score:3]
We also examined the effects of 5-aza-dC for miR-142-3p expression in thymocytes. [score:3]
miR-142-3p, which is highly expressed in iPS cells but not in fibroblasts, plays roles in the proliferation and differentiation of iPS cells. [score:3]
Plasmids containing antisense sequences of mature miR-142-3p or miR-17 expression plasmid were constructed as follows: double strand DNA, which encode antisense of mature miR-142-3p or miR-17, was inserted downstream of U6 promoter using BamHI and EcoRI sites of pMX retrovirus vector containing EGFP after 5′ LTR (Figure 1(b)). [score:3]
When iPS cells were differentiated by formation of embryoid bodies (EBs), the expression of miR-142-3p fell to very low levels on day 2 but then increased on the following days (Figure 1(a)). [score:3]
We then counted the number of alkaline phosphatase- (ALP-) positive iPS colonies, and significantly fewer ALP -positive cells were found within the as-miR-142-3p -expressing iPS colonies (Figure 1(e)). [score:3]
miR-142 is highly conserved among vertebrates [8] and has been implicated in cardiac cell fate determination [9], osteoblast differentiation [10], and vascular development [11]. [score:2]
More recently, a report indicated that the miR-142-3p -mediated regulation of Wnt signaling could modulate the proliferation of mesenchymal progenitors [34]. [score:2]
Proximal CpGs in the miR-142-3p Genomic Region Regulate Transcriptional Activity. [score:2]
iPS cells were transfected with as-miR-142-3p/EGFP, purified according to their expression of EGFP, and then subjected to an EB formation assay. [score:2]
In cancer, miR-142-3p was identified at the breakpoint of a MYC translocation in B-cell leukemia [12] and was mutated in 20% of diffuse large B-cell lymphomas [13]. [score:1]
We then analyzed the roles of miRNA-142-3p on the ability of iPS cells to differentiate. [score:1]
Furthermore, miR-142-3p might also play roles in the mesodermal differentiation of iPS cells. [score:1]
We identified several potential binding sites for c-Myc and Sox2 in the genomic region up to 1 kb from the miR-142 mature sequence using the Genomatix Software Suite (http://www. [score:1]
In this study, we examined the roles of miR-142-3p in iPS cells and found that miR-142-3p might be involved in the proliferation of iPS cells and in maintaining their immaturity. [score:1]
CpG Methylation in the 5′ Genomic Region of miR-142-3p. [score:1]
The sequence of pre-miR-142 is highly conserved among vertebrates [8]. [score:1]
Specifically, as-miR-142-3p/EGFP was transfected into undifferentiated iPS to analyze the role of miR-142-3p in the proliferation and maintenance of immaturity in iPS cells. [score:1]
Roles of Pluripotency-Related Transcription Factors in miR-142-3p Gene Activation. [score:1]
Characterization of miR-142-3p Expression in iPS Cells, Embryoid Bodies, and Fibroblasts. [score:1]
Functional Analyses of miR-142-3p in iPS Cell Physiology. [score:1]
A plasmid without insertion of antisense miR-142-3p was used as a control for all experiments. [score:1]
Supplemental Fig. 2: Region covering 1 kb of 5' upstream genomic region of miR142 contains number of CpG sites. [score:1]
Regions covering up to 700 bp upstream of the miR-142 seed sequence were amplified and were cloned into pGEM-T Easy Vector (Invitrogen). [score:1]
miR-142 was first identified in hematopoietic cells [4], where it plays various roles in differentiation and functions during hemopoiesis [5– 7]. [score:1]
[1 to 20 of 63 sentences]
13
[+] score: 179
The miRNAs that were differentially expressed between non-tumor gastric mucosae and MALT lymphoma lesions are listed in Table 2. The miRNA expression profile revealed that a hematopoietic-specific miRNA, miR-142 [23], [24], and an oncogenic miRNA, miR-155 [12], [25], were overexpressed in MALT lymphoma lesions, relative to the levels of expression in the corresponding non-tumor mucosae. [score:9]
miR-142-5p and miR-155 suppress the proapoptotic gene TP53INP1 as their targetIdentification of miRNA target genes is essential for determining miRNA function. [score:7]
These findings suggest that TP53INP1 is a common target of miR-142-5p and miR-155 and is suppressed by overexpression of both miR-142-5p and miR-155 in gastric MALT lymphoma lesions. [score:7]
In agreement with these findings, our results showed that TP53INP1 was suppressed by both miR-142-5p and miR-155, possibly leading to inhibition of apoptosis and acceleration of MALT lymphoma cell proliferation. [score:5]
0047396.g004 Figure 4 miR-142-5p and miR-155 suppress TP53INP1 as their target. [score:5]
miR-142-5p and miR-155 suppress the proapoptotic gene TP53INP1 as their target. [score:5]
miR-142-5p and miR-155 suppress TP53INP1 as their target. [score:5]
Overexpression of miR-142-5p and miR-155 in an animal mo del of gastric MALT lymphomaTo further confirm the molecular pathogenesis of gastric MALT lymphoma, we examined the expression levels of miR-142-5p and miR-155 in an animal mo del of gastric MALT lymphoma. [score:5]
The distinct connection between aberrant expression of miR-142-5p and miR-155 and the progression of MALT lymphoma suggests that miRNAs could be potential therapeutic targets. [score:5]
The expression data for patients #14 and #16 with gastric MALT lymphoma who achieved CR after H. pylori eradication therapy showed that the levels of miR-142-5p and miR-155 expression were significantly reduced after eradication (Figure 2B, p<0.05 and p<0.05, respectively). [score:5]
Overexpression of miR-142-5p and miR-155 is presumed to play a critical role in the initiation and progression of gastric MALT lymphoma, suggesting that these miRNAs may be potentially useful as therapeutic targets and novel biomarkers for gastric MALT lymphomas. [score:5]
These findings suggest that overexpression of miR-142-5p and miR-155 concomitant with suppression of TP53INP1 reflect the increased proliferation of MALT lymphoma cells. [score:5]
To confirm the target specificity of miR-142-5p and miR-155 for TP53INP1, we performed a luciferase reporter assay using a vector containing the putative TP53INP1 3′ UTR target sites downstream of the luciferase reporter gene, which was transfected into AGS cells. [score:4]
These findings are consistent with our results, and in the present study we focused on miR-142 and miR-155, because miR-142 is the most up-regulated miRNA and miR-155 plays a critical role in the pathogenesis of B-cell lymphoma. [score:4]
Overexpression of miR-142-5p and miR-155 in gastric MALT lymphomaTo identify miRNAs that play critical roles in the development of gastric MALT lymphoma, we performed miRNA microarray analysis using RNAs obtained from three gastric MALT lymphomas and three matched samples of non-tumor gastric mucosa. [score:4]
Quantitative RT-PCR analyses showed that the levels of expression of miR-142-5p and miR-155 were significantly higher in H. heilmannii-infected C57BL/6 mice (p<0.05 and p<0.05, respectively), being similar to the results for human gastric MALT lymphomas (Figure 3B). [score:3]
The levels of miR-142-5p and miR-155 expression in MALT lymphoma lesions which confers resistance to H. pylori eradication were significantly higher than those in lesions lacking the API2-MALT1 fusion gene, which exhibited CR after H. pylori eradication (p<0.0001 and p<0.005, respectively). [score:3]
The expression levels of miR-142-5p and miR-155 were significantly lower after H. pylori eradication. [score:3]
Inhibition of miR-142-5p and miR-155 might be a novel approach for the prevention and treatment of gastric MALT lymphoma. [score:3]
The levels of miR-142-5p and miR-155 expression in gastric MALT lymphoma lesions were significantly increased relative to the corresponding non-tumor gastric mucosae (p<0.05 and p<0.05, respectively). [score:3]
These patients showed increased expression levels of miR-142-5p and miR-155 (Figure 1). [score:3]
Overexpression of miR-142-5p and miR-155 in gastric MALT lymphoma. [score:3]
A recent study has shown that chemically engineered oligonucleotides, termed ‘antagomirs,’ can work as specific inhibitors of endogenous miRNAs in mice [35], and might be potentially applicable to silence miR-142-5p and miR-155 for the treatment of gastric MALT lymphomas that are resistant to H. pylori eradication therapy. [score:3]
0047396.g001 Figure 1Expression levels of miR-142-5p and miR-155 and responses to H. pylori eradication therapy in gastric MALT lymphoma cases. [score:3]
Expression levels of miR-142-5p and miR-155 and responses to H. pylori eradication therapy in gastric MALT lymphoma cases. [score:3]
The levels of miR-142-5p and miR-155 expression normalized to the level of U6 RNA were significantly increased in H. heilmannii-infected C57BL/6 mice. [score:3]
To further confirm the molecular pathogenesis of gastric MALT lymphoma, we examined the expression levels of miR-142-5p and miR-155 in an animal mo del of gastric MALT lymphoma. [score:3]
The base pairing between miR-142-5p and miR-155 and the wild-type (WT) or mutant (MUT) target sites in the 3′ UTR of TP53INP1 mRNA is shown in Figure 4A. [score:3]
Expression levels of miR-142-5p and miR-155 in an animal mo del of gastric MALT lymphoma. [score:3]
These cases showed increased expression of miR-142-5p and miR-155. [score:3]
As shown in Figure 1, the expression levels of miR-142-5p and miR-155 in the gastric MALT lymphoma lesions were significantly higher than those in the corresponding non-tumor gastric mucosae (p<0.05 and p<0.05, respectively). [score:3]
The levels of miR-142-5p and miR-155 expression were associated with the clinical course of gastric MALT lymphoma, including the response to H. pylori eradication. [score:3]
0047396.g002 Figure 2Expression levels of miR-142-5p and miR-155 in gastric MALT lymphoma cases before and after H. pylori eradication therapy. [score:3]
Therefore, we focused on TP53INP1 as a common target of miR-142-5p and miR-155. [score:3]
The base pairings between miR-142-5p and miR-155 and their putative target sites in the 3′ UTR of TP53INP1 mRNA are shown. [score:3]
Overexpression of miR-142-5p and miR-155 in an animal mo del of gastric MALT lymphoma. [score:3]
0047396.g003 Figure 3Expression levels of miR-142-5p and miR-155 in an animal mo del of gastric MALT lymphoma. [score:3]
As shown in Figure 1, the levels of expression of miR-142-5p and miR-155 in MALT lymphoma lesions that were resistant to H. pylori eradication were significantly higher than in cases showing complete remission (CR) after H. pylori eradication (p<0.0001 and p<0.005, respectively). [score:3]
The levels of miR-142-5p and miR-155 expression were evaluated using quantitative RT-PCR and normalized to the expression of U6 RNA. [score:3]
The expression levels of miR-142-5p and miR-155 showed no significant differences. [score:3]
Expression levels of miR-142-5p and miR-155 in gastric MALT lymphoma cases before and after H. pylori eradication therapy. [score:3]
On the other hand, in patient #1 with gastric MALT lymphoma harboring the API2-MALT1 fusion gene that was resistant to H. pylori eradication, there was no significant difference in the expression levels of miR-142-5p and miR-155 (Figure 2B). [score:3]
As shown in Fig. 4A, ‘seed’ matches between the 5′ end of the miRNAs and the 3′ UTR of TP53INP1 were stronger in miR-155 than in miR-142, suggesting that miR-155 may have a more profound effect on suppression of TP53INP1. [score:3]
These findings indicate that the levels of miR-142-5p and miR-155 expression have potential applicability as novel biomarkers of gastric MALT lymphoma. [score:3]
Levels of miRNA expression were analyzed using quantitative RT-PCR and the TaqMan microRNA assay for miR-142-5p and miR-155 (Applied Biosystems, Foster City, CA), in accordance with the manufacturer's instructions. [score:2]
To validate the microarray data, we performed quantitative RT-PCR for miR-142-5p and miR-155 in 20 cases of gastric MALT lymphoma. [score:1]
org), revealed that both miR-142-5p and miR-155 are able to bind to the 3′ UTR of the mRNA of the proapoptotic gene TP53INP1 (Tumor Protein P53 Inducible Nuclear Protein 1). [score:1]
The miR-142-5p and miR-155 precursor molecules and negative control precursor miRNAs were purchased from Ambion. [score:1]
In addition, we investigated the correlation between the levels of miR-142-5p and miR-155 expression and the clinical courses of gastric MALT lymphoma cases. [score:1]
miR-142-5p and miR-155 as novel biomarkers of gastric MALT lymphomaThe patients with gastric MALT lymphoma were divided into two groups according to their response to H. pylori eradication therapy (Table 1). [score:1]
Further studies involving more patients are warranted to explore the clinical use of miR-142-5p and miR-155 for diagnosis and treatment of gastric MALT lymphoma. [score:1]
miR-142, miR-155 and miR-223 have been reported to be hematopoiesis-specific miRNAs [24]. [score:1]
The luciferase activities of the AGS cells transfected with the TP53INP1-WT construct were significantly lower after transfection of miR-142-5p and miR-155, whereas those transfected with the TP53INP1-MUT construct or the pGL3 control vector (empty vector) showed no significant differences. [score:1]
The luciferase activities of the AGS cells transfected with the TP53INP1-WT construct were significantly lower after transfection with miR-142-5p and miR-155 (p<0.05 and p<0.005, respectively), whereas those of cells transfected with the TP53INP1-MUT construct and the pGL3 control vector (empty vector) showed no significant differences (Figure 4B). [score:1]
miR-142-5p and miR-155 as novel biomarkers of gastric MALT lymphoma. [score:1]
[1 to 20 of 55 sentences]
14
[+] score: 169
In the case for ADCY9, miR-142-3p was reported to target this gene, resulting in the regulation of cAMP that is crucial to the suppressive effect enforced by in CD4(+) CD25(−) regulatory T cells during the resolution of the inflammatory response (Huang et al., 2009). [score:7]
Given its involvement during early events of phagocytosis (McGee et al., 2001; Caron et al., 2006; Park and Cox, 2009; Dart et al., 2012), and the strong prediction for it being a gene target for miR-142-3p (Tables 1 and 3), we asked whether this miRNA may target the 3′-UTR mRNAs Wasl (mRNA for N-Wasp). [score:5]
Moreover, miR-142-3p expression is associated to normal myeloid leukocyte differentiation (Careccia et al., 2009), and among its bona fide gene targets in the immune system, include the pro-inflammatory cytokine IL-6 that plays an essential role in protective and pathological immune responses (Sun et al., 2011). [score:5]
Bold entries represent actin binding proteins potential targets of miR-142-3p Table 3 Molecular functions go term enrichment analysis of predicted gene targets of mmu-miR-142-3p. [score:5]
Indeed, the control of these two gene targets indicates miR-142-3p can influence both arms of the immune system, and that aberrant expression of this miRNA (e. g., due to a microbial hijacking strategy), could then result in a defective inflammation response that is counter-productive to host fitness. [score:5]
Bold entries represent actin binding proteins potential targets of miR-142-3p Table 3 Molecular functions go term enrichment analysis of predicted gene targets of mmu-miR-142-3p. [score:5]
Finally, while miR-142-5p is generated along with miR-142-3p after maturation of the pre-miR-142 (Wu et al., 2009), it ultimately failed to target the mRNA sequence for Cdc42ep4 mRNA 3′-UTR, a Rho GTPase that regulates signaling pathways controlling diverse cellular functions including endocytosis (Data not shown). [score:4]
The expression of miR-142-3p was first reported to be exclusive to cells of the hematopoietic system, with aberrant dys-regulation in T-cell and B-cell leukemia (Bellon et al., 2009). [score:4]
Targeting of microRNA-142-3p in dendritic cells regulates endotoxin -induced mortality. [score:4]
In the case of IL-6, the high expression of miR-142-3p in murine and human dendritic cells was demonstrated to be essential to regulate the biosynthesis of this cytokine and prevent endotoxin -induced mortality (Sun et al., 2011). [score:4]
Collectively, we demonstrate that: (1) mycobacteria infection of Mφs results in a short-lived induction of miR-142-3p, and in the case of Mtb, accompanied by a partial decrease of N-Wasp protein levels (2) N-Wasp mRNA (Wasl) is a direct target for miR-142-3p, (3) miR-142-3p leads to a significant decrease of intracellular mycobacteria intake by Mφs, and (4) the siRNA -mediated inactivation of N-Wasp in human Mφs affects the initial rate of phagocytosis of Mtb. [score:4]
To assess this, we again employed the use of either “mimics” or “inhibitors” of miR-142-3p activity. [score:3]
Altogether, this demonstrates that Wasl is indeed a target of miR-142-3p. [score:3]
Unlike the treatment with mimics, Mφs transfected with inhibitors of miR-142-3p and subsequently challenged with these mycobacterial strains showed no significant change in the protein levels of N-Wasp, implying that a compensatory effect was occuring (Data not shown). [score:3]
As shown in Figure 1B, we observed at 1 hpi a slight, but significant induction miR-142-3p expression that was, however, short-lived: it returned to basal levels at 4 hpi. [score:3]
Our previous results confirmed that miR-142-3p targets the mRNA sequence of N-Wasp, suggesting it may influence the level of N-Wasp protein, and consequently, the phagocytosis process. [score:3]
Expression of miR-142-3p is induced in murine Mφs upon mycobacteria infection. [score:3]
1 macrophages treated with miR-142-3p mimics (A) or miR-142-3p inhibitors (B), and challenged with M. tuberculosis (MOI 10) for 4 h. Blue (DAPI), green (H37Rv-eGFP), and Light red/orange (Rhodamine-Phalloidin). [score:3]
Human Mφs were exposed to latex beads (to induce a “sterile” phagocytosis process), or challenge with either M. smegmatis or Mtb, and the miR-142-3p expression was quantified by qPCR analysis. [score:3]
The third contribution of this study is the suggestion that a novel but general strategy in the context of mycobacteria infection is the role of miRNAs in modulating mycobacterial uptake by phagocytic cells, revealed by the partial and temporal inhibition of N-Wasp activity via miR-142-3p. [score:3]
1 macrophages treated with miR-142-3p mimics (A) or miR-142-3p inhibitors (B), and challenged with M. smegmatis (MOI 10) for 4 h. Arrows indicate phagocytic cups. [score:3]
Figure 2 N-Wasp is a target of miR-142-3p. [score:3]
Bona fide targets for miR-142-3p include RAC1, CD133, IL-6, and ADCY9 (Huang et al., 2009; Bissels et al., 2011; Sun et al., 2011; Wu et al., 2011). [score:3]
As shown in Figure 2A, the relative luciferase activity is lower in the pair miR-142-3p/Wasl relative to the control, indicating that the miR-142-3p targets the Wasl mRNA 3′-UTR with high probability (P < 0.01). [score:3]
Figure 5 Expression of miR-142-3p and N-Wasp levels in infected human primary macrophages. [score:3]
Our results indicate that while Mtb infection of human Mφs specifically induces the expression of miR-142-3p, challenge with M. smegmatis or exposure to latex beads failed to do so (Figure 5A, left). [score:3]
Our findings in the murine mo del suggest that Mtb induces the timely expression of miR-142-3p in order to down-modulate the function of N-Wasp protein, and therefore, modulate the uptake by phagocytic cells. [score:3]
As shown in Figure 2B, Mtb significantly induced the expression levels for miR-142-3p at 1 hpi similar to that obtained with M. smegmatis challenge. [score:3]
MicroRNA-142-3p, a new regulator of RAC1, suppresses the migration and invasion of hepatocellular carcinoma cells. [score:3]
This analysis showed that ABPs and cytoskeletal -binding proteins are indeed strongly enriched as potential targets of the miR-142-3p (Table 3). [score:3]
The miR-142-3p mimics and inhibitors (Dharmacon, Lafayette, CO, USA) were used for transient transfection in gain or loss-of-function experiments, respectively. [score:3]
Yet, similar to the pattern obtained during infection with M. smegmatis, the induction caused by Mtb was short-lived, as the expression levels for miR-142-3p drops considerably at 4 hpi and remains low at 24 hpi (Figure 2B). [score:3]
1 Mφs infected with M. smegmatis was slightly lower in the qPCR analysis compared to those obtained from the microarray data, they supported the notion that miR-142-3p is up-regulated at the earliest stage of infection. [score:3]
We employed the use of either “mimics” of miR-142-3p to imitate and increase its behavior (gain-of-function), or “inhibitors” to nullify its activity (loss-of-function), as described in Materials and Methods. [score:3]
In order to test this hypothesis, we first verified whether the pathogenic Mtb strain H37Rv was capable of modulating the miR-142-3p expression as M. smegmatis. [score:3]
The miR-142-3p is predicted to target two mRNAs encoding for ABPs, cofilin2 (Cfl2) and Wiskott-Aldrich Syndrome-Like (human) (N-Wasp), which are involved during the early events of phagocytosis (McGee et al., 2001; Caron et al., 2006; Park and Cox, 2009; Dart et al., 2012). [score:3]
Mtb induces miR-142-3p expression while decreasing that of N-WASP in human primary Mφs. [score:3]
In this manner, Mφs were transfected with mimics or inhibitors of miR-142-3p and subsequently challenged with either M. smegmatis or Mtb for 1 h. Whole cell extracts were then prepared for western blot analyses. [score:3]
miR-142-3p restricts cAMP production in CD4+CD25− T cells and CD4+CD25+ TREG cells by targeting AC9 mRNA. [score:3]
The modulation of miR-142-3p expression partially influences the amount of N-WASP protein. [score:3]
The mRNA for N-WASP is targeted by miR-142-3p. [score:3]
The second major contribution of this study is identification of miR-142-3p as a key candidate involved in the regulation of actin dynamics required in phagocytosis. [score:2]
org) with the potential to regulate ABP activity, we therefore ruled out that miR-142-5p can influence the early events of phagocytosis in concert with miR-142-3p. [score:2]
Therefore, if miR-142-3p plays a role in regulating N-Wasp activity, then it is only early on during the interaction with mycobacteria, such as the phagocytosis process. [score:2]
MicroRNA-29a and microRNA-142-3p are regulators of myeloid differentiation and acute myeloid leukemia. [score:2]
Next, to examine whether miR-142-3p is able to regulate N-Wasp expression in Mφs, we conducted gain-of-function and loss-of-function experiments in order to measure N-Wasp protein levels during mycobacterial infection. [score:2]
The reduction of N-Wasp expression by the treatment mimicking miR-142-3p of Mφs infected with either mycobacterial strain, prompted us to investigate for a possible role for this miRNA in controlling the early stages of phagocytosis. [score:1]
Beyond the identification of miR-142-3p as a key candidate, and its implications (discussed below), there are 9 miRNAs (i. e., miR: 29, 93, 101, 181, 207, 329, 451, 574, and 684) in our list that are reported to be similarly modulated in multiple mycobacterial infection contexts (Fu et al., 2011; Ma et al., 2011; Sharbati et al., 2011; Wang et al., 2011; Yi et al., 2012). [score:1]
We performed a time course of infection (1, 4, and 24 hpi) with either strains and measured the miR-142-3p expression by qPCR analysis. [score:1]
miR-142-3p activity correlates with a reduction of the amount of internalized mycobacteria per Mφ. [score:1]
A representative blot from three independent experiments is shown with the densitometry quantification: quantification of the relative levels of N-Wasp in infected macrophages, treated with either mimics of miR-142-3p or scramble ([*] P ≤ 0.01; [**] P ≤ 0.001). [score:1]
Identification of the specificity of miR-142-3p to the 3′-UTR mRNA of N-WASP. [score:1]
The transfection efficiency achieved was approximately 90%, as evaluated by confocal microscopy using a miR-142-3p inhibitor labeled with Alexa 594 fluorochrome (Exiqon, Vedbaek, Denmark). [score:1]
In primary human Mφs, however, only the challenge with virulent Mtb resulted in rapid high levels of miR-142-3p over background, peaking at 4 h and declining thereafter. [score:1]
We argue that the miRNA list provided in this report have potential roles in these activities, all in some way relying on the host cell cytoskeleton, as evidenced by the role of miR-142-3p in partially controlling N-Wasp in activity in the process of phagocytosis. [score:1]
The induction of miR-142-3p as detected by our microarray analysis was confirmed by qPCR analysis with both non-virulent and virulent mycobacterial strains. [score:1]
1 macrophages transfected with mimics of miR-142-3p or not, and that of internalized mycobacteria (MOI 10) after a 1-h challenge. [score:1]
Next, we measured whether the difference in miR-142-3p expression obtained from the challenge with either mycobacterial strain at 1 hpi is sustained throughout infection. [score:1]
Based on these criteria, the miR-142-3p was selected as the best candidate for further study. [score:1]
Right: relative expression of miR-142-3p in human macrophages infected with M. smegmatis or M. tuberculosis as the indicated time points, as measured by EXIQON (DK) microRNA qPCR services. [score:1]
Given the Mtb is the etiological agent of TB in humans, and that human Mφs are the primary replication site for this obligate intracellular pathogen, we used primary human monocyte-derived Mφs in order to investigate whether the expression of miR-142-3p leads to a subsequent reduction of N-Wasp and alter the rates of phagocytosis. [score:1]
Altogether, these results suggest that the modulation of N-Wasp function via miR-142-3p might contribute to the phagocytosis process of Mtb in human cells. [score:1]
All things considered, our findings strongly suggest that effective modulation of N-Wasp activity via miR-142-3p can influence the rate of bacterial intake by Mφs, and to our knowledge, this is the first description of a microbial strategy employing the use of miRNAs to regulate actin -mediated events leading to phagolysosome biogenesis. [score:1]
[1 to 20 of 63 sentences]
15
[+] score: 161
A miR-142-3p inhibitor was used to down-regulate the expression of miR-142-3p. [score:8]
The expression of RAC1, a known target of miR-142-3p [25], was significantly down-regulated in the HCC cells following incubation with TAMs from the propofol -treated HCC tissue (Figure  2C and 2D), suggesting that the level of functional miR-142-3p levels increased in the HCC cells. [score:8]
We showed that propofol stimulated miR-142-3p shuttling from macrophages to HCC cells and that miR-142-3p down-regulated RAC1 expression, thus, inhibiting HCC cell migration and invasion. [score:8]
However, the expression of miR-142-3p was not up-regulated when the Hepa1-6 cells were directly treated with propofol (Figure  3I). [score:7]
Second, the administration of MVs from propofol -treated macrophages increased miR-142-3p levels in HCC cells, but propofol itself did not up-regulate miR-142-3p expression in HCC cells. [score:6]
A previous study confirmed that miR-142-3p suppressed migration and invasion of HCC cells through down-regulation of RAC1 [19]. [score:6]
More importantly, down-regulation of miR-142-3p expression reversed the effect of propofol on HCC cell migration. [score:6]
More importantly, down-regulation of the expression miR-142-3p reversed the effect of propofol on HCC cell migration. [score:6]
The mice were then randomly divided and assigned to the following treatments (n = 8 in each group): 20 mg/kg of propofol, 100 μg/kg of clodrolip, 20 mg/kg of propofol + 100 μg/kg of clodrolip, 50 mg/kg of propofol, 50 mg/kg of propofol + 100 μg/kg of clodrolip, 20 μg of MVs, the miR-142-3p inhibitor, or 20 mg/kg of propofol + the miR-142-3p inhibitor. [score:5]
Propofol drastically inhibited tumor growth in tomor-bearing mice through macrophage activation, and stimulated tumor -associated macrophages (TAMs) to secrete microvesicles (MVs), which delivered miR-142-3p to HCC cells, resulting in the inhibition of HCC cell invasion. [score:5]
However, the inhibition of tumor growth by propofol (20 mg/kg) was restored by the miR-142-3p inhibitor (Figure  5E and 5F). [score:5]
A previous study demonstrated that miR-142-3p prevents the differentiation of macrophages and inhibits their immunosuppressive function in tumors [24]. [score:5]
The expression of miR-142-3p (C) and the invasion ability (D) were detected in Hepa1-6 cells treated with MVs from Raw 264.7 cells transfected with Nc or miR-142-3p inhibitor. [score:5]
For the knockdown of miR-142-3p, miR-142-3p inhibitor or a negative-control (Nc) was used at the concentration of 100 nM. [score:4]
We demonstrated that the miR-142-3p in the MVs was taken up by HCC cells and subsequently inhibited cell migration. [score:3]
The Nc and the miR-142-3p inhibitor (10 nmol) in 0.1 ml of saline buffer were administered intratumorally every 2 days for 3 weeks. [score:3]
The MVs from the propofol -treated cells (5 μg/ml) that were transfected with the miR-142-3p inhibitor significantly decreased miR-142-3p levels in Hepa1-6 cells and stimulated the migration of these cells (Figure  5C and 5D). [score:3]
We demonstrated that propofol exerted anti-HCC activity by modulating the expression of miR-142-3p in macrophage-derived MVs. [score:3]
To explore the mechanism underling the involvement of TAMs in the antitumor activity of propofol, we measured the expression of a number of miRNAs, including miR-142-3p, miR-199a, miR-122, and miR-29, which may act as tumor suppressors in HCC [23]. [score:3]
After an intratumoral injection of the miR-142-3p inhibitor, the size of the tumors in the tumor-bearing mice slightly increased. [score:3]
As a target of miR-142-3p, RAC1 plays a key role in tumor cell growth, migration and invasion [29, 30]. [score:3]
First, miR-142-3p plasma levels were increased in the MVs of the propofol -injected mice, and this significantly inhibited tumor growth. [score:3]
To further explore the role of miR-142-3p in MVs from macrophages, we treated Raw 264.7 cells with an miR-142-3p inhibitor. [score:3]
Wu et al. has demonstrated that miR-142-3p plays an important role in inhibiting migration and invasion of HCC cells [19]. [score:3]
We further analyzed the effect of propofol on the expression of miR-142-3p in macrophages and MVs in vitro. [score:3]
By depleting miR-142-3p expression, we showed that the miR-142-3p in the MVs accounted for the anti-HCC effect of propofol. [score:3]
The results of real-time PCR showed that the miR-142-3p inhibitor profoundly reduced the levels of miR-142-3p in the Raw 264.7 cells and MVs (Figure  5A and 5B). [score:3]
Propofol stimulated TAMs to secrete MVs and deliver miR-142-3p to HCC cells, resulting in the inhibition of HCC cell invasion. [score:3]
A cholesterol-conjugated miR-142-3p inhibitor and a negative control (Nc) oligonucleotide for in vivo RNA delivery were purchased from RiboBio (Guangzhou, China). [score:3]
Thus, modulation of miR-142-3p expression and activity may be a novel approach to HCC therapy. [score:3]
To determine whether propofol treatment stimulated miR-142-3p shuttling from macrophages to the HCC cells, we determined the expression of miR-142-3p in macrophages and MVs secreted from macrophages. [score:3]
This study reveals a novel role for propofol in the inhibition of HCC through MV -mediated transfer of miR-142-3p from macrophages to cancer cells in vivo. [score:3]
More importantly, miR-142-3p exerts anti-tumor effect by regulation of the differentiation of macrophages [20]. [score:2]
As expected, the expression of miR-142-3p in the TAMs of the tumor-bearing mice injected with propofol was obviously increased compared with those of the soybean oil -injected mice (Figure  3A). [score:2]
The administration of propofol stimulated miR-142-3p shuttling from macrophages to HCC cells. [score:1]
The level of miR-142-3p was determined (E) in Raw 264.7 cells treated with different concentration of propofol for 24 h and (F) in MVs from Raw 264.7 cells. [score:1]
The co-culture system was used to verify that miR-142-3p was transported from macrophages to HCC cells. [score:1]
The level of miR-142-3p was determined (A) in TAMs from tumor-bearing mice injected with propofol, (B) in MVs from propofol -treated TAMs and (C) in Hepa1-6 cells treated with MVs from propofol -treated TAMs. [score:1]
Hepa1-6 cells cocultured with TAMs (1:1) from the propofol -treated HCC tissue exhibited a dose -dependent increase in cellular miR-142-3p levels relative to cells that were cocultured with TAMs from soybean oil -treated HCC tissue (Figure  2A). [score:1]
miR-142-3p was involved in the anti-tumor activity of propofol. [score:1]
These results indicate that miR-142-3p was involved in the anti-HCC activity of propofol. [score:1]
Third, MVs shed from propofol -injected TAMs were enriched in miR-142-3p. [score:1]
Cocultivation with TAMs from the propofol–treated HCC tissue increased miR-142-3p levels in HCC cells. [score:1]
These results suggest that secreted miR-142-3p may be involved in the anti-HCC effect of propofol. [score:1]
The levels of miR-142-3p, miR-199a, miR-122, and miR-29 were quantified with a TaqMan PCR kit. [score:1]
The levels of miR-142-3p were significantly increased in the Hepa1-6 cells incubated with the MVs of the propofol -treated TAMs (Figure  3C). [score:1]
Figure 2 Co-cultivation with TAMs from propofol–treated HCC tissue increased miR-142-3p levels in HCC cells. [score:1]
Plasma miR-142-3p levels were increased in the tumor-bearing mice treated with the MVs of the propofol -injected mice (Figure  4A). [score:1]
Propofol Hepatocellular carcinoma Microvesicles RAC1 miR-142-3p Hepatocellular carcinoma (HCC), a primary malignant tumor, has a poor prognosis and is the third cause of tumor-related deaths in China [1, 2]. [score:1]
Consistent with this observation, the level of miR-142-3p in the MVs from the propofol -treated TAMs was also higher than that in the soybean oil -treated mice (Figure  3B). [score:1]
Figure 3 Propofol stimulated miR-142-3p shuttling from macrophages to HCC cells. [score:1]
Briefly, the Raw 264.7 cells were exposed to different concentrations of propofol for 24 h. The levels of miR-142-3p were dose -dependently elevated in both macrophages and MVs (Figure  3E and 3F). [score:1]
Figure 5 miR-142-3p was involved in the effect of propofol on anti-tumor activity. [score:1]
[1 to 20 of 53 sentences]
16
[+] score: 157
Other miRNAs from this paper: mmu-mir-142a, mmu-mir-294, mmu-mir-10a, mmu-mir-504
We demonstrate for the first time that the microRNA, miR-142-3p, directly regulates D1 receptor post-transcriptional regulation in CAD cells and that its expression is inversely correlated to D1 receptor protein expression during postnatal mouse brain development. [score:9]
Taken together, these results strongly suggest miR-142-3p directly regulates the D1 receptor 3′UTR -mediated translational repression of D1 receptor expression in CAD cells. [score:7]
Our novel finding that miR-142-3p is expressed in the brain and directly regulates the expression of D1 dopamine receptor protein suggests that miR-142-3p might play an important role in modulating D1 receptor -dependent behaviors. [score:7]
The regulation of endogenous D1 receptor expression by miR-142-3p is biologically significant as inhibition of miR-142-3p increased endogenous D1 receptor protein levels (Fig. 8) and enhanced D1 receptor signaling as evidenced by increased cAMP production and phospo-DARPP-32 levels (Fig. 9). [score:6]
Expression level of miR-142-3p in postnatal striatal development is inversely correlated to D1 receptor protein expression. [score:6]
Finally, we showed that the expression of miR-142-3p was inversely correlated to D1 receptor protein expression during postnatal mouse brain development (Fig. 10). [score:6]
Inhibition of miR-142-3p increases endogenous D1 receptor protein expression in CAD cells. [score:5]
To inhibit microRNA function, anti-mirs that specifically targeted miR-142-3p (Ambion) were transfected at a concentration of 30 nM per well (for a 12-well plate). [score:5]
In functional experiments, endogenous miR-142-3p was also inhibited using a miRZip™ anti-sense microRNA expressing plasmid with anti-miR-142-3p activity (System Biosciences, Mountain View, CA, USA). [score:5]
To further confirm these results and to determine if the miR-142-3p translation repression was maintained in the context of a heterologous 3′UTR, we cloned the 1277 bp wild type and the three mutated D1 receptor 3′UT regions into a β-galactosidase expression plasmid with a heterologous bovine growth hormone (BGH) poly adenylation site (Fig. 7A). [score:5]
This suggests that miR-142-3p -mediated post-transcriptional regulation might regulate translation of D1 receptor protein in dendritic spines. [score:5]
Interestingly, lipopolysaccharide (LPS) treatment decreases the expression of miR-142-3p in dendritic cells, specifically relieving the translational repression of the interleukin-6 (IL-6) mRNA and increasing the level of secreted IL-6 [20]. [score:5]
Our observations suggest that miR-142-3p mediated regulation of D1 receptor expression might contribute to T-cell differentiation. [score:4]
The identification of miR-142-3p as a regulator of D1 receptor expression was unexpected as the function of this microRNA has been previously described only in hematopoietic cells and lymphocytes were it was shown to modulate the differentiation of various classes of T-cells [20]. [score:4]
This result is consistent with above studies and suggested that the miRZip™ anti 142-3p plasmid also inhibits endogenous miR-142-3p and relieves D1 receptor post-transcriptional regulation in non-differentiated CAD cells. [score:4]
Together these results strongly suggest that the miR-142-3p mediated regulation of D1 receptor protein expression is biologically significant. [score:4]
The experiments in Figures 6, 7 and 8 suggested that mutating the miR-142-3p or knocking down miR-142-3p levels using anti-mirs increases the protein expression ∼80%. [score:4]
The result in Figure 10B shows that there is a significant reduction in miR-142-3p expression on P14 and P30 compared to P7 which inversely correlates with the increase in D1 receptor protein expression. [score:4]
Figure S1 Schematic representation of the binding sites for miR-294/295-3p, miR-142-3p and miR-10a* in D1 receptor 3′UTR and the seed recognition nucleotides that were targeted for mutation. [score:4]
These results are consistent with a previous study which showed that mir-142-3p is not only expressed in the brain but is enriched in purified striatal post-synaptic densities along with the Argonaute protein-2, which is a key protein involved in microRNA -mediated post-transcriptional regulation [29]. [score:4]
The EC [50] values for D1 receptor agonist, A77636, were similar (0.136 nM versus 0.142 nM for control and miRZip™ anti 142-3p, respectively) suggesting that the inhibition of miR-142-3p specifically affected E [max]. [score:3]
Furthermore, specific inhibition of endogenous miR-142-3p in CAD cells increases D1 receptor protein levels and enhances D1 receptor mediated-signaling. [score:3]
The expression of miR-142-3p is particularly high in the antigen-presenting dendritic cells [20]. [score:3]
The results confirmed that the D1 receptor 3′UTR repressed the translation of the β-galactosidase reporter protein in the presence of a heterologous poly adenylation site and this repression was abolished by specifically mutating the recognition site for miR-142-3p (Figure 7B). [score:3]
While miR-142-3p function has been primarily described in the hematopoietic and immune systems, our results suggest that this microRNA is also expressed in the brain and in the neuronal CAD cell line. [score:3]
To determine if miR-142-3p modulates the expression of endogenous D1 receptor protein in CAD cells, we transiently -transfected anti-mirs that specifically targeted miR-142-3p and measured endogenous D1 receptor protein levels. [score:3]
Deletion and site-directed mutagenesis studies showed that the D1 receptor post-transcriptional regulation in CAD cells is mediated by a specific interaction of miRNA miR-142-3p with a single cis-element adjacent to the first poly adenylation signal site in the D1 receptor 3′UTR (Figs. 5, 6, and 7). [score:3]
These results suggest that miR-142-3p might be involved in the D1 receptor post-transcriptional regulation during postnatal mouse brain development. [score:3]
Inhibition of miR-142-3p enhances D1 receptor signaling in CAD cells. [score:3]
Antisense -mediated Inhibition of miR-142-3p in CAD Cells Enhances D1 Receptor Signaling Function. [score:3]
To determine if this increase was biologically significant, we next determined the effect of inhibiting endogenous miR-142-3p on endogenous D1 receptor signaling function in CAD cells. [score:3]
The results in Figure 8 show that anti-mir mediated inhibition of miR-142-3p significantly increased D1 receptor protein levels in non-differentiated and differentiated CAD cells when compared to a FAM-labeled negative control anti-mir. [score:2]
The results show that mutation of the miR-142-3p recognition site in the 1277 bp D1 receptor 3′UTR, but not the 10a* or 294/295 sites, significantly increased the β-galactosidase reporter enzyme activity in both non-differentiated and differentiated CAD cells. [score:2]
To determine the effect of inhibiting miR-142-3p on D1 receptor signaling function, we transfected non-differentiated CAD cells with miRZip™ anti 142-3p or empty miRZip™ vector plasmids and compared D1 receptor stimulated increase in intracellular cAMP levels. [score:2]
D1 receptor post-transcriptional regulation is mediated by D1 receptor 3′UTR and miR-142-3p even in the presence of a heterologous 3′UTR polyadenylation signal. [score:2]
To further assess the biological significance of miR-142-3p regulation of D1 receptor expression, we evaluated the ability of D1 receptors to activate DARPP-32 in CAD cells transfected with miRZip™ anti 142-3p or empty miRZip™ vector plasmids. [score:2]
D1 receptor post-transcriptional regulation is mediated by microRNA miR-142-3p. [score:2]
Given the results of the deletion experiments in Figure 5A and the Dicer knock-down experiments in Figure 6, we generated pCMV β-gal+D1 3′UTR (1277 bp) constructs in which we specifically mutated nucleotides in the 1277 bp D1 receptor 3′UTR that were complementary to the seed sequence of microRNA miR-142-3p (Fig. 5B) and two other microRNAs (miR-294/295 and 10a*). [score:2]
Representative western blot (A) and cumulative data (B) showing the levels of D1 receptor protein normalized to total protein in non-differentiated (ND) and differentiated (D) CAD cells 48 hours post-transient transfection with 30 nM per well (in 12-well plate) FAM-labeled negative control anti mir (FAM Anti-mir) or mmu-miR-142-3p anti-mir. [score:1]
The poly adenylation signal and the consensus binding site for microRNA miR-142-3p are shown. [score:1]
To decrease the levels of miR-142-3p, in these experiments we used the miRZip™ anti-sense 142-3p plasmid construct. [score:1]
0049288.g008 Figure 8Representative western blot (A) and cumulative data (B) showing the levels of D1 receptor protein normalized to total protein in non-differentiated (ND) and differentiated (D) CAD cells 48 hours post-transient transfection with 30 nM per well (in 12-well plate) FAM-labeled negative control anti mir (FAM Anti-mir) or mmu-miR-142-3p anti-mir. [score:1]
Partial nucleotide sequence (from nucleotides 560 to 1250) of the 1277 bp D1 3′UTR that shows the putative binding sites (highlighted in yellow) for miR-294/295-3p, miR-142-3p and miR-10a*. [score:1]
Sequence analysis of the 94 bp D1 receptor 3′UTR fragment revealed a consensus binding site for the highly conserved microRNA, miR-142-3p (Fig. 5B). [score:1]
For these functional experiments we also generated and used a negative control empty miRZip™ vector plasmid in which the nucleotides encoding the anti-sense miR-142-3p were deleted. [score:1]
[1 to 20 of 45 sentences]
17
[+] score: 152
Apparently, miR-142-3p does not influence the expression of Foxp3, but Foxp3 regulates, directly or indirectly, the expression of miR-142-3p [19]. [score:8]
Expression analysis for two miR-142 mature isoforms on the RNA extracted from spinal cord tissue showed substantial upregulation of miR-142a-5p and miR-142a-3p in the lumbar spinal cord in peak of disease and post peak phases of EAE compared with control mice (Fig.   1c). [score:7]
3′UTR cloning and luciferase assays were then carried out to identify direct mRNA targets of miR-142, followed by quantifying the expression of targets in CNS tissue and cultured cells. [score:7]
These data indicate that miR-142 isoforms can be upregulated in T cells following exposure to the antigen and activation of TCR signaling and their upregulation, at least for the 5p isoform, might be able to influence CD4 T cell status towards the more pathogenic Th1 phenotype (Fig.   3c). [score:7]
Our data suggest that the miR-142 isoforms could target transcripts which are involved in cytokine signaling and, thereby affecting the phenotype of neuroantigen-reactive T cells infiltrating the nervous system during disease. [score:5]
While the current study is chiefly focused on miR-142 expression in T cells, we believe that both T cells and activated microglia in the NAWM contribute to enhanced miRNA expression in the tissues from MS patients. [score:5]
In this study, we first used human brain autopsy samples as well as central nervous system (CNS) tissue derived from EAE animals at different time points after disease induction to investigate the expression of miR-142-5p and miR-142-3p isoforms in disease tissues. [score:5]
Data are shown as mean ± SEM, ** p < 0.01, * p < 0.05, one-way ANOVA To confirm altered expression of miR-142 in MS white matter, we analyzed the expression of miR-142-3p and miR-142-5p isoforms in normal-appearing cerebral white matter from MS and non-MS cases by real-time PCR. [score:5]
To confirm altered expression of miR-142 in MS white matter, we analyzed the expression of miR-142-3p and miR-142-5p isoforms in normal-appearing cerebral white matter from MS and non-MS cases by real-time PCR. [score:5]
Expression of miR-142 isoforms target genes in stimulated splenocytes was determined by real-time RT-PCR. [score:5]
TargetScan and miRDB predicted targets for miR-142-3p and miR-142-5p. [score:5]
Consistent with previous reports [32], our in vitro gene expression studies showed expression of miR-142 mature isoforms in both T cells and primary macrophages. [score:5]
To investigate the potential mRNA transcripts which might be targeted by each of miR-142 isoforms, we extracted a list of predicted mRNA targets from TargetScan and miRDB databases. [score:5]
Immature mir-142 generates two mature isoforms; miR-142-3p and miR-142-5p which have both been implicated in regulation of leukocyte activity and also in inflammatory diseases [17– 20]. [score:4]
In the context of autoimmune neuroinflammation, upregulation of miR-142-5p have been reported in MS brain tissue in miRNA-profiling studies [5, 8, 14]. [score:4]
Expression of inflammation-related transcripts are regulated by miR-142 isoforms. [score:4]
Indeed, it has been reported that miR-142-3p reduces the production of cyclic 3′5′-adenosine monophosphate (cAMP), a molecule required for regulatory function of Tregs, by suppressing adenylyl cyclase (AC) 9 mRNA in T cells and macrophages. [score:4]
Conversely, some T cell studies have reported downregulation of miR-142-3p. [score:4]
miR-142 isoforms are upregulated in the CNS of MS patients and animals with EAE. [score:4]
The results revealed downregulation of multiple miRNAs including miR-142-3p in T cells derived from MS patients [38]. [score:4]
Interestingly, inhibition of miR-142-3p prevented an increase in glutamergic transmission caused by exposure of cerebellar slices to CSF from MS patients [21]. [score:3]
Moreover, high expression of miR-142-3P in EAE brain tissue and CSF of patients with multiple sclerosis during active inflammation has been illustrated [21]. [score:3]
In the case of TGFBR2 our data did not reveal evidence of direct interactions, however, considering the results of T cells transfection experiments, it seems that miR-142-3p might be able to affect TGFBR2 levels, perhaps by indirect means. [score:3]
Overall, these data indicate that splenocytes are able to enhance their expression of miR-142 isoforms after antigen-specific or polyclonal activation, and hence, they might be responsible for higher levels of miRNA transcripts identified in MS and EAE CNS tissues. [score:3]
Studies on blood cells have also linked miR-142-3p with MS disease process. [score:3]
In this study, we show that SOCS1 levels are diminished in MS tissues, and that it could be targeted by miR-142-5p, a finding that can be viewed important both from the perspectives of understanding MS pathogenesis and potential therapeutic interventions. [score:3]
Arruda et al. have recently reported enhanced miR-142-3p expression in CD4 [+] and CD8 [+] T cells from MS patients [37]. [score:3]
Our findings suggest that increased expression of miR-142 isoforms might be involved in the pathogenesis of autoimmune neuroinflammation by influencing, and this effect could be mediated by interaction of miR-142 isoforms with SOCS1 and TGFBR-1 transcripts. [score:3]
Our gene expression studies showed increased levels of both miR-142-5p and miR-142-3p isoforms in EAE spinal cord, and in MS brains miR-142-5p showed statistically significant increase. [score:3]
Overexpression experiments in CD4 [+] T cells were performed to examine the effect of miR-142 on. [score:3]
The other isoform of miR-142, i. e., miR-142-3p, has also been implicated in regulating T cell activity. [score:2]
Mandolesi G, De Vito F, Musella A, Gentile A, Bullitta S, Fresegna D, et al. miR-142-3p is a key regulator of IL-1beta -dependent synaptopathy in neuroinflammation. [score:2]
miR-142-3p was shown to regulate IL-1beta -dependent synaptic abnormalities that occur during neuroinflammation. [score:2]
These studies showed that miR-142-5p expression levels were significantly increased in MS brains compared with non-MS brain tissues (Fig.   1a), as previously reported in miRNA-profiling studies [2, 14, 15]. [score:2]
Expression of miR-142-5p was significantly increased in the frontal white matter from MS patients compared with white matter from non-MS controls. [score:2]
In the current study, we focused on the role of miR-142 in autoimmune neuroinflammation that takes place in MS and the EAE. [score:1]
MicroRNAs (miR-142-3p and miR-142-5p) and their predicted target levels were measured by real-time reverse transcription–PCR using SYBR Green dye on a Bio-Rad CFX96 system in cells and tissues. [score:1]
Fig. 1miR-142-3p and miR-142-5p levels in human brain tissue samples and EAE spinal cords. [score:1]
Mandolesi et al. have reported increased levels of miR-142-3p in the CSF of patients with active MS as well as brain tissue from EAE mice [21]. [score:1]
miR-142 isoforms binding region in human and mouse for ADCY9 (b), TGFBR1 (c), TGFBR2, and SOCS1 (d). [score:1]
The expression levels of two mature isoforms of miR-142 were measured in the brains of patients with multiple sclerosis (MS) and the CNS tissues from mice with experimental autoimmune encephalomyelitis (EAE), an animal mo del of MS. [score:1]
mir-142 is broadly conserved between different species, including human and mouse (Additional file 1: Figure S1). [score:1]
Using human brain autopsy samples and EAE CNS tissues, as well as different cell culture systems and molecular analyses, we show that miR-142 isoforms might be involved in the neuroinflammatory processes underlying MS/EAE. [score:1]
miR-142 isoforms homology between human and mouse (a). [score:1]
Some very recent studies have pointed to the role of miR-142 isoforms in MS pathogenesis. [score:1]
[1 to 20 of 45 sentences]
18
[+] score: 151
Third, we overexpressed miR142, one of the identified miRs upregulated in tauopathy, in wildtype brains to examine its impact on gene expression. [score:8]
The expression of miR142-3p was induced at postnatal day 15 and persisted until 6 m. Thus, the upregulation pattern of miR142-3p correlates well with the time course of Tau(P301L) overexpression (OE). [score:8]
Comparison of gene changes in miR142-OE and Tau-OE, based on the mRNA-seq data presented above, revealed 11 upregulated and 22 downregulated genes common between two datasets (Fig.   5A,B; Table  1). [score:7]
miR142-OE caused significant downregulation of 641 genes and upregulation of 501 genes (FDR < 0.05) (Fig.   4D, Supplementary Table  8). [score:7]
Interestingly, applying lentivirus vector carrying miR142-3p expressing cassette in-vitro to (DIV7) primary cortical neurons also led to Gfap and Csf1 upregulation at DIV11 in addition to the increase of miR142-3P (Fig.   5E,F). [score:6]
Here, we provide experimental evidence that neuronal miR142-OE in wildtype brains upregulates expression of many inflammatory genes accompanied by an increase of microglia and reactive astrocytes. [score:6]
Fourth, bioinformatics analysis revealed several overlapping gene transcriptional changes as well as canonical and disease -associated pathways between Tau and miR142 overexpression. [score:5]
Overlapping gene expression changes between miR142 and Tau overexpression. [score:5]
Here we employed IUE to introduce miR142 or control expression cassette into cortical neurons to assess the impact of miR142-OE on the cortical transcriptome at 1 m. Specifically, we electroporated miR142 together with GFP-reporter or with a tdTomato-reporter expression cassette alone (served as control) into the developing cortical plate of wildtype embryos at embryonic day 14.5 (E14.5) and let these embryos developed to term for birth (Fig.   4A). [score:5]
Even though miR142-OE and Tau-OE mo dels target several different genes, a high degree of directional similarity in the pathway regulation was observed between the two groups (Fig.   7). [score:5]
For miR142-OE overexpression experiment, a DNA mixture of pCAG-mGFP (membrane targeted green fluorescent protein [GFP]; a gift from Dr. [score:5]
Overlapping gene expression changes between miR142 and Tau OE prompted us to examine the contributory role of miR142 to the gene networks and disease pathways caused by Tau-OE. [score:5]
The upregulation of Gfap and Csf1 mRNA levels in miR142-OE cortex or Tau(P301L) OE hippocampi are likely to cause the increase of microglia and reactive astrocytes. [score:4]
Upregulation of both miR142-3p and-5p was reported in the prefrontal cortex of LOAD patients [13]. [score:4]
The upregulation of miR142-5p, miR181b, miR219-3p and miR219-5p became significant at 1 m (Fig.   3A). [score:4]
In situ hybridization (ISH) with anti-miR142-5p DNA probe in combination with immunostaining (IHC) using NeuN (recognizing neurons) and Iba-1 (recognizing microglia) antibodies suggest that miR142 upregulation is likely to occur in both neurons and microglia (Supplementary Fig.   4). [score:4]
Figure 5 Gfap and Csf1 mRNAs are up-regulated in both Tau and miR142-OE mice. [score:4]
Using the IUE surgical technique, we were able to provide the first in vivo demonstration that neuronal miR142-OE in wildtype cortex leads to gliosis as well as dysregulation of genes involved in several disease pathways. [score:4]
To determine whether a single CamKIIα-tTA or hTau transgene OE can cause miR142-3P upregulation, we conducted qPCR experiments with 2 m hippocampi from CamKIIα-tTA-only and hTau transgene-only mice. [score:4]
Similar effects were observed in our study, where modest miR142 overexpression in cortical neurons resulted in widespread transcriptome changes. [score:3]
Neuronal miR142 overexpression in developing cortex of wildtype brain leads to many transcriptional changes. [score:3]
Thus, we prioritized miR142-3p, miR142-5p, miR181a, miR181b, miR219-3p and miR219-5p to examine their temporal expression profiles in control and Tau hippocampi. [score:3]
No significant differences in miR142-3p levels were observed between control mice containing neither transgene and control mice with only one of the two transgenes, confirming that CaMKII-tTA transgene alone has no effect on miR142-3p expression (Supplementary Fig.   3). [score:3]
In addition to hippocampus, we found that miR142-3p expression is induced in Tau cortex at 2 m and 6 m (Fig.   3B). [score:3]
Matt Rasband), and miRNASelect™ pEGP-mmu-mir-142 Expression Vector (Cell Biolabs) mixed in equal amounts (1ug/ul each), with a final concentration of 1 μg/μl each) into the left hemisphere of ~50% of the ICR embryos. [score:3]
The top canonical pathways, and top diseases and biofunctions altered by miR142-OE were also analyzed (Supplementary Table  10). [score:3]
Many cytokines and inflammation associated molecules have been characterized as direct or indirect targets of miR142, suggesting its quintessential role in inflammatory processes 33, 36. miR142 alteration has also been associated with many pathological conditions, such as cardiomyopathy, atherosclerosis, osteoarthritis and chronic fibrosis 33, 76, 78, 79. [score:3]
MiR142-OE exerts similar effect as Tau-OE on biological and disease networks. [score:2]
To assess this, we compared the canonical pathways as well as disease and biological functions between miR142-OE and Tau-OE samples. [score:2]
qPCR analysis revealed a modest but significant increase in miR142 (−5p, 1.2 fold; and −3p, 1.4 fold) expression in the cortex prepared from miR142OE when compared with control cortices (Fig.   4C). [score:2]
Thus, manipulating a single miR, such as miR142, can lead to profound changes in biological pathways contributing to neurodegeneration. [score:1]
We found that miR142 (−3p and −5p) induction occurs soon after Tau(P301L) OE triggered by CaMKIIα-tTA, and it persists through later stages. [score:1]
Interestingly, both miR142 OE and Tau OE induced many genes involved in inflammation, including Gfap and Csf1. [score:1]
For 2 m, miR142-3p, miR181b, miR181a (also known as miR213) and miR219-5p were validated; and for 6 m, validation was performed for miR142-3p, miR142-5p, miR339 and miR1249 (Fig.   1C). [score:1]
A recent study highlighted the role of miR142 in multiple sclerosis (MS), a neurodegenerative disease characterized by immune system dysfunction. [score:1]
The MDS plot obtained after mRNA-seq shows clear separation between miR142-OE and control samples (n = 5 per group, Supplementary Fig.   5). [score:1]
We validated these changes using qPCR in both miR142-OE cortex (Fig.   5C) and Tau OE hippocampus (Fig.   5D). [score:1]
The wall of the abdominal cavity and skin were then sutured, and the animals were allowed to develop to term and aged to 1 m. At 1 m old, control and miR142-OE mice were deeply anesthetized and decapitated to harvest brains, For RNAseq analysis, GFP- (miR142-OE) or tdTomato -positive (control) cortical tissues were dissected out from IUE mouse brains. [score:1]
MiR142 is an evolutionary conserved pre-miR that encodes for two separate miRs, miR142-3p and miR142-5p. [score:1]
MiR142-3p has been shown to regulate neuroinflammation associated with Multiple Sclerosis [29]. [score:1]
Figure 7Gene network and pathway overlap between Tau and miR142-OE mice determined by IPA analysis. [score:1]
At 1 m old, control and miR142-OE mice manipulated via IUE were deeply anesthetized by isoflurane inhalation, transcardially perfused with PBS, followed by 4% Paraformaldehyde (PFA) solution in PBS, after which the brains were removed and postfixed overnight in 4% PFA at 4°. [score:1]
To assess transcriptome changes induced by miR142-OE in cortical neurons at 1 m, we performed mRNA sequencing on miR142-OE (GFP -positive) versus control (tdTomato -positive) cortices. [score:1]
Using double-immunostaining with 1 m miR142-OE brains, we found that the majority of GFP -positive cells were also NeuN -positive (neuronal marker) [39] but not S100β -positive (astrocyte marker) [40] (Fig.   4B). [score:1]
The gene network and pathway analysis showed that the top transcriptomic network altered by miR142-OE is “Cellular Assembly and Organization, Cellular Function and Maintenance, Cellular Movement” (Supplementary Table  9; GSE107167). [score:1]
As proof-of-concept, we show that miR142-OE in cortical neurons is sufficient to trigger changes in many gene network pathways, including inflammation. [score:1]
Probes (miRCURY LNA detection control probe U6, catalog no # 99002-15, Exiqon, Germantown, MD; miRCURY LNA detection probe hsa-miR-142-5p, catalog no # 38514-15, Exiqon, Germantown, MD) at a final concentration of 30 nM were diluted in hybridization buffer (Formamide, SSC, Yeast RNA, Heparin, Denhardts solution, Tween, EDTA) and heat-denatured at 90 °C for 2 minutes after which it was cooled on ice. [score:1]
Both miR142-OE and Tau-OE induced Stat3 and Tnfr2 signaling pathways. [score:1]
Several studies have delineated the role of miR142 in immune responses in multiple pathological conditions 29, 33, 75– 77. [score:1]
These data provide the first in vivo demonstration that miR142-OE in cortical neurons can lead to substantial transcriptional changes. [score:1]
This observation suggests that miR142-OE in neurons could elicit inflammatory signals that lead to an increase in microglia and reactive astrocytes numbers. [score:1]
[1 to 20 of 51 sentences]
19
[+] score: 146
As miRNAs regulate the expression of mRNAs by binding to the sequence-specific target sites on mRNAs, we intersected these selected genes with the predicted target list of miR-142-5p from TargetScan database (Agarwal et al., 2015). [score:10]
miR-142-5p Suppression Inhibits the Loss of PSD-95 in SH-SY5Y Neuronal Cells Treated with Aβ [42]Given the increase in miR-142-5p expression during the pathogenesis of AD, we hypothesized that miR-142-5p suppression may alleviate the AD phenotype. [score:9]
We used the predicted target lists from TargetScan database [3] to identify the target mRNAs of miR-142-5p (Agarwal et al., 2015). [score:7]
We filtered these genes based on the existence of conserved target sites of miR-142-5p using predicted target list from TargetScan database (Agarwal et al., 2015). [score:7]
One possibility is that the suppression of miR-142-5p target genes may have decreased the expression of PSD-95. [score:7]
Pretreatment with miR-142-5p inhibitor attenuated the decrease of PSD-95 mRNA expression after treatment with Aβ [42]. [score:5]
Although the decrease in PSD-95 expression after Aβ [42] treatment was compromised through the inhibition of miR-142-5p, the underlying mechanism is still unclear. [score:5]
One of the key experiments is to test whether the inhibition of miR-142-5p expression in the brain of animal AD mo del could restore the loss of PSD-95 and subsequently prevent neuronal loss and memory decline. [score:5]
Thus, miR-142-5p may affect PSD-95 indirectly by regulating the expression of other neuron-related genes. [score:5]
As the expression of miR-142-5p is greatly increased in Aβ [42] -treated cells (Figure 1), we selected mRNAs that exhibited decreased expression under same condition, using the microarray data for Aβ [42] -treated SH-SY5Y cells (GSE23000; Gatta et al., 2011). [score:5]
miR-142-5p Suppression Inhibits the Loss of PSD-95 in SH-SY5Y Neuronal Cells Treated with Aβ [42]. [score:5]
Because miR-142-5p expression is highly increased by Aβ [42] treatment, we selected only the mRNAs with decreased expression following Aβ [42] treatment. [score:5]
Given the increase in miR-142-5p expression during the pathogenesis of AD, we hypothesized that miR-142-5p suppression may alleviate the AD phenotype. [score:5]
This suggests that PSD-95 would be regulated by miR-142-5p indirectly. [score:3]
Synthetic miR-142-5p and control inhibitor were purchased from Ambion (Ambion, Austin, TX, USA). [score:3]
We pretreated differentiated SH-SY5Y cells with miR-142-5p inhibitor, followed by treatment with Aβ [42] (Figure 2A and Supplementary Figure S2). [score:3]
Among the target genes of miR-142-5p from (A), those genes with neuronal process-related GO terms in (B) were chosen. [score:3]
When we searched a possible binding site of miR-142-5p in the 3′-UTR of PSD-95, no site was identified from several target search algorithms (data not shown). [score:3]
As abnormal synaptic process is an important factor in cognitive dysfunction, our results suggest that miR-142-5p may be a potential target in AD for the improvement in synaptic signaling. [score:3]
Quantitative analysis of miR-32-5p, miR-142-5p, miR-455-3p and miR-1249-3p expression was performed with reverse transcription polymerase chain reaction (RT-PCR) using the TaqMan MicroRNA Reverse Transcription kit (Applied Biosystems, Waltham, MA, USA) and 10 ng of total RNA. [score:3]
We found that miR-142-5p suppression prevents the reduction of PSD-95 level in Aβ [42] -treated SH-SY5Y neuronal cells. [score:3]
However, pretreatment of SH-SY5Y cells with miR-142-5p inhibitor compromised the reduction in PSD-95 after Aβ [42] treatment. [score:3]
GO analysis for the decreased gene group with no target site for miR-142-5p (2919 genes) showed no neuron-related term among the top 10 enriched terms (data not shown). [score:3]
There need to be additional studies to use miR-142-5p as a therapeutic target of AD. [score:3]
Target Analysis of miR-142-5p and Its Functional Implication. [score:3]
The result indicates high PSD-95 signal for cells pretreated with miR-142-5p inhibitor. [score:3]
These mRNAs were intersected with the list of predicted target genes of miR-142-5p. [score:3]
The mRNA level of PSD-95 increased in Aβ [42] -treated SH-SY5Y cells subjected to miR-142-5p inhibitor pretreatment. [score:3]
Taken together, our results show that the inhibition of miR-142-5p prevented the Aβ [42] -induced loss of PSD-95 in SH-SY5Y cells. [score:3]
This analysis suggests that miR-142-5p plays a specific role in neuronal process during AD progression by targeting neuron-related genes. [score:3]
Figure 3Target analysis of miR-142-5p and its functional implication. [score:3]
In addition, bioinformatics analysis revealed the regulation of genes associated with neuronal maintenance and synaptic plasticity by miR-142-5p. [score:2]
Thus, the establishment of a proper method to manipulate the level of miR-142-5p would be important to verify the role of this miRNA in the regulation of synaptic plasticity and to alleviate the pathogenesis of AD. [score:2]
Supporting this, there is no sequence motif (ACUUUAU) in the 3′-UTR of PSD-95 which is complementary to the seed sequence of miR-142-5p (AUAAAGU). [score:1]
Our study shows that miR-142-5p plays a role in neuronal process. [score:1]
We selected miR-142-5p as the final candidate involved in the pathogenesis of AD. [score:1]
Figure 2Cellular analysis to identify the role of miR-142-5p in Aβ [42] -treated SH-SY5Y cells. [score:1]
The effect of miR-142-5p inhibition in Aβ [42] -treated SH-SY5Y cells was investigated with the evaluation of PSD-95 expression. [score:1]
This necessitates further studies to gain insight in the detail mechanism of the effect of miR-142-5p during the pathogenesis of AD. [score:1]
To identify target genes of miR-142-5p, we used the microarray data and measured global mRNA level changes after treatment of SH-SY5Y cells with Aβ [42] (Gatta et al., 2011). [score:1]
Thus, we shortlisted four miRNAs—miR-32-5p, miR-142-5p, miR-455-3p and miR-1249-3p. [score:1]
[1 to 20 of 41 sentences]
20
[+] score: 130
Other miRNAs from this paper: mmu-mir-142a, hsa-mir-142
To verify whether TGF-β2 was the target of miR-142-5p, an inhibitor and a mimic of miR-142-5p were transfected into macrophages, and the effects were observed on TGF-β2 protein and mRNA expression levels. [score:7]
do) target-gene prediction software was used to predict the target gene of miR-142-5p, and TGF-β2 was predicted to be the most probable target gene. [score:7]
To investigate the effects of miR-142-5p on the rate of apoptosis of human macrophages, the cells were divided into seven groups: Control, control + ox-LDL, miR-142-5p inhibitor transfection + ox-LDL, TGF-β2 inhibitor transfection + miR-142-5p inhibitor + ox-LDL, miR-142-5p mimic transfection, TGF-β2 inhibitor + ox-LDL, N. C + ox-LDL. [score:7]
Expression levels of miR-142-5p are upregulated in human macrophages treated with ox-LDL. [score:6]
Expression levels of miR-142-5p are upregulated in the atherosclerotic plaques of mice. [score:6]
The present study demonstrated that miR-142-5p expression was upregulated in atherosclerotic plaques obtained from apoE−/− mice. [score:6]
In the present study, an atherosclerotic plaque apoE−/− mouse mo del was generated and the expression levels of miR-142-5p were upregulated in the atherosclerotic plaques of the apoE−/− mice. [score:6]
To verify whether TGF-β2 was a target gene, a miR-142-5p inhibitor and mimic were transfected into macrophages. [score:5]
A database -based target gene prediction software predicted that TGF-β2 was the most probable target gene of miR-142-5p. [score:5]
To study TGF-β2 expression levels in the macrophages, the cells were divided into five groups: Control, control + ox-LDL, miR-142-5p inhibitor transfection + ox-LDL, miR-142-5p mimic transfection, and negative control (NC) + ox-LDL. [score:5]
The expression levels of miR-142-5p in the human macrophages treated with ox-LDL were upregulated, as compared with the control macrophages (P<0.05). [score:5]
The expression levels of TGF-β2 were higher in the cells transfected with the miR-142-5p inhibitor and treated with ox-LDL, as compared with the cells undergoing ox-LDL treatment alone (P<0.05; Fig. 4), and were the lowest when the cells were transfected with the miR-142-5p mimic (P<0.05). [score:4]
In addition, miR-142-5p was shown to be associated with the apoptosis of macrophages, through the regulation of its predicted target gene, TGF-β2. [score:4]
In the present study, significant miR-142-5p expression was detected in macrophages, but not endothelial or smooth muscle cells. [score:3]
In conclusion, miR-142-5p was shown to be involved in atherosclerosis in mice, and TGF-β2 was identified as its target. [score:3]
MiR-142-5p is a member of the miR-142 miRNA family which have known roles in cancer, immune diseases and embryonic stem cells (12, 13). [score:3]
MiR-142-5p is a member of the miR-142 family, which is involved in the pathogenesis of various diseases (13, 32, 33). [score:3]
The present study also aimed to identify miR-142-5p target genes, and its effects on apoptosis in macrophages. [score:3]
Previous research into miR-142-5p has mainly focused on its associations with tumors, immune diseases and stem cells (32); however, its role in atherosclerosis remains unknown. [score:3]
The suspension was then added to the cells and incubated for 6 h, the medium was then replaced and the cells were cultured for a further 48 h. To study the miR-142-5p expression levels, the cells were divided into two treatment groups: Control and oxidized low-density lipoprotein treated (ox-LDL; 90 μl, 50 mg/ml, for 24 h). [score:3]
MiR-142-5p was shown to regulate macrophage apoptosis by targeting TGF-β2. [score:3]
However, the expression of miR-142-5p in atherosclerotic plaque and its roles in atherosclerosis are currently unclear. [score:3]
In the present study, the expression levels of miR-142-5p were detected in murine atherosclerotic plaques and human macrophages. [score:3]
The liposome suspension was then added to the mir-142-5p inhibitor liquid and incubated at room temperature for 15 min. [score:3]
Gene microarray analysis for miR-142-5p expression. [score:3]
The results verified that TGF-β2 was the likely target gene of miR-142-5p. [score:3]
,) of mir-142-5p inhibitor (Shanghai GenePharma Co. [score:3]
These results suggest that TGF-β2 may be a target gene of miR-142-5p. [score:3]
TGF-β2 is predicted to be a target gene of miR-142-5p. [score:3]
The following primer sequences were used: TGF-β2 forward, 5′-ACAAAATAGACATGCCGCCC-3′, and reverse, 5′-GATGGCATCAAGGTACCCACAG-3′; Hsa-miR-142-5p forward, 5′-AACTCCAGCTGGTCCTTAG-3′, and reverse, 5′-TCTTGAACCCTCATCCTGT-3′; Hsa-miR-142-5p inhibitor were, 5′-AGUAGUGCUUUCUACUUUAUG-3′; Hsa-miR-142-5p mimic forward, 5′-CAUAAAGUAGAAAGCACUACU-3′, and reverse, 5′-UAGUGCUUUCUACUUUAUGUU-3′. [score:2]
The expression levels of miR-142-5p were 6.84-fold higher in the mice with stable plaques, and was 2.69-fold higher in the mice with vulnerable plaques, as compared with the controls (Fig. 1). [score:2]
The expression levels of miR-142-5p, in the atherosclerotic plaques, were determined using a miRNA microarray assay with rat miRNA array probes (Kangchen Bio-tech Inc. [score:2]
In the present study, miR-142-5p was shown to be associated with the apoptosis of macrophages by negatively regulating TGF-β2. [score:2]
The present study determined that apoptosis of macrophages could be affected by miR-142-5p. [score:1]
[1 to 20 of 34 sentences]
21
[+] score: 119
Experiment 2: MiRNA regulation of Bmal1 3′ UTR activitySince the observed circadian fluctuations in serum levels of miRNAs predicted to target Bmal1 is suggestive of their involvement in circadian timekeeping mechanisms, we used an in vitro reporter assay to examine the effects of miR-494, miR-152 and even miR-142-3p on Bmal1 expression via targeting of the 3′ UTR of this clock gene. [score:7]
mmu-miR-142-3p mmu-miR-152 mmu-miR-135b mmu-miR-135a mmu-miR-34c mmu-miR-494 MicroCosm Bmal1 Bmal1, Rorβ - - Reverbα Bmal1, Rorβ TargetScan Bmal1 - - - - Bmal1, Clock MiRanda Bmal1 Bmal1, Rorα, Rorβ Rorα, Rorβ Rorα, Rorβ Per2 Bmal1, Per2, Rorβ Because recent findings indicate that despite their abundant expression in the cytoplasm, 18s and 28s rRNA are absent in RNA extracted from circulating exosomes [31], 18s rRNA levels were analyzed in serum and WBC fractions of blood samples collected from mice (n = 3–4) at ZT3 and ZT7 to confirm that the detected small RNAs reflect serum expression, rather than artifact associated with cellular lysis during sample preparation. [score:7]
mmu-miR-142-3p mmu-miR-152 mmu-miR-135b mmu-miR-135a mmu-miR-34c mmu-miR-494 MicroCosm Bmal1 Bmal1, Rorβ - - Reverbα Bmal1, Rorβ TargetScan Bmal1 - - - - Bmal1, Clock MiRanda Bmal1 Bmal1, Rorα, Rorβ Rorα, Rorβ Rorα, Rorβ Per2 Bmal1, Per2, Rorβ Because recent findings indicate that despite their abundant expression in the cytoplasm, 18s and 28s rRNA are absent in RNA extracted from circulating exosomes [31], 18s rRNA levels were analyzed in serum and WBC fractions of blood samples collected from mice (n = 3–4) at ZT3 and ZT7 to confirm that the detected small RNAs reflect serum expression, rather than artifact associated with cellular lysis during sample preparation. [score:7]
Since the observed circadian fluctuations in serum levels of miRNAs predicted to target Bmal1 is suggestive of their involvement in circadian timekeeping mechanisms, we used an in vitro reporter assay to examine the effects of miR-494, miR-152 and even miR-142-3p on Bmal1 expression via targeting of the 3′ UTR of this clock gene. [score:6]
Daily profiles of miRNA expression in serum were assessed to determine whether circulating levels of mature miRNAs that are predicted to target mouse Bmal1 or other genes regulating this key component of the molecular clockworks, miR-494, miR-152 and miR-142-3p, oscillate rhythmically. [score:6]
Based on the results from Targetscan analysis, the cKit 3′ UTR is predicted to contain a target site for miR-494, but not for miR-142-3p or miR-152. [score:5]
Because previous studies indicate that two different miRNAs can act in concert to simultaneously repress translation of a single mRNA [32], we next examined the combinatorial effects of miR-494, miR-152 and miR-142-3p overexpression in repressing Bmal1 3′ UTR activity. [score:5]
The basis for this inductive effect of miR-142-3p on cKit 3′ UTR activity is unknown, but the cKit 3′ UTR is predicted to contain a target site for miR-142-5p and overexpression of its antisense transcript, miR-142-3p, may effectively reverse any basal repression derived from interactions of endogenous miR-142-5p with the cKit 3′ UTR. [score:5]
Transfection with a non -targeting miRNA had no significant effect on luciferase -mediated bioluminescence in Bmal1 3′ UTR -expressing cells relative to that found in cells transfected with the control vector, suggesting that basal reporter activity is similar between the Bmal1 3′ UTR and control vectors and that the observed repression of the Bmal1 3′ UTR is specific for miR-494 and miR-142-3p. [score:5]
In HEK293 cells co -transfected with Bmal1 3′ UTR expression vector, over -expression of miR-494 or miR-142-3p, but not miR-152, produced significant decreases (p<0.01) in luciferase -mediated bioluminescence relative to that found in cells transfected with the control vector (Fig. 4A). [score:5]
Pre-miR interactions with the 3′ UTR of a non-clock gene containing predicted target sites for miR-494 but not miR-152 or miR-142-3p were explored by analyzing bioluminescence from HEK293 cells co -transfected with the pEZX-MT01 vector expressing the cKit 3′ UTR and pre-miR constructs for these miRNAs (n = 4). [score:5]
Using in vitro analysis of luciferase-reported Bmal1 3′ UTR activity to examine the effects of miRNA over -expression, miR-494 and miR-142-3p were identified as potential post-transcriptional repressors of Bmal1, for the first time implicating specific miRNAs in the regulation of this integral molecular component of the mammalian circadian clock. [score:4]
The cKit 3′ UTR also contains a predicted target site for miR-142-5p, the antisense transcript of miR-142-3p. [score:3]
0022586.g004 Figure 4Independent and combinatorial effects of miR-494, miR-152 and miR-142-3p over -expression on Bmal1 3′ UTR activity. [score:3]
For all of the tested miRNA combinations (miR-494+miR-152, miR-494+miR-142-3p, miR-152+miR-142-3p), luciferase-reported bioluminescence was significantly reduced (p<0.01) in Bmal1 3′ UTR -expressing cells relative to that control vector transfectants (Fig. 4B). [score:3]
Using this information as a relative index of abundance, miR-142-3p, miR-152 and miR-494 appear to represent species of moderate to low expression in serum. [score:3]
Combinatorial effects in repressing luciferase-reported Bmal1 3′ UTR activity were lowest in response to miR-494 and miR-152 overexpression (∼21%) and were highest in cells treated with pre-miR constructs for miR-494 and miR-142-3p (∼75%). [score:3]
The Bmal1 3′ UTR was predicted to contain miR-152, miR-142-3p and miR-494 target sites that are located at nucleotide positions 88–108, 335–357 and 473–495, respectively (Figure S3). [score:3]
The differential expression of miR-142-3p in WBCs is not surprising because this miRNA is highly abundant in hematopoietic cell lineages [30]. [score:3]
Bioluminescence was analyzed in HEK293 cells co -transfected with the pEZX-MT01 Bmal1 3′ UTR expression vector and pre-miR constructs for miR-494, miR-152, or miR-142-3p (n = 4). [score:3]
Temporal patterns of miR-494, miR-152 and miR-142-3p expression in mouse serum. [score:3]
These components of blood exhibited variable differences in miRNA levels such that miR-142-3p and miR-494 expression were lower (77-fold and 1.5-fold, respectively) and miR-152 was higher (25-fold) in serum than in WBCs (Fig. 2A). [score:3]
Time -dependent fluctuations in miR-494, miR-152 and miR-142-3p expression were first identified by one-way analysis of variance (ANOVA). [score:3]
Although both miR-494 and miR-142-3p target the same gene, Bmal1, overt rhythmicity in extracellular levels may not be the sole criterion determining their role in the mammalian circadian system. [score:3]
Independent and combinatorial effects of miR-494, miR-152 and miR-142-3p over -expression on Bmal1 3′ UTR activity. [score:3]
Moreover, the potentiated repression observed in response to combined treatment with pre-miR constructs for miR-142-3p and miR-494 is compatible with previous evidence for the synergistic regulation of the 3′ UTR for a single gene by two or more miRNA species [32]. [score:2]
24 hours later, co-transfection of verified plasmid DNA clones (0.4 ug) with either individual pre-miRs, or paired combinations of pre-miR constructs for miR-494, miR-152, or miR-142-3p (final conc. [score:1]
In comparison with miR-494 and miR-152, serum levels of miR-142-3p were relatively high with no significant variation over time (p = 0.377). [score:1]
0022586.g002 Figure 2(A) Bars denote real-time PCR determinations of serum and WBC miRNA levels (mean ± SEM) in blood samples collected from mice (n = 3) at ZT 7. The plotted values correspond to the ratios of fraction-specific miR-142-3p, miR-494 and miR-152 signal and are represented as a percentage of the maximal value obtained among the serum and WBC fractions. [score:1]
Figure S3 Predicted interactions between miR-494, miR-152 and miR-142-3p and the Bmal1 3′ UTR. [score:1]
miR-142-3p, miR-152, miR-494, miR-135b, miR-135a and miR-34c were found in descending order of abundance in the serum (Fig. 1A). [score:1]
Treatment with pre-miR constructs for miR-494 or miR-142-3p repressed Bmal1 3′ UTR -mediated bioluminescence by about 35% and 60%, respectively, in comparison with control transfections. [score:1]
In contrast to other tested miRNAs, miR-142-3p levels in the serum exhibited no evidence of diurnal fluctuations (Fig. 3). [score:1]
Diagrammatic representation of predicted interactions between mature (A) miR-494, (B) miR-152 and (C) miR-142-3p with complementary regions of the wild-type Bmal1 3′ UTR. [score:1]
In conjunction with the observed differences in the repressive effects of individual miRNAs, these results suggest that among the tested transcripts, miR-142-3p is the most potent repressor of Bmal1 3′UTR -mediated activity. [score:1]
Interestingly, treatment with pre-miR constructs for miR-142-3p caused a significant increase in cKit 3′ UTR -mediated bioluminescence relative to the luciferase activity of the control vector. [score:1]
The plotted values correspond to the ratios of miR-494 (top left), miR-152 (top right) and miR-142-3p (bottom) signal normalized to miR-16 levels in each sample and are represented as a percentage of the maximal value obtained for each miRNA. [score:1]
[1 to 20 of 37 sentences]
22
[+] score: 86
Similarly, miR-142-3p was upregulated in human T-leukemic cell lines and primary T-leukemic cells isolated from T-cell acute lymphoblastic leukemia (T-ALL) patients and its expression levels correlated with prognosis 49. [score:6]
Interestingly, increased expression of PD-L1 has been reported in chronic lymphocytic leukemia (CLL) suggesting a possible association of miR-142-3p and PD-L1 expression 50. [score:5]
Overexpression of miR-24, miR-30b, and miR-142-3p suppress type I cytokines by DCs. [score:5]
Enforced expression of miR-24, miR-30b, and miR-142-3p in untreated MΦ significantly induced (~1.5–2 fold) CD86 expression (Fig. 5a,b). [score:5]
Marked induction (~2–4.5 fold) in PD-L1 expression was observed in miR-24, miR-30b, and miR-142-3p overexpressing cells compared to control mimic (Fig. 5a). [score:4]
These findings indicate that aberrant miR-142-3p and PD-L1 levels can suppress both innate and adaptive immune responses. [score:3]
Time kinetics of antigen uptake and processing in MΦ and DC overexpressing miR-24, miR-30b, and miR-142-3p. [score:3]
Impaired T-cell proliferation by MΦ and DC overexpressing miR-24, miR-30b and miR-142-3p. [score:3]
MΦ and DC overexpressing miR-24, miR-30b, and miR-142-3p exhibit impaired antigen processing. [score:3]
Our results show induced PD-L1 expression in miR-142-3p -transfected cells. [score:3]
In our previous study we showed that enforced expression of miR-142-3p in myeloid inflammatory cells results in defective phagocytosis as well as reduced secretion of proinflammatory cytokines 20. [score:3]
PD-L1 surface expression is induced in miR-24, miR-30b, and miR-142-3p transfected MΦ and DC. [score:3]
In this study we demonstrate an inhibitory effect of miR-24, miR-30b, and miR-142-3p on the uptake as well as processing of Ova by APCs. [score:3]
However, CD86 expression was significantly elevated only in miR-142-3p transfected MΦ treated with Ova while Ova treated or untreated DC transfected with miR-30b showed significant changes (Fig. 5a,b). [score:3]
MiR-24, miR-30b, and miR-142-3p mimics or inhibitors were purchased from Qiagen (Gaithersburg, MD, USA). [score:3]
MΦ and DCs overexpressing miR-24, miR-30b, and miR-142-3p are defective in antigen processing. [score:3]
Flow cytometric analysis showed antigen processing was reduced to approximately 22%, 38% and 40% in DC overexpressing miR-24, miR-30b and miR-142-3p, respectively (Fig. 1g–j). [score:3]
Time kinetics of antigen uptake and processing in miR-24, miR-30b, and miR-142-3p overexpressing APCs. [score:3]
miR-24, miR-30b, and miR-142-3p induce PD-L1 expression in APCs. [score:3]
Taken together, these results show that Th1 activation -associated cytokine profiles are suppressed in DC transfected with miR-24, miR-30b, and miR-142-3p. [score:3]
To examine the specific impact of miRNA mimics, we also used miR-142-3p inhibitor. [score:3]
Compared to control mimic, no significant differences were noted in the presence of miR-24, miR-30b or miR-142-3p inhibitor (Fig. 1e). [score:2]
MΦ transfected with miR-24, miR-30b and miR-142-3p mimics show reduced green signal compared to control mimics (Fig. 1a) suggesting impaired antigen processing upon enforced expression of the miRNA mimics. [score:2]
Overall, our results highlight novel mechanistic insights through which miR-24, miR-30b and miR-142-3p can regulate activation of adaptive immune responses guided by APCs. [score:2]
miR-24, miR-30b, and miR-142-3p impair Ova specific T-cell proliferation. [score:1]
We therefore examined the impact of miR-24, miR-30b and miR-142-3p on antigen processing by MΦ and DC. [score:1]
How to cite this article: Naqvi, A. R. et al. miR-24, miR-30b and miR-142-3p interfere with antigen processing and presentation by primary macrophages and dendritic cells. [score:1]
MiRNA transfected cells, more specifically miR-142-3p, were also less efficient in clearing the antigen as reflected by the absence of population devoid of Ova (both Texas Red and BODIPY labelled Add; ‘see black arrows in Fig. 1, lower panels’. [score:1]
Impaired T-cell activation and proliferation by miR-24, miR-30b, and miR-142-3p transfected APCs. [score:1]
In MΦ, Mycobacteria tuberculosis (M. tb) infection induces high levels of miR-142-3p and impairs phagocytosis of pathogen 56. [score:1]
We next examined the impact of PD-L1 blocking on T cell proliferation by miR-24, miR-30b, and miR-142-3p. [score:1]
[1 to 20 of 31 sentences]
23
[+] score: 83
The chronic lymphocytic leukemia (CLL) line MEC-1 and the multiple myeloma cell line Kas 6/1 expressed the highest levels of endogenous miR-142-3p (Figure 2F), and showed the greatest inhibition of CVA21 142T RNA expression (Figure 2D), followed by the CLL lines MEC-2, MEC-1, and WAC-3. We observed an inverse correlation between miR-142-3p expression levels and the CVA21 142T RNA copy numbers detected, suggesting that the abundance of this particular miRNA contributes substantially to the efficiency with which it acts to silence complementary mRNAs. [score:9]
In addition, two viruses were constructed to look at the potential for translational silencing of the viral mRNA: a virus containing 7 base pairs of mismatch between the target and miR-142-3p (CVA21 mm7T) and a virus that contained the entire miR-142-3p target site with a 6 base pair (bp) stuffer sequence inserted between bp 10/11 of the target site (CVA21 b6T), each with four replicate copies (Figure 1C). [score:9]
However, despite very high let-7a abundance in a number of cell lines, target elements corresponding to let-7 do not functionally suppress sequence complementary targets as efficiently as does miR-142 (or a number of other well-characterized miRNAs) [5]. [score:5]
While inserting perfectly complementary miR-142-3p targets (in CVA21 142T) reduced CVA21 RNA levels by up to a million-fold, the mismatched CVA21 mm7T and bulged CVA21 b6T targets induced only a modest decrease in viral RNA (Figure 2D). [score:5]
However, hematopoetic cell lines and primary hematopoetic cells expressing high levels of endogenous miR-142-3p were significantly less susceptible to viruses containing mismatch (mm7T) or bulge (b6T) targets (Figure 2B; p<0.01 and p<0.004, respectively). [score:5]
To identify miRNA -mediated antiviral activity acting at distinct steps in the viral life cycle, we designed a panel of recombinant viruses expressing variations of the miR-142-3p target. [score:5]
Target elements corresponding to muscle-specific (miR-133 and miR-206), hematopoetic-specific (miR-142-3p) or tumor-suppressor (miR-145) miRNAs were incorporated in the 3′UTR of CVA21 and protection of HeLa cells transfected with sequence-complementary miRNA mimics (synthetic dsRNAs corresponding to cellular miRNA duplex intermediates) was analyzed (Figure 1B). [score:5]
However, miR-142-3p mimic present 4 hours prior to infection or simultaneously with CVA 142T infection inhibited detectable expression of CVA21 capsid in the immunoblot. [score:5]
While miRNA -mimics were able to protect cells infected with viruses containing sequence complementarity from ∼60% to levels that were not significantly different from control, the hematopoetic-specific miR-142-3p target provided the most complete and most consistent protection, and hence provided the best candidate to study the different steps of virus replication at which cellular miRNAs could act to perturb viral replication. [score:3]
To determine whether this variability correlated with the level of miR-142-3p expression in these cells, we analyzed the abundance of endogenous miR-142-3p in our panel of hematopoetic cell lines by qRT-PCR. [score:3]
While we observed that the CVA21 142T RNA genome was profoundly decreased in the presence of perfectly matched miR-142 mimics, there was significant variability in the degree of inhibition seen in different hematopoetic cell lines (Figure 2D). [score:3]
In contrast to the melanoma xenografts, MEC-1 CLL xenografts (which express abundant miR-142) were susceptible to the WT and muscle-restricted viruses but were highly resistant to oncolysis by CVA21 142T (Figure 6B). [score:3]
Unexpectedly, the virus bearing tandem repeats of miR-142 (CVA21 142T) replicated in both the permissive melanoma xenograft (Figure 6C) and in the “nonpermissive” CLL xenograft (Figure 6D) in these mice, such that both tumors regressed just as rapidly as when they were infected with the nontargeted WT or miRT viruses. [score:3]
Fold decrease expressed as ratio of CVA 142T RNA in the presence of miR-142 mimic/CVA 142T RNA in the presence of control miRNA mimic (at indicated MOI). [score:3]
Overall these results show that perfectly matched miR-142 targets are recognized and catalytically degraded. [score:3]
In order to determine why regression of mir-142 -expressing hematopoetic tumors was observed in animals bearing contralateral melanoma xenografts when treated with the miR-142 restricted virus, but not in animals with a single hematopoetic tumor, we compared the viral titers in serum from animals treated with CVA21 142T versus WT CVA21 (Figure 6H). [score:2]
In contrast, when miR-142-3p mimic was added at either 3 or 6 hours after expression, accumulation of viral capsid was detected in Western blots of the sucrose-purified portion and corresponded with capsid quantified by protein assay. [score:2]
Capsid proteins were not detected in sucrose-purified samples of cellular supernatant to which sequence-complementary mimics (miR-142-3p) were added before or simultaneously with CVA21-142T infection (Figure 4B). [score:1]
miR-142 3pT TCCATAAAGTAGGAAACACTACA CGAT TCCATAAAGTAGGAAACACTACAACCGGT TCCATAAAGTAGGAAACACTACATCAC TCCATAAAGTAGGAAACACTACA miR-142revT TGTAGTGTTTCCTACTTTATGGA ATCG TGTAGTGTTTCCTACTTTATGGAACCGGT TGTAGTGTTTCCTACTTTATGGAATCG TGTAGTGTTTCCTACTTTATGGA miR-142 mm7T TTAATGCAGTCATAAACACTACA CGAT TTAATGCAGTCATAAACACTACAACCGGT TTAATGCAGTCATAAACACTACATCAC TTAATGCAGTCATAAACACTACA miR-142 b6T TCCATAAAGTAGGTCGATTAAACACTACA CGAT TCCATAAAGTAGGTCGATTAAACACTACAACCGGT TCCATAAAGTAGGTCGATTAAACACTACATCAC TCCATAAAGTAGGTCGATTAAACACTACA miR-145T AGGGATTCCTGGGAAAACTGGAC CGAT AGGGATTCCTGGGAAAACTGGACACCGGT AGGGATTCCTGGGAAAACTGGACTCAC AGGGATTCCTGGGAAAACTGGAC Viral RNA was produced using Ambion Megascript and Megaclear T7 polymerase kit according to manufacturers instructions. [score:1]
Since serum titers were very high in mice with bilateral tumors (>10 [8] TCID [50]/ml), we investigated the possibility that endogenous miR-142 expressed in MEC-1 xenografts could have been saturated by this high-level viremia. [score:1]
These recombinant viruses were rescued in the absence of the corresponding miRNAs and found to replicate to high titer with growth kinetics analogous to the wild-type (WT) virus in cells lacking miR-142-3p (Figure 1D). [score:1]
post infection with MOI = 1.0 in a panel of hematopoetic or control cell lines or in H1-HeLa cells transfected with 200 nM control or miR-142-3p mimics. [score:1]
A panel of hematopoetic cells, as well as H1-HeLa cells (serving as a control cell line) were supplemented with control or miR-142 mimics, and all cells were infected with the panel of recombinant CVA21 viruses. [score:1]
post infection with (A) MOI = 1.0, (C) MOI = 3, (E) MOI = 10 CVA 142T in the presence of control or miR-142-3p mimic added 4 hours prior to infection, or at 0, 3, or 6 hours post infection. [score:1]
post infection with MOI = 1.0 recombinant CVA21s in the presence of 200 nM control or miR-142 mimic. [score:1]
While cells were completely protected against cytotoxicity at MOIs of up to 30, increasing virus titer thereafter resulted in decreased cell viability such that by an MOI = 1,000 we saw near complete cytopathic effects in CVA21 142T infected cells (Figure 6I), thus suggesting that the endogenous miR-142 may have been effectively saturated, a phenomenon which has been observed by a number of groups previously [32] [25]. [score:1]
Small RNA was extracted from cells and reverse-transcription and qPCR analysis of miR-142 3p was performed. [score:1]
[1 to 20 of 27 sentences]
24
[+] score: 76
Other miRNAs from this paper: mmu-mir-142a
Moreover, miss -expression of miR-142 has been implicated in the initiation and development of a panel of diseases, supported by clinical evidence and animal mo dels [14]. [score:6]
Here, we depleted miR-142 in MSCs cells through expression of antisense of miR-142, resulting in enhanced expression of CXCR7 in these miR-142 -depleted MSCs (md-MSCs). [score:5]
Furthermore, one miRNA has many targets, it is necessary to study the effects of targets other than CXCR7 for miR-142 in MSCs. [score:5]
CXCR7 is targeted and suppressed by miR-142 in MSCs. [score:5]
Although many targets of miR-142 have been determined, CXCR7 as a target gene for miR-142 has not been reported. [score:5]
Moreover, it might be interesting to check the effects of miR-142 inhibition on downstream signaling of SDF-1/CXCR7 to further confirm that the effects of miR-142 inhibition is primarily affecting this signaling pathway. [score:5]
Interestingly, overexpression of miR-142 in MSCs did not have significant effects on CXCR7 mRNA and protein. [score:3]
This data may reflect the endogenous high expression of miR-142 in MSCs, and further increases in miR-142 could not further increase its effects on CXCR7, which may be saturated already. [score:3]
Here, we used as-miR-142 to neutralize the endogenous expression of miR-142 in MSCs. [score:3]
The depletion of miR-142 resulted in loss of the suppression of miR-142 on CXCR7 and then increases in CXCR7 protein levels. [score:3]
These data suggest that the binding of miR-142 on 3′-UTR of CXCR7 mRNA is functional, which suppresses CXCR7 protein levels. [score:3]
However, to the best of our knowledge, this is the first report to show that CXCR7 is a target for miR-142, especially in MSCs. [score:3]
We found that miR-142 markedly inhibited the luciferase activity of CXCR7 3′-UTR wt, whereas the as-miR-142 increased the luciferase activity in MSCs (Figure 1C). [score:3]
However, transfection by miR-142 did not significantly alter either mRNA or protein of CXCR7, suggesting a relative high expression level of miR-142 in the primary MSCs. [score:3]
Previous studies have reported several targets of miR-142 in different cells, e. g. sirtuin1 [21, 22] and Bach2 [23]. [score:3]
In the past studies on miRNAs, miR-142 has been shown to be a major regulator of cell fate decision in the hematopoietic system [14]. [score:2]
RT-qPCR was performed in these transfected cells and confirmed the alteration of miR-142 levels in these cells (Figure 1B). [score:1]
We only found one cross-species conserved miRNA, miR-142, in the library, which binds to 3′-UTR of CXCR7 mRNA at 389th–395th base site (Figure 1A). [score:1]
In order to examine the effects of miR-142-depletion in MSCs on their potential in treating MI, we prepared adeno -associated viruses (AAVs) carrying as-miR-142 or null as a control. [score:1]
RT-qPCR for miR-142 in these cells was performed. [score:1]
The transduced cells were termed as md-MSCs (for AAV-as-miR-142) or MSCs (for AAV -null), respectively. [score:1]
On the other hand, transfection of either miR-142 or as-miR-142 did not alter the luciferase activity of the reporter for CXCR7 3′-UTR mut in MSCs (Figure 1D). [score:1]
Moreover, although transfection by as-miR-142 did not alter CXCR7 mRNA in MSCs (Figure 1E), it significantly increased CXCR7 protein levels in MSCs, determined byting (Figure 1F), and by immunocytochemistry (Figure 1G). [score:1]
Finally, we examined the miR-142 and CXCR7 levels in md-MSCs. [score:1]
The effects of miR-142 depletion in MSCs on cardiac muscle cell apoptosis were tested in vitro and in vivo in an MI mo del in mice. [score:1]
To figure out if the binding of miR-142 on CXCR7 may be functional, we transfected mouse MSCs with miR-142, or antisense for miR-142 (as-miR-142) or a null plasmid as a control. [score:1]
Figure 1(A) Bioinformatics analyses show that miR-142 has a binding site on the wildtype (wt) 3′-UTR of CXCR7 mRNA. [score:1]
Figure 2MSCs were transduced with AAVs carrying as-miR-142 or null as a control. [score:1]
MSCs were transduced with AAVs carrying as-miR-142 or null as a control. [score:1]
The null or as-miR-142 or CXCR7 construct was cloned into a pAAV-CAG-GFP plasmid (Clontech, Mountain View, CA, USA). [score:1]
By RT-qPCR, we found that the levels of miR-142 significantly decreased in md-MSCs (Figure 2C). [score:1]
Together, these data suggest that miR-142-depletion in MSCs increases CXCR7 levels. [score:1]
[1 to 20 of 32 sentences]
25
[+] score: 60
Table 1 The role of miRNAs in autoimmune diseases miRNA Predicted/Identified targets Function Related diseases miR-22 IRF8Enhances CD11c [+]CD11b [+]B220 [−] cDC generation at the expense of pDCs miR-142 IRF8Plays a pivotal role in the maintenance of CD4 [+] DCs miR-142-3p IL-6 Specifically inhibits IL-6 expression by moDC MS miR-21 IL-12p35, Wnt1 Negatively regulates the production of IL-12 by moDC; negatively regulate the development of moDC SLE, IBD, UC, MS miR-10a IL-12/IL-23p40 Suppress the production of IL-12 and IL-23 by moDC SLE miR-148/152 Calcium/Calmodulin- dependent protein kinase IIa Suppress the production of IL-12 and IL-6 SLE miR-23b Notch1, NF-κB Inhibits the production of IL-12 while promotes IL-10 production UC miR-155 SOCS1, SHIP1, TAB2 Positively regulates the production of several pro-inflammatory cytokines including IL-6, IL-23, IL-12, and TNF-α RA, IBD miR-146a IRAK1, TRAF6 Negatively regulates TLR4-NF-κB pathway in monocytes RA, SLE, IBD miR-34a JAG1 Negatively regulates the development of moDC MS miR-223 C/EBPβNegatively regulates LCs -mediated antigen-specific CD8 [+] T cell proliferation, production of inflammatory cytokine TNFα, IL-1β, and IL-23 by intestinal DCs. [score:25]
MiR-142-3p was also identified as a key negative regulator of IL-6. In contrast to miR-155, which is strongly up-regulated after LPS stimulation, miR-142-3p is constitutively and highly expressed in resting moDCs but down-regulated after LPS stimulation. [score:10]
By analyzing miRNA expression profiles for distinct myeloid populations, including BM-resident progenitors, monocytes, and mature splenic DC subsets, miR-142 was found to be highly expressed in classic FLT3-L–dependent CD4 [+] cDCs, whereas reduced expression was observed in CD8α [+] or CD4 [−]CD8α [−] cDCs (Mildner et al., 2013). [score:7]
Comparison of the expression profiles of WT and miR-142 [−/−]CD4 [+] cDC equivalents using ingenuity pathway analysis revealed an up-regulation of the transcription factors HoxA9, IRF8, and Meis1 in miR-142 [−/−]CD4 [+] cDCs. [score:6]
The up-regulation of IRF8 may suggest a function for miR-142 in the specification of CD4 [+] versus CD8α [+] cDCs through regulation of the IRF8 pathway (Mildner et al., 2013). [score:5]
MiR-142-3p directly targets IL-6 mRNA and thus specifically affects IL-6 expression (Sun et al., 2011). [score:5]
Another important miRNA involved in DC homeostasis is miR-142. [score:1]
Moreover, mice deficient for miR-142 displayed an impairment of CD4 [+] cDC homeostasis both in vitro and in vivo. [score:1]
[1 to 20 of 8 sentences]
26
[+] score: 52
In addition, pair-wise analyses revealed 42 common targets for miR-182 and miR-142-3p, 34 common targets for miR-182 and miR-223, and 7 common targets for miR-142-3p and miR-223 (Table S1, Fig. 2A). [score:7]
The most noteworthy novel finding was that in skeletal muscle, HRT use associates with down-regulation of miR-182, miR-223, and miR-142-3p, which modulate the expression of central players in the insulin/IGF-1 pathway, namely IGF-1R and FOXO3A. [score:6]
Figure 6The effects of estrogen stimulation on the expression of miR-182, miR-223, and miR-142-3p and their targets in infant female quadriceps femoris-derived myoblasts. [score:5]
Identification of common pathways targeted by miR-182, miR-223, and miR-142-3p was obtained using the DIANA-microT 3.0 target prediction program (http://diana. [score:5]
Figure 5MiR-182, miR-223, and miR-142-3p expression and their target mRNA and protein levels under estrogen stimulation in MCF-7 cells. [score:5]
Both miR-223 and miR-142-3p were down-regulated by 100 n m E [2], the difference being highly significant for miR-142-3p (Fig. 6A). [score:4]
Putative pathways affected by miR-182, miR-223, and miR-142-3p are reported in Table 2. Among the putative target pathways, we found the insulin/IGF1 pathway (Fig. 2B). [score:3]
Validation by quantitative PCR (qPCR) confirmed that the expression levels of miR-182, miR-223, and miR-142-3p in the HRT users were approximately one-third of that of nonusers (P = 0.05, 0.001 and 0.003, respectively; Fig. 1C), while miR-142-5p and miR-451 were not significantly different between HRT users and their nonuser co-twins. [score:3]
Table S1 Common targets for hsa-miR-142-3p (250 elements), hsa-miR-182 (841 elements) and hsa-miR-223 (202 elements). [score:3]
Consequently, miR-142-3p was here excluded from the further analyses, as it was not predicted to target other components of the insulin/IGF-1 pathway. [score:3]
In the present study, we confirmed that estrogen-regulated miRNAs, that is, miR-182, miR-223 and miR-142-3p, exist in skeletal muscle of postmenopausal women. [score:2]
As recently we reported that estrogen -based hormone therapy is associated with increased activity in the same pathway (Pöllänen et al., 2010; Ahtiainen et al., 2012a), we focused here on IGF-1R, FOXO3A, and FOXO1A, which in our analysis proved to be regulated by miR-182, miR-223, and miR-142-3p, as described in Fig. 2. Table 2Common pathways of miR-142-3p, miR-182, and miR-223. [score:2]
As recently we reported that estrogen -based hormone therapy is associated with increased activity in the same pathway (Pöllänen et al., 2010; Ahtiainen et al., 2012a), we focused here on IGF-1R, FOXO3A, and FOXO1A, which in our analysis proved to be regulated by miR-182, miR-223, and miR-142-3p, as described in Fig. 2. Table 2Common pathways of miR-142-3p, miR-182, and miR-223. [score:2]
MiR array data showed miR-142-3p, miR-142-5p, miR-223, miR-182, and miR-451 to be hypo-expressed in the HRT users compared to nonusers (Fig. 1B). [score:2]
[1 to 20 of 14 sentences]
27
[+] score: 52
The two miR-142 states were resolved in the case of asymmetric bidirectional promoters with EF1 α driving the normalizer expression and CAG or PGK promoters (variants ① and ②) driving the detector expression (Fig 5L). [score:6]
CAG-type bidirectional promoters generally exhibited excellent transgene expression levels and a tight correlation in detector and normalizer expression, resulting in a high resolution of the two miR-142 states. [score:6]
This creates two stable mESC states, one with low miR-142 expression and another one with high miR-142 expression. [score:5]
A self-renewing mESC population will then be segregated into two subpopulations: one subpopulation with low miR-142 expression and one subpopulation with high miR-142 expression. [score:5]
See also Fig 3. (A)-(D) Representative flow cytometry plots of clonal mESC lines expressing miR-142-3p activity reporters under the control of bidirectional promoter variants with asymmetric outer promoter elements. [score:4]
0155177.g004 Fig 4See also Fig 3. (A)-(D) Representative flow cytometry plots of clonal mESC lines expressing miR-142-3p activity reporters under the control of bidirectional promoter variants with asymmetric outer promoter elements. [score:4]
In fact, an increase of the PGK-enhancer number led to a lower performance (variants ⑥ and ⑦) and a largely uncorrelated expression of the normalizer and detector genes, making the two miR-142 states indiscernible. [score:3]
miR-142 is expressed at two different levels in self-renewing mESCs, leading to a bimodal distribution of its activity reporter [40]. [score:3]
miR-142 expression is governed by a double negative feedback loop between miR-142 itself and KRAS/ERK signaling in LIF -dependent pluripotency. [score:3]
Stable transgenic mESCs lines expressing miR-142 reporters were generated by random transgene integration. [score:3]
The bimodally expressed microRNA miR-142 gates exit from pluripotency. [score:3]
To address these points in our promoter screen, we therefore exploited the known bimodal regulation of miR-142 [40] to gauge the efficacy of a given reporter to resolve cell-to-cell variations in miRNA activity within the same population. [score:2]
Comparing the performance of miR-142-3p activity reporters with different bidirectional promoters under pluripotency conditions. [score:2]
Using a single-cell fluorescent miRNA reporter, we have recently identified a single miRNA, miR-142, as a marker distinguishing two functionally distinct states in mouse embryonic stem cells (mESCs): a state amenable to differentiation cues and a state deaf to signaling changes [40]. [score:1]
A binding site perfectly complementary to mmu-miR-142-3p (miRBase Accession Number: MIMAT0000155) was inserted downstream of the H2B-Citrine stop codon by inserting annealed oligonucleotides (miR-142-3p_F: 5’-CTAGCAAGCTTTCCATAAAGTAGGAAACACTACAG-3’ and miR-142-3p_R: 5’-GATCCTGTAGTGTTTCCTACTTTATGGAAAGCTTG-3’) into the BamHI-, NheI-digested vector. [score:1]
We thus used miR-142-3p as a mo del miRNA, incorporating into each of the constructs variants a binding site perfectly complementary to miR-142-3p. [score:1]
[1 to 20 of 16 sentences]
28
[+] score: 46
Other miRNAs from this paper: mmu-mir-126a, mmu-mir-142a, mmu-mir-126b
Expression of miR-142 specifically suppressed protein production from NP segments carrying the corresponding target site (142T and DblT) but had no effect on ScrbT or 126T; similarly, expression of miR-126 suppressed NP protein production from 126T and DblT (Fig 1B) [32]. [score:11]
HEK-293T cells were co -transfected with plasmids expressing specific miRNAs (vector, miR142, miR126) and NP with miRNA target sites, and NP expression was analyzed by western blot. [score:7]
We also engineered an NP segment carrying two miR-142-3p and two miR-126-3p target sites (DblT) as well as a control NP segment carrying a scrambled target sequence (ScrbT, Fig 1A). [score:5]
Furthermore, replication of H5N1-142T was suppressed in mouse bone marrow derived dendritic cells (BMDC) and a macrophage like cell line (J774; Fig 1D and S1 Fig), both of which express high levels of miR-142 (Fig 1D) [28, 31]. [score:5]
Specifically, we generated H5N1 viruses containing endothelial cell specific miR-126 target sites (H5N1-126T) or hematopoietic cell specific miR-142 target sites (H5N1-142T), such that viral replication was abrogated in endothelial cells or hematopoietic cells, respectively. [score:5]
To generate H5N1 viruses incapable of replicating exclusively in hematopoietic or endothelial cells, we incorporated four copies of miRNA target sites (complementary sequence of a miRNA) for miR-142-3p (142T) or miR-126-3p (126T), respectively, into the 3’ UTR of the viral NP segment (Fig 1A). [score:3]
The Complementary sequences of miR-126-3p (126T; CGCATTATTACTCACGGTACGA), miR-142-3p (142T; TCCATAAAGTAGGAAACACTACA), and scrambled target sequence (ScrbT; GAGAATCTAAACGACTCAATACA) were incorporated into the NP segment. [score:3]
Prior miRNA profiling studies have shown that miR-142 and miR-126 are specifically expressed in hematopoietic or endothelial cells, respectively [27, 28, 30, 31]. [score:3]
DblT refers to the NP segment carrying two miR-142-3p and two miR-126-3p target sites. [score:3]
Conservation of miR-126-3p and miR-142-3p among different species. [score:1]
[1 to 20 of 10 sentences]
29
[+] score: 46
Moreover, CTX significantly changed the expressions of mmu-miR-106b* (down-regulation), mmu-miR-144 (down-regulation), mmu-miR-669k* (down-regulation), mmu-miR-142-3p (up-regulation), mmu-miR-210 (up-regulation) and mmu-miR-223 (up-regulation) in CD34 [+]SCA1 [+] BMHSCs (Figure 3G–3L). [score:21]
To sum up, SHSB granule might cure CTX -induced myelosuppression and increase WBCs via enhancing CD34 [+]SCA1 [+] BMHSCs proliferation (SHSB granule up-regulated the expressions of mmu-miR-106b*, mmu-miR-144 and mmu-miR-669k*, as well as down-regulated the expressions of mmu-miR-142-3p, mmu-miR-210 and mmu-miR-223 in CD34 [+]SCA1 [+] BMHSCs). [score:13]
On the contrary, mmu-miR-142-3p (Figure 3J), mmu-miR-210 (Figure 3K) and mmu-miR-223 (Figure 3L) in CD34 [+]SCA1 [+] BMHSCs were up-regulated after CTX treatment. [score:4]
Shuanghuang Shengbai might promote the proliferation of CD34 [+]SCA1 [+] bone marrow hematopoietic stem cells via up -regulating mmu-miR-106b*, mmu-miR-144, and mmu-miR-669k*, as well as down -regulating mmu-miR-142-3p, mmu-miR-210, and mmu-miR-223. [score:3]
Therefore, SHSB might enhance BMHSCs proliferation via up -regulating mmu-miR-106b*, mmu-miR-144 and mmu-miR-669k*, as well as down -regulating mmu-miR-142-3p, mmu-miR-210 and mmu-miR-223. [score:3]
These results indicated that SHSB reversed the effects of CTX on microRNAs like mmu-miR-106b*, mmu-miR-144, mmu-miR-669k*, mmu-miR-142-3p, mmu-miR-210 and mmu-miR-223 in CD34 [+]SCA1 [+] BMHSCs. [score:1]
Moreover, miR-32*, miR-466i-5p, and mmu-miR-669c in SP [+] lung cancer stem cells were confirmed, as well as mmu-miR-106b*, mmu-miR-144, mmu-miR-669k*, mmu-miR-142-3p, mmu-miR-210, and mmu-miR-223 in CD34 [+]SCA1 [+] bone marrow hematopoietic stem cells. [score:1]
[1 to 20 of 7 sentences]
30
[+] score: 40
In silico miRNA Target Selection PipelineTarget sites for mmu-miR-1a-3p (miR-1), miR-133a-1 (miR-133), miR-142a-3p (miR-142), miR-183-5p (miR-183), miR-96-5p (miR-96) and miR-182-5p (miR-182) were predicted employing Diana-microT (v. 3.0) 61, miRanda (Aug 2010 release) 62 and TargetScan tools (v. 6.2) 4, and filtered for sites predicted by at least two prediction tools. [score:7]
As hsa-miR-142 targeting of RAC1 was shown in human hepatocellular carcinoma cell lines 53, miR-142 targeting of Rac1 is also possible. [score:5]
In Silico Target SelectionAltered expression of miR-1, miR-133, miR-142 and miR-183/96/182 in the R347 mouse mo del has been observed 12. [score:5]
Target sites for mmu-miR-1a-3p (miR-1), miR-133a-1 (miR-133), miR-142a-3p (miR-142), miR-183-5p (miR-183), miR-96-5p (miR-96) and miR-182-5p (miR-182) were predicted employing Diana-microT (v. 3.0) 61, miRanda (Aug 2010 release) 62 and TargetScan tools (v. 6.2) 4, and filtered for sites predicted by at least two prediction tools. [score:5]
Focusing on predicted targets for modulated miRNAs in R347 retina, including miR-1/133, miR-142 and miR-183/96/182, high-throughput proteome analysis provided a unique opportunity to explore miRNA regulation in a mo del system for inherited retinopathy. [score:4]
Note, that the Rac1 3′UTR also contains a predicted miR-142 target site, functionality of which we did not test. [score:3]
Altered expression of miR-1, miR-133, miR-142 and miR-183/96/182 in the R347 mouse mo del has been observed 12. [score:3]
Specifically, 23, 10, 6, 18, 35 potential target genes were identified for miR-1, miR-133, miR-142, miR-183, miR-96 and miR-182, respectively (Supplementary Table S3). [score:3]
Of the six miRNAs modulated in R347 retinas 12 the Rac1 3′UTR contains a predicted combined target site for miR-96/182 (Fig. 3g) and a site for miR-142 (Fig. 3g). [score:3]
In contrast, levels of Rac1 protein in retinal membrane protein extracts were reduced by ~40% (Table 2), perhaps due to regulation via miR-142. [score:2]
[1 to 20 of 10 sentences]
31
[+] score: 39
Figure 5 shows that the miRNAs let-7a-5p, let-7c-5p, miR-122-5p, miR-142-3p, miR-29b-3p, and miR-30c-5p are up-regulated and the miRNA species miR-669n and miR-709 are down-regulated in livers of vaccination -induced self-healing infections on day 11 p. i. in comparison to lethal infections in non-vaccinated mice, thus confirming our microarray analyses. [score:7]
Moreover, the present study shows that the expression level of mir-142-3p is significantly up-regulated during crisis by more than 100% in the liver of vaccinated mice as compared with non-vaccinated mice, i. e., this percental difference during crisis is by far higher than those found for all other malaria-responsive miRNA species in the liver. [score:5]
It appears therefore plausible to assume that the up-regulation of mir-142-3p observed here during crisis is involved in enhanced erythropoiesis at the expense of megakaryopoiesis in the liver of vaccination -induced self-healing infections of P. chabaudi malaria (Al-Quraishy et al., 2016). [score:4]
Thus, our data showing up-regulation of mir-142-3p may suggest that protective vaccination affects hepatic megakaryopoiesis induced by P. chabaudi blood-stage malaria during crisis. [score:4]
Recent evidence indicates that the miRNA-142 locus is important for the regulation of macrophage-related processes, as e. g., macrophage and dendritic cell differentiation (Fordham et al., 2015), regulation of cell migration (Kim et al., 2015), control of profibrogenic macrophage program (Su et al., 2015), role in colony-stimulating factor 1 -induced monocyte differentiation into macrophages (Lagrange et al., 2013), prevention of macrophage differentiation during cancer -induced myelopoiesis (Sonda et al., 2013). [score:3]
Regulation of mi-24, miR-30b, and miR-142-3p during macrophage and dendritic cell differentiation potentiates innate immunity. [score:2]
On the other hand, however, there is evidence that miR-142-3p is also involved in the regulation of erythropoiesis (Muhseen and Abbood, 2014). [score:2]
MiR-142-3p regulates cardiovascular system during zebra fish development. [score:2]
miR-142 orchestrates a network of action cytoskeleton regulators during megakaryopoiesis. [score:2]
miR-142-5p and miR130a-3p are regulated by IL-4 and Il-13 and control profibrogenic macrophage program. [score:2]
miR-142-3p is a regulator of the TGFbeta -mediated vascular smooth muscle cell phenotype. [score:2]
The miRNA-142-3p stringently controls specific cytoskeletal rearrangements required for maturation and function of megakaryocytes, and genetic deletion of miR-142-3p results in impaired megakaryocyte ablation, cytoskeletal dys-integrity, abnormal proplatelet formation and thrombocytopenia (Chapnik et al., 2014). [score:1]
A role for miR-142-3p in colony-stimulating factor 1 -induced monocyte differentiation into macrophages. [score:1]
miR142-3p prevents macrophage differentiation during cancer -induced myelopoiesis. [score:1]
Currently, however, the most unequivocal evidence demonstrates that mir-142-3p is critical for megakaryopoiesis (Chapnik et al., 2014). [score:1]
[1 to 20 of 15 sentences]
32
[+] score: 39
This network reveals five putative direct targets: CACNA1C (Calcium channel) target of miR-149-5p; GJA5 (Gap Junction protein, alpha 5), RNF207 (Ring finger protein 207) and KCNA1 (potassium voltage-gated channel shaker-related subfamily, member 1) targets of miR-145-5p; KCNA1 which is also a miR-21-5p target; and finally, SLC18A2 (Solute carrier family 18 member 2) target of miR-142-5p. [score:12]
Conversely, SLC18A2 gene is downregulated while miR-142-5p is upregulated (Fig 7D). [score:7]
Ingenuity Pathway Analysis (IPA) software was used to identify molecular networks and targets of the miRNAs miR-146b, miR-21, miR-142-3p miR-142-5p, miR-145 and miR-149, which were differentially expressed in all three time points post infection and were significantly correlated both with changes in parasitemia and QTc interval. [score:5]
As observed, four out of those six miRNAs (miR-142-5p, miR-21-5p, miR-145-5p and miR-149-5p), directly or indirectly regulate several genes involved with QTc interval length. [score:4]
The alterations occurring in the host microRNA profile observed here reflect the role of these molecules in the acute phase of the infection and may highlight important aspects of the pathogenesis, opening a broad range of possibilities in the study of Chagas disease S1 Fig In silico analysis done using the IPA software (Ingenuity Systems, USA) showing a biological network built with four miRNAs (miR-142-5p, miR-21-5p, miR-145-5p and miR-149-5p). [score:3]
According to our network analysis, it was predicted as a miR-142-5p target. [score:3]
In silico analysis done using the IPA software (Qiagen, USA) showing a biological network built with 4 miRNAs (miR-142-5p, miR-21-5p, miR-145-5p and miR-149-5p) from the 6 (miR-146b, miR-21-5p, miR-142-3p, miR-142-5p, miR-145-5p and miR-149) uploaded for the analysis. [score:1]
In addition, six (out of nine) microRNAs were significantly correlated with changes in both parasitemia and QTc interval: miR-146b, miR-21, miR-142-3p miR-142-5p (positive correlation) and miR-145-5p and miR-149-5p (negative correlation) (Fig 5). [score:1]
0003828.g006 Fig 6 In silico analysis done using the IPA software (Qiagen, USA) showing a biological network built with 4 miRNAs (miR-142-5p, miR-21-5p, miR-145-5p and miR-149-5p) from the 6 (miR-146b, miR-21-5p, miR-142-3p, miR-142-5p, miR-145-5p and miR-149) uploaded for the analysis. [score:1]
In silico analysis done using the IPA software (Ingenuity Systems, USA) showing a biological network built with four miRNAs (miR-142-5p, miR-21-5p, miR-145-5p and miR-149-5p). [score:1]
Individual mature miRNAs and their respective putative gene targets: A) miR-149-5p and CACAN1C B) miR-21-5p, miR-145-5p and KCNA1 C) miR-145-5p and KCNA1, GJA5, RNF207 and D) miR-142-5p and SLC18A2 were measured by real time RT-PCR in each time point post infection (15, 30 and 45) in four animals per group. [score:1]
[1 to 20 of 11 sentences]
33
[+] score: 39
Brown and colleagues used target sequences of hematopoietic lineage-specific miR-142.3 to eliminate off-target expression in hematopoietic cells. [score:7]
To analyse regulation of transgene expression, NR8383, 293T and Huh7 cells were transduced at a MOI of 10 with a lentiviral vector carrying either miR-142 or miR-122 target sequences. [score:6]
Muscle-specific miR-133, liver specific miR-122, or hematopoietic specific miR-142 target sequences were shown to work synergistically with the TetR-KRAB cassette and enable tissue-specific expression. [score:5]
This indicated that the miR-142 target sequence enabled specific regulation in cells of the hematopoietic lineage. [score:4]
After transduction with miR-142-regulated vectors, transgene expression did not change in the absence or presence of doxycycline (Figs. 4c, d). [score:4]
The first included a constitutively active promoter (PGK, phosphoglycerate kinase or CMV, cytomegalovirus) driving a TetR-KRAB sequence, which was linked to four tandem repeats of a target sequence designed to be perfectly complementary to miR-122 (TGG AGTGTGACAATGGTGTTTGTGT), miR-142.3p (TCCATAAAGTAGGAAACACTACA) and miR-133 (ACAGCTGGTTGAAGGGGACCAA). [score:3]
We designed a DNA cassette in which the TetR-KRAB coding sequence contained 4 copies of perfectly complementary miR-142 target sequences. [score:3]
In contrast a significant decrease was detected with vectors containing the miR-142 target sequences. [score:3]
Expected specific expression of miR-142 in NR8383 and its absence in Huh7 and 293T cells was demonstrated using RT-qPCR (Fig. 4b). [score:3]
In 293T cells we observed a significant decrease in mean fluorescence intensity when doxycycline was withdrawn from cells that had been infected with vectors containing miR-142-mTTR GFP and miR-122-mTTR GFP cassettes. [score:1]
[1 to 20 of 10 sentences]
34
[+] score: 37
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-27a, hsa-mir-29a, hsa-mir-101-1, dme-mir-1, dme-mir-2a-1, dme-mir-2a-2, dme-mir-2b-1, dme-mir-2b-2, dme-mir-10, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-101a, mmu-mir-124-3, mmu-mir-126a, mmu-mir-133a-1, mmu-mir-137, mmu-mir-140, mmu-mir-142a, mmu-mir-155, mmu-mir-10b, mmu-mir-183, mmu-mir-193a, mmu-mir-203, mmu-mir-143, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-183, hsa-mir-199b, hsa-mir-203a, hsa-mir-210, hsa-mir-222, hsa-mir-223, dme-mir-133, dme-mir-34, dme-mir-124, dme-mir-79, dme-mir-210, dme-mir-87, mmu-mir-295, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, dme-let-7, dme-mir-307a, dme-mir-2c, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-137, hsa-mir-140, hsa-mir-142, hsa-mir-143, hsa-mir-126, hsa-mir-193a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-29a, mmu-mir-27a, mmu-mir-34a, mmu-mir-101b, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-155, mmu-mir-10a, mmu-mir-210, mmu-mir-223, mmu-mir-222, mmu-mir-199b, mmu-mir-124-1, mmu-mir-124-2, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-378a, mmu-mir-378a, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-411, hsa-mir-193b, hsa-mir-411, mmu-mir-193b, hsa-mir-944, dme-mir-193, dme-mir-137, dme-mir-994, mmu-mir-1b, mmu-mir-101c, hsa-mir-203b, mmu-mir-133c, mmu-let-7j, mmu-let-7k, mmu-mir-126b, mmu-mir-124b
iso1 was upregulated by 2.3-fold in psoriatic skin (Supplementary Table S10) and shown to repress targets distinct from the targets of miR-142-3p. [score:8]
iso1 (Supplementary Table S10) was upregulated 2.3-fold in psoriatic involved skin (PP) versus normal skin (NN), suggesting a role of miR-142-3p. [score:4]
Consistently, mmu-miR-142 and its 5′-isomiR had similar effects on their exclusive targets in the miR-142 knockout data (4.1E-07 versus 5.0E-08 on 8mer in Supplementary Table S9). [score:4]
Taken together, the high abundance and upregulation of 5′-isomiRs of hsa-miR-203 and hsa-miR-142 may indicate their functional roles in inflammatory and hyperproliferative phenotype of psoriatic lesions. [score:4]
For example, miR-142-3p has a 2.5-fold upregulation in psoriatic lesions (35); consistently, miR-142-3p. [score:4]
For example, miR-142 had a high 5′-heterogenity among all the mammalian small -RNA datasets that were examined, indicating a ubiquitous expression of 5′-isomiRs from miR-142 hairpin (Supplementary Tables S2 and S3). [score:3]
5′-isomiRs have also been noticed on both the 5p and 3p arms of hsa-miR-142 hairpin in T cells where miR-142 is the most highly expressed miRNA in naive T cells (70). [score:3]
Microarray datasets of mmu-miR-223 and mmu-miR-142 knockout experiments (GSE22004, GSE42325, Supplementary Table S1B) were collected in recent studies (21, 46). [score:2]
Our recent study has revealed the epidermal infiltration of the hematopoietic-specific miR-142-3p in psoriatic lesions (35). [score:1]
In light of the function of many miRNAs (e. g. miR-203 and miR-142) in skin and psoriasis, DE 5′-isomiRs (such as miR-203-3p. [score:1]
Another 5′-isomiR, miR-142-3p. [score:1]
In addition, the mmu-miR-142 hairpin had similar arm abundances between miRNA and 5′-isomiR (45% versus 55%) in dendritic cells (GSM539853). [score:1]
iso1 and miR-142-3p. [score:1]
[1 to 20 of 13 sentences]
35
[+] score: 36
The ten most up-regulated miRNAs included mmu-miR-205-5p, mmu-miR-222-3p, mmu-miR-205-3p, mmu-miR-146b-5p, mmu-miR-21-5p, mmu-miR-21-3p, mmu-miR-221-3p, mmu-miR-140-3p, mmu-miR-142-5p, and mmu-miR-140-5p and the ten most down-regulated miRNAs comprised mmu-miR-211-5p, mmu-miR-3096-5p, mmu-miR-711, mmu-miR-466h-5p, mmu-miR-130b-3p, mmu-miR-3082-5p, mmu-miR-1199-5p, mmu-miR-669b-5p, mmu-miR-1187, and mmu-miR-1224-5p (Table 1). [score:7]
The top ten miRNAs being significantly up-regulated by curcumin treatment comprised mmu-miR-205-5p (135-fold), mmu-miR-205-3p (9-fold) and mmu-miR-142-5p (6-fold). [score:4]
Down-regulation of miR-142-5p is associated with recurrence and poor overall survival in gastric and pancreatic cancer patients [12], [44]. [score:4]
Taken together, these results indicate that the curcumin-regulated miRNAs mmu-miR-205-5p, mmu-miR-205-3p, mmu-miR-142-5p and mmu-miR-130b-3p represent promising targets as well as markers to determine the aggressiveness and metastatic activity of malignant tumors. [score:4]
To investigate whether the curcumin -induced expression pattern of the key miRNAs identified in the in vivo experiments is also transferable to other melanoma cell lines, murine B78H1 cells as well as human SK-MEL-28 (ATCC® HTB-72™) and MeWo cells (ATCC® HTB-65™) were treated with 20 µM curcumin or vehicle (0.1% DMSO; control) at 37°C and 5% CO [2] for 48 h. Subsequently, the cells were harvested and the expression of mmu-miR-205-5p, mmu-miR-205-3p (or hsa-miR-205-3p for human cells), mmu-miR-142-5p and mmu-miR-130b-3p was analyzed by qRT-PCR, as described above. [score:3]
The expression levels of mmu-miR-205-5p, mmu-miR-205-3p, mmu-miR-142-5p and mmu-miR-130b-3p, which have previously been described in the literature as miRNAs with potential anti-cancer properties [37], [38], were confirmed by qRT-PCR (Figure 2). [score:3]
For the validation of the miRNA microarray results, qRT-PCR was performed to analyze the expression of the four selected miRNAs mmu-miR-205-5p, mmu-miR-205-3p, mmu-miR-142-5p and mmu-miR-130b-3p using miScript PCR System (Qiagen). [score:3]
0081122.g002 Figure 2 The diagrams display bar charts on the fold expression (compared to control) of mmu-miR-205-5p, mmu-miR-205-3p, mmu-miR-142-5p and mmu-miR-130b-3p in curcumin -treated B78H1 melanoma, as assessed by miRNA array (grey bars) and qRT-PCR (black bars). [score:2]
The diagrams display bar charts on the fold expression (compared to control) of mmu-miR-205-5p, mmu-miR-205-3p, mmu-miR-142-5p and mmu-miR-130b-3p in curcumin -treated B78H1 melanoma, as assessed by miRNA array (grey bars) and qRT-PCR (black bars). [score:2]
0081122.g003 Figure 3 The diagram displays bar charts on the fold expression (compared to vehicle -treated control cells) of mmu-miR-205-5p, mmu-miR-205-3p, mmu-miR-142-5p and mmu-miR-130b-3p of curcumin -treated murine B78H1 (white bars), human SK-MEL-28 (grey bars) and human MeWo melanoma cells (black bars), as assessed by qRT-PCR. [score:2]
The diagram displays bar charts on the fold expression (compared to vehicle -treated control cells) of mmu-miR-205-5p, mmu-miR-205-3p, mmu-miR-142-5p and mmu-miR-130b-3p of curcumin -treated murine B78H1 (white bars), human SK-MEL-28 (grey bars) and human MeWo melanoma cells (black bars), as assessed by qRT-PCR. [score:2]
[1 to 20 of 11 sentences]
36
[+] score: 34
Other miRNAs from this paper: mmu-mir-142a
Indeed, GLAST dysfunction in EAE cerebellum depends on a downregulation of the protein which is caused by an IL-1β -dependent upregulation of miR-142-3p, which targets the Slc1a3 mRNA coding for GLAST [25, 26]. [score:9]
On the one hand, laquinimod induced a transcriptional upregulation of GLAST with no effect in terms of protein enhancement, likely due to the inhibitory action of miR-142-3p that is still high despite the presence of laquinimod. [score:6]
These data suggest that, although laquinimod induced an upregulation of the Slc1a3 mRNA, GLAST protein synthesis was impaired likely due the presence of high levels of miR-142-3p in EAE cerebellum. [score:4]
a– d qPCR experiments performed on EAE cerebellar slices incubated with or without laquinimod (30 μM, 2 h) show that laquinimod did not modulate IL-1β mRNA (a), miR-142-3p (b), and GFAP mRNA (d) while significantly upregulated Slc1a3 mRNA coding for GLAST (c). [score:4]
We have recently demonstrated that GLAST is regulated at posttranscriptional level by miR-142-3p under inflammatory conditions in EAE brain and likely in MS. [score:2]
Fig. 3The anti-excitotoxic effect of laquinimod does not involve the IL-1β-miR-142-3p-GLAST regulatory axis. [score:2]
Therefore, we first used qPCR to quantify the expression level of IL-1β mRNA, miR-142-3p, and Slc1a3 mRNA in EAE cerebellar slices incubated with 30 μM laquinimod compared with EAE-vhl slices. [score:2]
One-way ANOVA post hoc comparisons: EAE-vhl vs CFA control ** p < 0.01, *** p < 0.001; EAE-laquinimod vs EAE-vhl # p < 0.05, ### p < 0.001 We speculated whether laquinimod beneficial effect on EAE synaptic alterations could be due to the interference with the excitotoxic mechanism involving the IL-1β-miR-142-3p-GLAST regulatory axis, recently described in [26]. [score:2]
Astrogliosis and the regulatory axis IL-1β /miR-142-3p, which impairs GLAST protein synthesis, seem to be unaffected by the treatment. [score:2]
The beneficial effect of laquinimod on glutamatergic transmission is independent of IL-1β-miR-142-3p-GLAST axis. [score:1]
[1 to 20 of 10 sentences]
37
[+] score: 34
Therefore, we generated detargeted viruses by inserting two tandem copies of miR-124, miR-125b, or either miR-142-3p target sequences immediately preceding the pCT in the 5′ NCR or two copies each of miR-133b and miR-208a [133/208(2×)] target sequences or four copies of miR-142-3p target sequences in the 3′ NCR of vMC [24]. [score:9]
The replication of miRT viruses was compared to that of unmodified vMC [24] using single-step growth curve analysis (Fig. 2B) in H1HeLa cells, which do not express any of the corresponding miRNAs, and in RAW 264.7 macrophages, which express high levels of miR-142 and intermediate levels of miR-125b (37, 38, 42). [score:4]
As a control, we employed miR-142, which is exclusively expressed in cells of hematopoietic lineage (37, 38). [score:3]
This inhibition of viral replication by the 3′ NCR insertions may be due to the presence of miR-142, miR-133, or miR-208 in certain cells or nonspecific effects of the insertions themselves. [score:3]
To analyze the genetic stability of the miRT sequences under selective pressure, vMC [24]-H, -H2, and -NC were serially passaged 10 times at high MOI in MPC-11 cells, which express high levels of miR-142. [score:3]
However, in RAW 264.7 macrophages, viruses encoding either miR-125b or miR-142 target sequence replicated with diminished kinetics or did not replicate at all, resulting in significantly lower peak viral yields. [score:3]
The targeting specificity of the inserts was verified in vitro, both in the presence of exogenously delivered miRNA mimics and as naturally occurring levels of miR-125 and miR-142. [score:3]
To enhance its safety profile, microRNA target sequences complementary to miR-124 or miR-125 (enriched in nervous tissue), miR-133 and miR-208 (enriched in cardiac tissue), or miR-142 (control; enriched in hematopoietic tissues) were inserted into the vMC [24] NCRs. [score:3]
Unexpectedly, mice injected with vMC [24]-H2 or vMC [24]-C also had reduced mean viral loads in all three tissues, suggesting that either the placement of the insert can control viral replication in vivo or that there are low to intermediate levels of miR-142, miR-133, or miR-208 present regulating viral tropism. [score:2]
Sequences complementary to miR-142, miR-124, miR-125, miR-133, and miR-208 were successfully incorporated (individually or in combination) into the 5′ and 3′ NCRs of the vMC [24] genome. [score:1]
[1 to 20 of 10 sentences]
38
[+] score: 33
Other miRNAs from this paper: mmu-mir-142a, mmu-mir-21a, mmu-mir-21b, mmu-mir-21c
Predicated by TargetScan and FINDTAR3, 14 genes were putative targets of miR-142, in which 4 genes was downregulated (Fig. S2). [score:8]
We also noticed that Gfi1 was downregulated in CCR6 [+] Tregs, indicating that Gfi1 might be a target of miR-142. [score:6]
Recent evidence showed that miR-142 was highly expressed in Tregs and could regulate the expansion of Tregs in response to stimulation (Zhou et al., 2013). [score:4]
In this study, we observed that miR-142 was significantly upregulated in CCR6 [+] Tregs. [score:4]
575/supp-1 Figure S1The relative expression of miR-142 and miR-21 in CCR6 [+] TregsCCR6 [+] Tregsand CCR6 [-] Tregs were purified from splenocytes in Balb/c mice by FACSsorting. [score:3]
The relative expression of miR-142 and miR-21 in CCR6 [+] Tregs. [score:3]
Thus, further study on miR-142 function will help us understand the regulatory role of miR-142 in the function and proliferation of CCR6 [+] Tregs. [score:2]
The relative expression of miR-142 and miR-21 in CCR6 [+] Tregscells was determined by Realtime PCR assay. [score:2]
miR-142, a distinct member of the miRNA family, is highly conserved across species and is linked to chromosome 3p22.3/12q14. [score:1]
[1 to 20 of 9 sentences]
39
[+] score: 30
Since miR-142-3p (target protein IL-6), miR-155(target protein TAB2) and miR-152 (target protein CaMK II) were increased in allografts, we could speculate that miR-142-3p and miR-155 may combine with mRNAs of IL-6 and TAB2 and induce their degradation. [score:7]
Validated by quantitate RT-PCR and western blot, we proclaimed that increased mmu-miR-142-3p and mmu-miR-155 down regulated mRNA of IL-6 and TAB2, while highly expressed mmu-miR-152 could silence mRNA of CaMK II and down regulate the translation of CaMK II, which may play an important role in tolerance induction, indicating it could be a potential spot for clinic application. [score:7]
To our surprise, there were only 3 predicted target genes had a significant change in mRNA level (CaMK II, IL-6, TAB2), while the others were not (AKT, IL-1, P53, RIP140, TLR3, UCP-2, RAB9b, CYCLIN M4), as was shown in Figure 3. The mRNAs levels of IL-6 and TAB2 were down-regulated by increased mmu-miR-142-3p and mmu-miR-155 in allogeneic grafts compared with syngeneic grafts. [score:5]
IL-6 was predicted to be targeted by miR-142-3p. [score:3]
In vivo delivery of a miR-142-3p regulated transgene could induce antigen-specific regulatory T cells and promoted immunologic tolerance [25], [26]. [score:3]
For example, miR-142-3p could regulate cytokine-cytokine receptor interaction and Fc gamma R mediated phagocytosis, while miR-152 played a role in endocytosis and membrane associated granulate kinase. [score:2]
mRNAs of IL-6 and TAB2 was down regulated by increased mmu-miR-142-3p and mmu-miR-15, while mmu-miR-152 and mRNA of CaMK II was both increased in allografts compared with syngrafts. [score:1]
Among them, miR-142-3p was involved in Fc gamma R -mediated phagocytosis. [score:1]
Mmu-miR-142-3p was involved in cytokine-cytokine receptor interaction, JAK-STAT signaling pathway, and chemokine signaling pathway, Fc gamma R -mediated phagocytosis and cell adhesion molecules. [score:1]
[1 to 20 of 9 sentences]
40
[+] score: 29
We further tested the influence of Dicer inactivation on a reporter system where miR-142-3p expressed from a pGIPZ derivative inhibits the expression of a reporter luciferase construct carrying miR-142-3p target sequences. [score:9]
Generation of L929 Cells Overexpressing miR-770-3p and Construction of a miR-142-3p Expressing Vector. [score:5]
miR-142-3p was overexpressed in cells by transient transfection of pADC38, a pGIPZ (GE Dharmacon-Thermofisher, Erembodegem, Belgium) derivative that drives the expression of artificial miRNAs based on the backbone of miR30, from a RNA polymerase II promoter. [score:5]
Recently, it has been described that miR-142-3p inhibits the replication of Eastern equine encephalitis virus in murine macrophages and dendritic cells [21]. [score:3]
In the 3′ UTR region of the Renilla luciferase gene, we subcloned a BsiWI/ XbaI fragment carrying 4 tandem target sequences for miR-770-3p and miR-142-3p, yielding plasmids pADC30 and pADC39, respectively. [score:3]
In cells transduced with the control lentiviral vector that does not express Cre, miR-142-3p triggered an important decrease of Renilla luciferase activity (Figure 3A,B). [score:3]
To construct this plasmid, a 430 bp genomic sequence encompassing the miR-142-3p short hairpin sequence was amplified by PCR from C57BL/6 mouse genomic DNA and subcloned in pGIPZ using XhoI/ BamHI restriction sites. [score:1]
[1 to 20 of 7 sentences]
41
[+] score: 27
CD84 and IL-10 are predicted targets of miR-142-3p, while signaling lymphocytic activation molecule -associated protein (SAP) is a potential target of miR-142-5p. [score:5]
miR-126, miR-142-3p, and miR-142-5p are predicted to target genes associated with SLE, which implicates their aberrant expression in CD4 [+] T cells in LN pathogenesis. [score:5]
Decreased expression of miR-142-3p and miR-142-5p in SLE CD4 [+] T cells was confirmed in studies by Ding et al. [73]. [score:3]
These results indicate that reduced expression of miR-142-3p and miR-142-5p in CD4 [+] T cells of SLE patients contributes to T cell hyperactivity and B cell hyperstimulation [73]. [score:3]
Although many miRNAs are expressed in T cell subsets, one study found 7 miRNAs (miR-16, miR-21, miR-142-3p, miR-142-5p, miR-150, miR-15b, and let-7f) account for almost 60% of all T cell miRNAs. [score:3]
SAP protein production was decreased after inhibition of mir-142-5p. [score:3]
When miR-142-3p was inhibited in CD4 [+] T cells from healthy donors, protein levels of CD84 and IL-10 increased. [score:3]
In addition, the expression of miR-142-3p and miR-142-5p was reduced to less than half in SLE CD4 [+] T cells compared to CD4 [+] T cells from healthy controls. [score:2]
[1 to 20 of 8 sentences]
42
[+] score: 25
Other miRNAs from this paper: mmu-mir-142a, hsa-mir-142
Here we show that IDLVs can be used to express transgenes for a window of time in the liver as long as the expression is stringently targeted to hepatocytes with transcriptional and miR-142–mediated regulation. [score:8]
8 The vectors carried target sequences for miR-142 in the transgene 3′-untranslated region (3′-UTR; ET. [score:5]
These results indicate that the pattern of OVA expression driven by miR-142–regulated IDLVs in the liver favored the conversion of transgene-specific naive CD4 [+] T cells into transgene-specific FOXP3 [+] -induced Tregs (Fig. 7B,C). [score:4]
142T: miR-142 target sequence made of 4 tandem copies of a sequence perfectly complementary to miR-142. [score:3]
The frequency of CD4 [+]CD25 [+]FOXP3 [+] regulatory T cells (Tregs; FOXP3 = forkhead box P3) increased in the liver after treatment with both IDLV types 3 weeks after vector administration; however, the ratio of Tregs to CD8 [+] effector cells was much higher in the mice treated with miR-142-regulated vector than in control vector treated mice (Fig. 5C,D). [score:3]
CD8 [+] T cell infiltration was well detected 1 week after IDLV treatment independently of the presence or absence of miR-142 regulation. [score:2]
[1 to 20 of 6 sentences]
43
[+] score: 25
There were four up-regulated miRNAs (mmu-miR-709, mmu-miR-467a-3p, mmu-miR-182-5p and mmu-miR-25-5p) and seven down-regulated miRNAs (mmu-miR-615-3p, mmu-miR-409-3p, mmu-miR-680, mmu-miR-129-5p, mmu-miR-151-5p, mmu-miR-142-5p and mmu-miR-30b-5p), as the values presented in Table 1. Then we performed unsupervised hierarchical clustering of the eleven miRNAs. [score:7]
Among the ten miRNAs validated by qRT-PCR, we found that mmu-miR-487b-5p, mmu-miR-709, mmu-miR-182-5p, mmu-miR-214-3p and mmu-miR-467a-3p were up-regulated in HCC-activated Tregs, mmu-miR-142-5p, mmu-miR-30b-5p, mmu-miR-409-3p and mmu-miR-129-5p were down-regulated (P < 0.01), while miR-344e-5p did not change significantly, as shown in Figure 1C. [score:7]
Control) P -valuemmu-miR-25-5p2.210.04mmu-miR-7091.980.02mmu-miR-467a-3p1.820.04mmu-miR-182-5p1.540.05mmu-miR-129-5p0.290.02mmu-miR-6800.340.02mmu-miR-615-3p0.360.00mmu-miR-409-3p0.440.02mmu-miR-30b-5p0.510.05mmu-miR-151-5p0.610.03 mmu-miR-142-5p 0.63 0.04By TargetScan, we found that mmu-miR-25-5p, mmu-miR-615-3p, mmu-miR-151-5p and mmu-miR-680 had few target genes directly relating with Tregs in MeSH database, so we excluded the four miRNAs for further exploration. [score:6]
Compared with the healthy controls, the expression levels of hsa-miR-182-5p, hsa-miR-214-3p, hsa-miR-129-5p and hsa-miR-30b-5p were significantly up-regulated in Tregs from HCC patients while the hsa-miR-409-3p and hsa-miR-142-5p did not show significant changes (Figure 3). [score:5]
[1 to 20 of 4 sentences]
44
[+] score: 23
These include on the one hand the up-regulated miRNAs: mmu-miR-342-3p, mmu-miR-142-3p, mmu-miR-142-5p, mmu-miR-21, mmu-miR-335-5p, mmu-miR-146a, mmu-miR-146b, mmu-miR-674 and mmu-miR-379; and on the other hand the down-regulated ones after HFD -induced obesity: mmu-miR-122, mmu-miR-133p, mmu-miR-1, mmu-miR-30a, mmu-miR-192 and mmu-miR-203. [score:7]
Furthermore, Akt1, a target of mmu-miR-142-3p, is also involved in this regulation [30]. [score:4]
The following miRNAs were found to be up-regulated in WAT after HFD feeding: mmu-miR-342-3p, mmu-miR-222, mmu-miR-221, mmu-miR-142-3p, mmu-miR-142-5p, mmu-miR-21, mmu-miR-335-5p, mmu-miR-146a, mmu-miR-146b, mmu-miR-647* and mmu-miR-379. [score:4]
The following 22 murine microRNAs were selected for qPCR validation of their expression: mmu-miR-1, mmu-miR-21, mmu-miR-30a*, mmu-miR-30e*, mmu-miR-122, mmu-miR-130a, mmu-miR-133b, mmu-miR-141, mmu-miR-142-3p, mmu-miR-142-5p, mmu-miR-146a, mmu-miR-146b, mmu-miR-192, mmu-miR-193a-3p, mmu-miR-200b, mmu-miR-200c, mmu-miR-203, mmu-miR-204, mmu-miR-222, mmu-miR-342-3p, mmu-miR-378 and mmu-miR-379. [score:3]
The mmu-miR-142-5p-regulated genes, Bmp-4 and Fgf10, are involved in adipogenesis regulation [29]. [score:3]
Both mmu-miR-142-3p and mmu-miR-142-5p derive from the stem loop precursor of mmu-miR-142. [score:1]
This is the first study to connect mmu-miR-142 with obesity; however, further experiments are warranted to elucidate its role in this process. [score:1]
[1 to 20 of 7 sentences]
45
[+] score: 20
Table S9 List of genes in mouse genome targeted by the differentially expressed murine miRNA (miR-142-3p). [score:5]
Furthermore, the significance of the differential expression of mouse miRNA, miR-142-3p, suggests involvement in gene regulation during lytic infection of MHV68; thus its targets are of primary interest for further investigation. [score:4]
More importantly, one of the murine miRNAs (miR-142-3p) in the host genome exhibited more than 35-fold up-regulation in lytically infected cells in reference to mock -treated cells with the percentage of false positive (pfp) less than 0.001 (see ). [score:4]
On the other hand, no ORF in the viral genome was predicted to be a target of miR-142-3p, indicating that MVH68 might have evolved to avoid counter-attack of the host miRNAs' regulation. [score:4]
A total of 240 mRNA genes in the mouse genome were predicted to be putative targets of miR-142-3p (Table S9). [score:3]
[1 to 20 of 5 sentences]
46
[+] score: 18
The combinatorial effect of ten down-regulated miRNAs (miR-144-3p, miR-33-5p, miR-32-5p, miR-1983, miR-136-5p, miR-142-3p, miR-376a-3p, miR-142-5p, miR-3968, and miR-29b-3p) reveals that a total of 61, 51, 48, and 37 target genes are significantly affected in PI3K-Akt, focal adhesion, cancer pathways, and transcriptional misregulation pathway respectively (p<0.001) (Figure 4). [score:7]
Ten miRNAs (miR-144-3p, miR-33-5p, miR-32-5p, miR-1983, miR-136-5p, miR-142-3p, miR-376a-3p, miR-142-5p, miR-3968, and miR-29b-3p) were differentially expressed (log fold change>1) and down-regulated in chronically treated SKH1 mice compared to untreated controls (Table 1-3). [score:5]
The miR-142-3p can also target ECM-receptor interaction, PI3K-Akt signaling, focal adhesion signaling, and mTOR signaling. [score:3]
Other gene Rac1 is targeted by miR-142a-3p (old name miR-142-3p) in our present study. [score:3]
[1 to 20 of 4 sentences]
47
[+] score: 18
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-20a, hsa-mir-22, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-98, hsa-mir-101-1, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-15b, mmu-mir-101a, mmu-mir-126a, mmu-mir-130a, mmu-mir-133a-1, mmu-mir-142a, mmu-mir-181a-2, mmu-mir-194-1, hsa-mir-208a, hsa-mir-30c-2, mmu-mir-122, mmu-mir-143, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-181a-1, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-122, hsa-mir-130a, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-142, hsa-mir-143, hsa-mir-126, hsa-mir-194-1, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-208a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-18a, mmu-mir-20a, mmu-mir-22, mmu-mir-26a-1, mmu-mir-26b, mmu-mir-29c, mmu-mir-98, mmu-mir-326, rno-mir-326, rno-let-7d, rno-mir-20a, rno-mir-101b, mmu-mir-101b, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-181b-2, mmu-mir-17, mmu-mir-19a, mmu-mir-181a-1, mmu-mir-26a-2, mmu-mir-19b-1, mmu-mir-181b-1, mmu-mir-181c, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-101-2, hsa-mir-26a-2, hsa-mir-378a, mmu-mir-378a, hsa-mir-326, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-181b-2, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-15b, rno-mir-16, rno-mir-17-1, rno-mir-18a, rno-mir-19b-1, rno-mir-19a, rno-mir-22, rno-mir-26a, rno-mir-26b, rno-mir-29c-1, rno-mir-30c-1, rno-mir-30c-2, rno-mir-98, rno-mir-101a, rno-mir-122, rno-mir-126a, rno-mir-130a, rno-mir-133a, rno-mir-142, rno-mir-143, rno-mir-181c, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-194-1, rno-mir-194-2, rno-mir-208a, rno-mir-181a-1, hsa-mir-423, hsa-mir-18b, hsa-mir-20b, hsa-mir-451a, mmu-mir-451a, rno-mir-451, ssc-mir-122, ssc-mir-15b, ssc-mir-181b-2, ssc-mir-19a, ssc-mir-20a, ssc-mir-26a, ssc-mir-326, ssc-mir-181c, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-18a, ssc-mir-29c, ssc-mir-30c-2, hsa-mir-484, hsa-mir-181d, hsa-mir-499a, rno-mir-1, rno-mir-133b, mmu-mir-484, mmu-mir-20b, rno-mir-20b, rno-mir-378a, rno-mir-499, hsa-mir-378d-2, mmu-mir-423, mmu-mir-499, mmu-mir-181d, mmu-mir-18b, mmu-mir-208b, hsa-mir-208b, rno-mir-17-2, rno-mir-181d, rno-mir-423, rno-mir-484, mmu-mir-1b, ssc-mir-15a, ssc-mir-16-2, ssc-mir-16-1, ssc-mir-17, ssc-mir-130a, ssc-mir-101-1, ssc-mir-101-2, ssc-mir-133a-1, ssc-mir-1, ssc-mir-181a-1, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-378-1, ssc-mir-133b, ssc-mir-499, ssc-mir-143, ssc-mir-423, ssc-mir-181a-2, ssc-mir-181b-1, ssc-mir-181d, ssc-mir-98, ssc-mir-208b, ssc-mir-142, ssc-mir-19b-1, hsa-mir-378b, ssc-mir-22, rno-mir-126b, rno-mir-208b, rno-mir-133c, hsa-mir-378c, ssc-mir-194b, ssc-mir-133a-2, ssc-mir-484, ssc-mir-30c-1, ssc-mir-126, ssc-mir-378-2, ssc-mir-451, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, mmu-mir-378b, mmu-mir-101c, hsa-mir-451b, hsa-mir-499b, ssc-let-7a-2, ssc-mir-18b, hsa-mir-378j, rno-mir-378b, mmu-mir-133c, mmu-let-7j, mmu-mir-378c, mmu-mir-378d, mmu-mir-451b, ssc-let-7d, ssc-let-7f-2, ssc-mir-20b-1, ssc-mir-20b-2, ssc-mir-194a, mmu-let-7k, mmu-mir-126b, rno-let-7g, rno-mir-15a, ssc-mir-378b, rno-mir-29c-2, rno-mir-1b, ssc-mir-26b
Our study revealed miR-181 and miR-142-3p with relatively high expression in thymus (Figure 2C), and miR18a and miR-20a appeared to be weakly expressed in thymus (Figure 2D). [score:5]
miR-142-3p, a hematopoietic-specific miRNA [56], exhibits distinct expression patterns during T-cell development and maturation [55]. [score:4]
Additionally, miR-1 and miR-133 in the heart, miR-181a and miR-142-3p in the thymus, miR-194 in the liver, and miR-143 in the stomach showed the highest levels of expression. [score:3]
Some miRNAs, including miR-208, miR-101, miR-18a, miR-20 and miR-142-3p, showed a weaker expression than other miRNAs tested by small RNA blot analyses (Figures 2 and 3). [score:3]
Several miRNAs (miR-1, miR-133, miR-499, miR-208, miR-122, miR-194, miR-18, miR-142-3p, miR-101 and miR-143) have distinct tissue-specific expression patterns. [score:3]
[1 to 20 of 5 sentences]
48
[+] score: 16
The most significantly downregulated (mmu-miR-31, mmu-miR-455, mmu-miR-744, mmu-miR-695, mmu-miR-181a, mmu-miR-181d, mmu-miR-182, mmu-miR-190, mmu-miR-194) and upregulated miRNAs (mmu-miR-34c, mmu-miR-124, mmu-miR-142–3p, mmu-miR-706, mmu-miR-29c) were analyzed. [score:7]
The results of the miRNA– messenger RNA regulatory networks indicated that the common target gene between mmu-miR-181d and mmu-miR-455 was motile sperm domain containing 1 (MOSPD1); that between mmu-miR-31 and mmu-miR-182 was RNA polymerase II, TATA box -binding protein–associated factor (TAF4A); that between mmu-miR-455 and mmu-miR-182 was reticulon 4 (RTN4); that between mmu-miR-182 and mmu-miR-190 was brain-derived neurotrophic factor (BDNF); that between mmu-miR-142–3p and mmu-miR-34c was protein phosphatase 1, regulatory subunit 10 (PPP1R10); and that between mmu-miR-142–3p and mmu-miR-124 was leucine rich repeat containing 1 (LRRC1). [score:5]
The common target gene between mmu-miR-181d and mmu-miR-455 was motile sperm domain containing 1 (MOSPD1), that between mmu-miR-31 and mmu-miR-182 was RNA polymerase II, TATA box binding protein (TBP) -associated factor (TAF4A), that between mmu-miR-455 and mmu-miR-182 was reticulon 4 (RTN4), that between mmu-miR-182 and mmu-miR-190 was brain-derived neurotrophic factor (BDNF), that between mmu-miR-142–3p and mmu-miR-34c was protein phosphatase 1, regulatory subunit 10 (PPP1R10), and that between mmu-miR-142–3p and mmu-miR-124 was leucine rich repeat containing 1 (LRRC1). [score:4]
[1 to 20 of 3 sentences]
49
[+] score: 16
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-18a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-21, hsa-mir-23a, hsa-mir-31, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-96, hsa-mir-98, hsa-mir-99a, hsa-mir-106a, mmu-let-7g, mmu-let-7i, mmu-mir-23b, mmu-mir-99a, mmu-mir-127, mmu-mir-128-1, mmu-mir-136, mmu-mir-142a, mmu-mir-145a, mmu-mir-10b, mmu-mir-182, mmu-mir-183, mmu-mir-187, mmu-mir-193a, mmu-mir-195a, mmu-mir-200b, mmu-mir-206, mmu-mir-143, hsa-mir-139, hsa-mir-10b, hsa-mir-182, hsa-mir-183, hsa-mir-187, hsa-mir-210, hsa-mir-216a, hsa-mir-217, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-224, hsa-mir-200b, mmu-mir-302a, mmu-let-7d, mmu-mir-106a, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-128-1, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-127, hsa-mir-136, hsa-mir-193a, hsa-mir-195, hsa-mir-206, mmu-mir-19b-2, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-18a, mmu-mir-21a, mmu-mir-23a, mmu-mir-31, mmu-mir-92a-2, mmu-mir-96, mmu-mir-98, hsa-mir-200c, mmu-mir-17, mmu-mir-139, mmu-mir-200c, mmu-mir-210, mmu-mir-216a, mmu-mir-219a-1, mmu-mir-221, mmu-mir-222, mmu-mir-224, mmu-mir-19b-1, mmu-mir-92a-1, mmu-mir-128-2, hsa-mir-128-2, mmu-mir-217, hsa-mir-200a, hsa-mir-302a, hsa-mir-219a-2, mmu-mir-219a-2, hsa-mir-363, mmu-mir-363, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-371a, hsa-mir-18b, hsa-mir-20b, hsa-mir-452, mmu-mir-452, ssc-mir-106a, ssc-mir-145, ssc-mir-216-1, ssc-mir-217-1, ssc-mir-224, ssc-mir-23a, ssc-mir-183, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-128-1, ssc-mir-136, ssc-mir-139, ssc-mir-18a, ssc-mir-21, hsa-mir-146b, hsa-mir-493, hsa-mir-495, hsa-mir-497, hsa-mir-505, mmu-mir-20b, hsa-mir-92b, mmu-mir-302b, mmu-mir-302c, mmu-mir-302d, hsa-mir-671, mmu-mir-216b, mmu-mir-671, mmu-mir-497a, mmu-mir-495, mmu-mir-146b, mmu-mir-708, mmu-mir-505, mmu-mir-18b, mmu-mir-493, mmu-mir-92b, hsa-mir-708, hsa-mir-216b, hsa-mir-935, hsa-mir-302e, hsa-mir-302f, ssc-mir-17, ssc-mir-210, ssc-mir-221, mmu-mir-1839, ssc-mir-146b, ssc-mir-206, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-128-2, ssc-mir-143, ssc-mir-10b, ssc-mir-23b, ssc-mir-193a, ssc-mir-99a, ssc-mir-98, ssc-mir-92a-2, ssc-mir-92a-1, ssc-mir-92b, ssc-mir-142, ssc-mir-497, ssc-mir-195, ssc-mir-127, ssc-mir-222, ssc-mir-708, ssc-mir-935, ssc-mir-19b-2, ssc-mir-19b-1, ssc-mir-1839, ssc-mir-505, ssc-mir-363-1, hsa-mir-219b, hsa-mir-371b, ssc-let-7a-2, ssc-mir-18b, ssc-mir-187, ssc-mir-218b, ssc-mir-219a, mmu-mir-195b, mmu-mir-145b, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, ssc-let-7d, ssc-let-7f-2, ssc-mir-20b-1, ssc-mir-20b-2, ssc-mir-31, ssc-mir-182, ssc-mir-216-2, ssc-mir-217-2, ssc-mir-363-2, ssc-mir-452, ssc-mir-493, ssc-mir-671, mmu-let-7k, ssc-mir-7138, mmu-mir-219b, mmu-mir-216c, mmu-mir-497b, mmu-mir-935, ssc-mir-9843, ssc-mir-371, ssc-mir-219b, ssc-mir-96, ssc-mir-200b
Low miR-142 expression can respond to differentiation cues [55]. [score:3]
The bimodally expressed microRNA miR-142 gatesexit from pluripotency. [score:3]
Ssc-miR-142-5p was also more highly expressed in mpiPSCs than that in hpiPSCs. [score:3]
Additionally, ssc-miR-216, ssc-miR-217, ssc-miR-142-5p, ssc-miR-96-5p, ssc-miR-182 and ssc-miR-183 have higher expression levels in mpiPSCs than that in hpiPSCs (Fig 3A). [score:3]
It is reported that miR-142 is bimodally expressed in mESCs. [score:3]
It indicated that ssc-miR-142-5p makes contribution to maintenance pluripotency in mpiPSCs. [score:1]
[1 to 20 of 6 sentences]
50
[+] score: 16
Other miRNAs from this paper: mmu-mir-142a, hsa-mir-142
To further demonstrate that cells of hematopoetic origin were important in the cytokine response and severe outcome of infection with the 6:2 Tky/05 virus, we engineered a recombinant virus (NPr142-Tky/05) that harboured four copies of a microRNA target sequence in the NP gene for a microRNA specifically expressed in cells of haematopoetic origin, MiR142, as previously described by Langlois et al [56]. [score:4]
The sequence contained 231bp of codon optimized open reading frame upstream of the stop codon, four tandem copies of miRNA142 target sequence or scrambled control sequence, and 146bp duplicated segment 5 packaging sequence. [score:3]
The miRNA142 target was the same as previous described [56]. [score:3]
Moreover the decrease in lung type I IFN levels during infection with the Mir142 targeted RG virus confirms that a proportion of the cytokines that contribute to the proinflammatory response during H5N1 virus infection were secreted in vivo by infected haematopoetic cells. [score:2]
The insertion of the MiR142 target sequence, that reduced the extent of replication in cells of hematopoietic origin, resulted in reduced weight loss that correlated with a lower IFN-α level in the lung (Fig 7E and 7G). [score:2]
A recent article, as well as our own nucleotide BLAST analysis, have revealed a high degree of similarity between mouse miRNA-142 and an unannotated miRNA in the ferret genome, but further research is necessary to understand whether this putative miRNA-142 displays similar cell-type specific effects in ferrets as it does in mice [37]. [score:1]
However, in GM-DCs, vRNA accumulation following infection with the virus containing MiR142 target sites was significantly reduced compared to control virus (Fig 7C) and this led to a decreased level of IFN-α mRNA in these cells (Fig 7D). [score:1]
[1 to 20 of 7 sentences]
51
[+] score: 16
For example, Hlf was targeted by mmu-miR-18b-5p, mmu-miR-429-3p and mmu-miR-291a-3p; Cnot6 and Zfp91 were targeted by mmu-miR-206-3p and mmu-miR-291a-3p; Rbfox2 was targeted by mmu-miR-429-3p and mmu-miR-449c-5p; Aebp2 was targeted by mmu-miR-125a-3p, mmu-miR-223-3p and mmu-miR-496-3p; Nfya was targeted by mmu-miR-199a-5p, mmu-miR-216b-5p and mmu-miR-671-5p; Nucks1 was targeted by mmu-miR-142-3p, mmu-miR-146a-5p and mmu-miR-223-3p; Notch2 was targeted by mmu-miR-146a-5p and indirectly via Ascl1 by mmu-miR-1903. [score:16]
[1 to 20 of 1 sentences]
52
[+] score: 15
Finally, miR-142-3p which was not differentially expressed considering the whole cohort (Fig 1), was found differently expressed when the group of women was analysed independently (NGT vs IGT, Fig 2). [score:5]
In addition, the group of diabetic men was significantly younger than the group of diabetic women (41.7 ± 1.45 vs 47.08 ± 1.72; p = 0.02) which could explain that some miRNAs differentially expressed between controls and diabetics were not significantly altered in the group of men (i. e. ; miR-128; miR-374a, miR-142-3p and let-7d-3p). [score:3]
Altered expressions of miR-629a-5p, let-7d-3p, miR-142-3p and miR-484 were not confirmed in the whole cohort (p<0.05). [score:3]
Statistical data analysis revealed that the mean expression level of 9 miRNAs (i. e. ; miR-128, miR-99b-5p, miR-130b-3p, miR-142-3p, miR-374a-5p, miR-423-5p, miR-484, miR-629-5p, let-7d-3p) was significantly different (student t-test p<0.05) across the studied groups (Table 2). [score:3]
Our study also highlighted that some miRNAs (miR-128 and miR-374a, miR-142-3p, let-7d-3p, miR-423-5p) had sex-specific associations with prediabetes or diabetes. [score:1]
[1 to 20 of 5 sentences]
53
[+] score: 15
In the present study, we showed that the expression of several miRNAs is altered during the development of PC and that licofelone reverses the altered expression of the majority of these miRNAs with up-regulation of miR-21, miR-222, Let-7, miR-125, miR-142 and down-regulation of miR-1, miR-122 and miR-148. [score:12]
For example, Lee EJ 2007 et al. [44] showed that the miRNAs miR155, miR21, miR222, Let7, miR376a, miR301, miR100, miR125, miR142 and others are overexpressed significantly in human PC. [score:3]
[1 to 20 of 2 sentences]
54
[+] score: 13
Expression levels of miR-155 (a), miR-142.3p and miR-142-5p (b) and of members of the miR-17~92 cluster (c) were determined by single specific qPCR in the indicated sorted human CD8 [+ ]T cell subsets (a), and are expressed as fold change relatively to levels in naive cells (n = 9; *: p < 0,05; **: p < 0,01). [score:5]
Since the TLDA analysis showed that both miR-142-3p and miR-142-5p were among the most expressed microRNAs in CD8 [+ ]T cells (Table 1), their expression levels were assessed in the different subsets. [score:5]
Interestingly, these microRNAs include miR16, miR-21, miR-142-3p and miR-142-5p, which were also found in the group A in human CD8 [+ ]T lymphocytes, with miR-142-3p showing the highest relative expression levels (Table 1). [score:3]
[1 to 20 of 3 sentences]
55
[+] score: 12
miR-142-3p inhibits expression of adenylyl cyclase 9, responsible for generating the inhibitory second messenger, cAMP (48, 66). [score:7]
Strategically generating Tregs that have low miR-17, miR-16a/16, or miR-142-3p or high miR-146a or let-7d expression may represent an approach to increase Treg suppressor function. [score:5]
[1 to 20 of 2 sentences]
56
[+] score: 12
Of all the targets that were specifically upregulated during reprogramming of wt cells, only miR-142-3p lacked a predicted p53 responsive element in its promoter altogether. [score:6]
Another interesting hit that is strongly upregulated in p53 wt iPS cells, but very low expressed in p53 KO and mutant iPS cells is miR-142-3p. [score:6]
[1 to 20 of 2 sentences]
57
[+] score: 12
It was reported that miR-381 was up-regulated in mouse liver and acted as a hub regulators [30], miR-142-3p can suppresses the migration and invasion of HCC cells by regulating RAC1 [31], and miR-214 can suppress invasion, stem-like traits and recurrence of HCC through targeting beta-catenin pathway [32]. [score:12]
[1 to 20 of 1 sentences]
58
[+] score: 12
Further work has shown that miR-142 mutations in AML are localized to the seed region of miR-142-3p, leading to reduced expression of miR-142-5p. [score:4]
Earlier last year, whole genome sequencing of de novo acute myeloid leukemia (AML) revealed that miR-142 undergoes point mutations, potentially resulting in loss of targeting by the 3p form (Cancer Genome Atlas Research Network, 2013). [score:4]
Dysregulation and recurrent mutation of miRNA-142 in de novo AML. [score:3]
Examples include miR-142 and miR-17 where incorporation of both the strands into the RISC complex occurs, leading to the presence of both 5p as well as 3p transcripts inside the cell (Kasashima et al., 2004; Yang et al., 2013). [score:1]
[1 to 20 of 4 sentences]
59
[+] score: 11
Other miRNAs from this paper: mmu-mir-126a, mmu-mir-142a, mmu-mir-126b
Transcriptional and post-translational engineering of the LV, using a combination of cell-specific promoters and miRNA target sequences to eliminate transgene expression in professional APCs (miR-142-3p), while restricting high levels of therapeutic expression to hepatocytes, has been shown to induce tolerance in both hemophilia A and B mo dels and correction of disease phenotype (99– 102). [score:11]
[1 to 20 of 1 sentences]
60
[+] score: 10
Other miRNAs from this paper: mmu-mir-142a
A recent study has revealed that the likely mechanism for the decreased levels of Hsp70 is that triptolide induces the upregulation of a microRNA, miR-142-3p, which directly binds to the 3′ UTR of Hsp70 mRNA and causes the destruction of Hsp70 mRNA (25). [score:5]
In addition to miR-142-3p, there are many other potential targets of triptolide or minnelide. [score:3]
In the same study, minnelide was also shown to induce miR-142-3p levels in mice bearing human pancreatic tumors while concurrently reducing Hsp70 mRNA. [score:1]
It is probable that both triptolide and minnelide treatment of mesothelioma cells stimulated miR-142-3p, thus reducing aberrantly high Hsp70 levels and preventing cell growth as evident in the studies presented here. [score:1]
[1 to 20 of 4 sentences]
61
[+] score: 10
Evidence of the concerted interplay of miRNAs regulated by CpG-ODN and their potential target mRNAs was observed (Fig. 4) for 2 miRNAs upregulated (hsa-miR-302b and hsa-miR-374b) and for 13 miRNAs downregulated in CpG-ODN -treated mice (hsa-miR-135a, hsa-miR-136, hsa-miR-340, hsa-miR-445-5p, hsa-miR-424, hsa-miR-96, hsa-miR-142-3p, hsa-miR-140-5p, hsa-miR-542-3p, hsa-miR-18a, hsa-miR-18b, hsa-miR-101, and hsa-miR-99a). [score:10]
[1 to 20 of 1 sentences]
62
[+] score: 10
Upregulated miR-142-5p, miR-155, and miR-223 were strongly linked to intragraft levels of CD3 and CD20 mRNA, suggesting that the altered expression of miRNAs might be due to graft-infiltrating immune cells [44]. [score:6]
Furthermore, differential expression of miR-142-3p, miR-204, and miR-211 was also observed in urine samples between patient groups with chronic allograft dysfunction [47]. [score:3]
Intragraft levels of miR-142-5p, miR-155, miR-223, miR-10b, miR-30a-3p, and let-7c have been proposed to have diagnostic value for acute rejection, with miR-142-5p, miR-155, and miR-223 each predicting acute rejection with >90% sensitivity and specificity. [score:1]
[1 to 20 of 3 sentences]
63
[+] score: 10
Other miRNAs from this paper: hsa-let-7c, hsa-let-7d, hsa-mir-16-1, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-28, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-99a, hsa-mir-101-1, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-30a, mmu-mir-99a, mmu-mir-101a, mmu-mir-125b-2, mmu-mir-126a, mmu-mir-128-1, mmu-mir-9-2, mmu-mir-142a, mmu-mir-144, mmu-mir-145a, mmu-mir-151, mmu-mir-152, mmu-mir-185, mmu-mir-186, mmu-mir-24-1, mmu-mir-203, mmu-mir-205, hsa-mir-148a, hsa-mir-34a, hsa-mir-203a, hsa-mir-205, hsa-mir-210, hsa-mir-221, mmu-mir-301a, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-142, hsa-mir-144, hsa-mir-145, hsa-mir-152, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-126, hsa-mir-185, hsa-mir-186, mmu-mir-148a, mmu-mir-200a, mmu-let-7c-1, mmu-let-7c-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-21a, mmu-mir-24-2, mmu-mir-29a, mmu-mir-31, mmu-mir-34a, mmu-mir-148b, mmu-mir-339, mmu-mir-101b, mmu-mir-28a, mmu-mir-210, mmu-mir-221, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-125b-1, mmu-mir-128-2, hsa-mir-128-2, hsa-mir-200a, hsa-mir-101-2, hsa-mir-301a, hsa-mir-151a, hsa-mir-148b, hsa-mir-339, hsa-mir-335, mmu-mir-335, hsa-mir-449a, mmu-mir-449a, hsa-mir-450a-1, mmu-mir-450a-1, hsa-mir-486-1, hsa-mir-146b, hsa-mir-450a-2, hsa-mir-503, mmu-mir-486a, mmu-mir-542, mmu-mir-450a-2, mmu-mir-503, hsa-mir-542, hsa-mir-151b, mmu-mir-301b, mmu-mir-146b, mmu-mir-708, hsa-mir-708, hsa-mir-301b, hsa-mir-1246, hsa-mir-1277, hsa-mir-1307, hsa-mir-2115, mmu-mir-486b, mmu-mir-28c, mmu-mir-101c, mmu-mir-28b, hsa-mir-203b, hsa-mir-5680, hsa-mir-5681a, mmu-mir-145b, mmu-mir-21b, mmu-mir-21c, hsa-mir-486-2, mmu-mir-126b, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
Furthermore, some of the differentially expressed miRNAs have been reported to play a role in the metastasis of other types of cancer, for example, the up-regulated miRNAs, let-7i, miR-9, miR-30a, miR-125b, miR-142-5p, miR-151-3p, miR-450a and the down-regulated miRNAs, miR-24, mir-145, miR-146b-5p, miR-185, miR-186, miR-203 and miR-335. [score:9]
The miR-30a, miR-142-5p and miR-450a have roles in metastatic breast and colon cancer [61] and the miR-151-3p can enhance hepatocellular carcinoma cell mobility [66]. [score:1]
[1 to 20 of 2 sentences]
64
[+] score: 9
The success of this approach was proved by the experimental evidence that de -targeting a transgene expression in hematopoietic cells, using target sequences of hematopoietic lineage-specific miRNA-142.3, enabled stable and long-lasting transgene expression in mice without inducing an immune response, overcoming one of the most current issues in gene therapy (57). [score:9]
[1 to 20 of 1 sentences]
65
[+] score: 9
Transfection of let-7e mimic but not miR-125 or miR-142 mimic into RAW 264.7 cells mediated the reduction of Alox5 mRNA (Fig.   7d), indicating that Alox5 is a novel target of the let-7 family of miRNAs. [score:3]
c pISO-AL5 or empty pISO vector was cotransfected into HEK293 cells with 10 n M let-7e or miR-142 (control) mimic or vehicle alone (bottom). [score:1]
For miR-142, n = Ctr: 9 embryos, c KO: 5 embryos. [score:1]
n = 6. d Macrophage RAW 264.7 cells were transfected with 18 n M miR-142 (control), let-7e, or miR-125b mimic, followed by qRT-PCR analysis of Alox5 mRNAs (bottom). [score:1]
When Alox5 3′-UTR was inserted into the luciferase reporter construct pISO-AL5 (Fig.   7b), the luciferase activity was significantly reduced upon transfection of let-7e mimic but not control mimic (miR-142) (Fig.   7c). [score:1]
For transfection of let-7e mimic or control mimic (miR-142-5p), 18 n M miRNA mimics were transfected into cultured E10.5 AGM with Lipofectamine RNAiMAX (Thermo Fisher Scientific) following manufacturer’s instructions. [score:1]
pISO, pISO-AL5 (100 ng each), and renilla luciferase plasmid (1 ng) were transfected with 6 pmol let-7e or control (miR-142-5p) mimic (mirVana® miRNA mimic, Thermo Fisher Scientific) into one well of a 24-well plate of HEK293 cells. [score:1]
[1 to 20 of 7 sentences]
66
[+] score: 9
Vaccine alone increased the expression of miR-142-5p and miR-150, and downregulated miR-133b and miR-1. RFA alone induced up-regulation of 5 specific microRNA transcripts relative to treatment control: miR-1, -133b, -150, -203, and -205. [score:9]
[1 to 20 of 1 sentences]
67
[+] score: 9
Of the miRNAs upregulated in differentiated mature brown adipocytes, miR-142-3p and -19a were also up-regulated in the present list of 35 BAT-enriched miRNAs predicted to target genes involved in growth and differentiation. [score:9]
[1 to 20 of 1 sentences]
68
[+] score: 9
miR142 is highly expressed in the hemotopoietic organs such as bone marrow, spleen and thymus [36]. [score:3]
Among the miRNAs in the plasma, many have been shown to have differential expression in cells or tissue after ionizing radiation, such as miR-142-5p [27], miR-339, hsa-miR-342, hsa-miR146a, hsa-miR-29c, hsa-miR155, hsa-miR-197, hsa-miR-34b [28], and miR-29c [29]. [score:3]
We found that some of our miRNAs are reported to be enriched in bone marrow (miR-142) and GI tract (miR-142, miR-150, miR-155). [score:1]
miR142 is also shown to have 1 clone in small intestine and 6 clones in colon. [score:1]
Among them, only miR-142-5p showed up in our 6 h metagene and none showed up in our 24 h metagene. [score:1]
[1 to 20 of 5 sentences]
69
[+] score: 9
Expression of miR-467a*, interestingly, was enriched only in the nucleus of LSK and promyelocytes, while expression of miR-135* and miR-142-3p did not appear to be nuclear-enriched in any myeloid population (Figure 5B). [score:5]
Notably, the primary transcript of miR-142-3p, a miRNA recently found to be important in promoting granulopoieisis, was amongst the putative targets of miR-706 (Figure 6B). [score:3]
Of these 7 miRNAs, miR-142 and miR-192 possessed putative binding sites in their primary transcripts that demonstrated near perfect binding to mature miR-706 (Figure 6B). [score:1]
[1 to 20 of 3 sentences]
70
[+] score: 9
Other miRNAs from this paper: mmu-mir-142a, hsa-mir-142
Treatment with triptolide results in the transcriptional inhibition of HSP70 mRNA and the upregulation of miR-142-3p, a microRNA that downregulates HSP70 mRNA levels. [score:9]
[1 to 20 of 1 sentences]
71
[+] score: 9
For example, miR-22, miR-142-3p and miR-142-5p were upregulated in CD11c [+] CD11b [+] B220 [−] cDCs and downregulated in pDCs relative to progenitor expression levels, while miR-20a, miR-17-5p and miR-130a showed the reverse pattern. [score:9]
[1 to 20 of 1 sentences]
72
[+] score: 8
Absolute granulocyte numbers and miRNA expression correlated most significantly in both mouse strains (23 miRNAs with significant correlations; violet circles in Figure 3), with miR-223-3p, miR-142-3p, and miR-20b-5p correlating the most positively in both mouse strains ([ρ [DBA/2J] + ρ [C57BL/6J]]/2 > 0.7). [score:3]
Expression of subsets of miRNAs correlated significantly with peripheral blood granulocyte and monocyte numbers, particularly in DBA/2J mice; miR-223-3p, miR-142-3p, and miR-20b-5p correlated most positively with these cell types in both mouse strains. [score:3]
For instance, miR-142-5p plays critical roles in lymphocyte development and homeostasis (57), and miR-106a-5p, miR-130-3p, miR-20b-5p, miR-345-3p, and the miR-15 cluster have been associated with immune or stress responses (58– 62). [score:2]
[1 to 20 of 3 sentences]
73
[+] score: 8
Additionally, we detected upregulated miRNAs targeting important tumor suppressor genes in diverse neoplasia, such as miR-638 (BRCA1), miR-130b (TP53), miR-130b (CSF1), miR-142-3p (IL1A), and miR-301a (BIM, PTEN) (Table 2). [score:8]
[1 to 20 of 1 sentences]
74
[+] score: 8
Other miRNAs from this paper: mmu-mir-142a, hsa-mir-142
To reduce expression of DBY by APCs after virus inoculation, we inserted four tandem target sequences of the hematopoietic-specific mir142-3p after the Luciferase-DBY cassette to induce its degradation specifically in hematopoietic cells [29] (Supplementary Fig.   1c). [score:5]
Thus, APCs having captured DBY Ag from transduced cells or expressing residual Ag in the absence of complete silencing by the mir142-3p generate inefficient priming that rapidly vanishes without giving rise to Treg or memory cells. [score:3]
[1 to 20 of 2 sentences]
75
[+] score: 8
IL-21 did not modulate expression of miR-142-5p, which is expressed in haematopoietic cells 26 (Fig. 2a), indicating that it acted selectively on the miR-29 locus and not on miRNAs generally. [score:5]
d. of duplicate wells) of mature miR-29a, miR-29b, miR-29c and miR-142-5p in purified total human splenic CD4 T cells from untreated (medium) or IL-21 -treated HLACs after 12 h. (b) Kinetics of expression (average±s. [score:3]
[1 to 20 of 2 sentences]
76
[+] score: 8
As such affector miRNAs, that act independently from the interaction of Nrf2 with Keap1, miRNAs miR-153, miR-27-a, miR-142-5p, and miR-144 regulated the Nrf2 expression in neuroblastoma cells [179], and miR-28 targeted the 3’UTR of Nrf2 mRNA decreasing Nrf2 expression in human breast cancer cells [180]. [score:8]
[1 to 20 of 1 sentences]
77
[+] score: 8
Other miRNAs from this paper: mmu-mir-142a, hsa-mir-142
Overexpression of miR-142-3p decreases Rac1 mRNA and protein levels, implying miR-142-3p negatively regulates Rac1 via inhibiting its translation [25]. [score:8]
[1 to 20 of 1 sentences]
78
[+] score: 8
Thus, for six miRNA families – mir-135, mir-205, mir-142-3p, mir-15/16, mir-218 and mir-24 - we obtained evidence for their functional relevance in the inner ear on two levels: (a) the miRNAs were differentially expressed between the two tissues; and (b) their predicted targets were differentially expressed in a manner consistent with the currently accepted mo del of miRNA regulation. [score:8]
[1 to 20 of 1 sentences]
79
[+] score: 7
Of these miRNAs, the relatively prominent upregulated miRNAs were hsa-miR-3656, hsa-miR-139-5p, hsa-miR-4796-5p, hsa-miR-330-5p, hsa-miR-4698, hsa-miR-3124-5p, hsv2-miR-H10, hsa-miR-133b, hsa-miR-515-3p, hsa-miR-516a-5p, hsa-miR-4762-5p, hsa-miR-4508, hsa-miR-27a-5p, hsa-miR-3120-5p, hsa-miR-133a, and hsa-miR-205-5p (>15-fold), and the relatively prominent downregulated miRNAs were hsa-miR-411-3p, hsa-miR-19b-3p, hsa-miR-152, and hsa-miR-142-5p (>15-fold). [score:7]
[1 to 20 of 1 sentences]
80
[+] score: 7
Of the 6 differentially regulated miRNA predicted to target NR3C1, two (miR-18a and miR-142-3p) have previously been shown to target NR3C1 directly [59– 63]. [score:7]
[1 to 20 of 1 sentences]
81
[+] score: 7
Other miRNAs from this paper: mmu-mir-142a
Interestingly, Carraro et al. reported that increased Apc expression accompanied by downregulation of Wnt/Ctnnb1 activity, achieved by knocking down miR-142-3p, promoted parabronchial smooth muscle cell progenitor differentiation [22]. [score:7]
[1 to 20 of 1 sentences]
82
[+] score: 7
Of the 20 miRNAs downregulated in crypts, 8 showed a >4.0 fold difference (miR-142-5p, miR-16-5p, miR-22-3p, miR-194-3p, miR-33-5p, miR-223-3p, miR-32-5p, miR-140-5p; Fig. 4a1, blue spots), whereas, of the 15 miRNAs upregulated in crypts, 2 showed a >3.0 fold difference (miR-192-5p, miR-98-5p) (Fig. 4a2, blue spots). [score:7]
[1 to 20 of 1 sentences]
83
[+] score: 7
Chaudhry et al. reported that let-7e or c-Myc related miRNAs (miR-17-3p, miR-17-5p, miR-19a, and miR-142-5p) were downregulated after 3 h following 100 mGy acute dose in AG1522 normal human skin fibroblasts, but were upregulated after 3 h following 4 Gy acute dose [31]. [score:7]
[1 to 20 of 1 sentences]
84
[+] score: 7
We found that silencing of TALNEC2 in U87 cells resulted in an increased expression of miRNAs associated with tumor suppression [38, 39] (e. g., let-7b, miR-7, miR-124, miR-137, miR-129-3p, miR-142-3p, miR-205, miR-376c, miR-492, miR-562 and miR-3144) and in a decrease in the expression of miRNAs associated with tumor promotion [38– 40] (e. g., miR-9, miR-21 miR-33b, miR-155, miR-191, miR-525-3p, and miR-767-3p). [score:7]
[1 to 20 of 1 sentences]
85
[+] score: 7
Other miRNAs from this paper: mmu-mir-142a, mmu-mir-206, mmu-mir-468, mmu-mir-374b, mmu-mir-374c
Expression of miRNA was altered in LS and MDR groups, and we identified 4 miRNAs (miR-206, miR-374, miR-468, and miR-142-5p), which were differently modulated in the MDR group versus both control and LS groups. [score:3]
We focused on the 4 miRNAs (miR-206, miR-374, miR-142-5p, and miR-468) which were different between the control and MDR groups, as well as between the LS and MDR groups. [score:1]
However, the functions of miR-374, miR-468, and miR-142-5p are not clearly known. [score:1]
We hypothesize that miR-468 and miR-142-5p contribute to a unique feature of pharmacoresistance. [score:1]
The altered patterns of miR-468 and miR-142-5p are interesting because AED responsive and resistant mice demonstrated opposite responses. [score:1]
[1 to 20 of 5 sentences]
86
[+] score: 7
Expression of a mature miR-142, but not miR-24 was able to rescue hemangioblast development in Dgcr1 knockdown embryos, however miR-142 was unable to rescue hemogenic endothelium development. [score:6]
The top candidate in this screen was miR-142. [score:1]
[1 to 20 of 2 sentences]
87
[+] score: 6
Transfected miR-142 repressed the expression of a known target, Cofilin 2 (Cfl2) [35] by 70% after 72 hrs. [score:5]
We isolated motor neurons from embryonic spinal cords, following [34], and transfected a hematopoietic miRNA, miR-142, or a scrambled dsRNA sequence at a concentration of 0.1 ng/µl or 0.5 ng/µl. [score:1]
[1 to 20 of 2 sentences]
88
[+] score: 6
Other miRNAs from this paper: mmu-mir-142a, hsa-mir-142
Expression of miR-142 or direct silencing of Rac1 inhibited cellular invasion as well as cellular proliferation. [score:6]
[1 to 20 of 1 sentences]
89
[+] score: 6
Other miRNAs from this paper: mmu-mir-142a, mmu-mir-151, mmu-mir-195a, mmu-mir-100, mmu-mir-195b
miR-142-3p, which is downregulated in HCC, can reduce the mRNA and protein level of Rac1, and suppress the migratory and invasive ability of HCC cell lines in vitro [28]. [score:6]
[1 to 20 of 1 sentences]
90
[+] score: 6
For example, miR-34c, miR145, and miR-142-5p, which suppress lung cell growth, are found to be repressed in both human and mouse lung cancer [29]. [score:3]
For example, the miR-17-92 cluster promotes the proliferation of lung progenitors [28], whereas miR-34c, miR145, and miR-142-5p suppress lung cell growth [29]. [score:3]
[1 to 20 of 2 sentences]
91
[+] score: 6
In any case, differential expression of miR-1a, miR-133a, and miR-142 in our study, as well as in the work of Loscher et al., is observed after the onset of apoptosis. [score:3]
In support of this, selective ablation of Müller cells resulted in photoreceptor death, and an altered expression of miR-1a, miR-133a, and miR-142. [score:3]
[1 to 20 of 2 sentences]
92
[+] score: 6
Other miRNAs from this paper: mmu-mir-142a
A recent report analyzed stage and subset-specific expression of mi -RNAs during DC development and miR-142 was identified as a key regulator of cDC2 differentiation, further adding additional complexity to our current understanding of DC development (91). [score:6]
[1 to 20 of 1 sentences]
93
[+] score: 6
NCD4 cells from older people are reported to express lower levels of miR-181a (relative to a control miRNA, miR-142) than NCD4 cells from young people [8]. [score:3]
I. ΔΔCt values of Real time RT-PCR for miR-181a normalized to miR-142 on ANCD4 and YNCD4 cells (Mean ± SE from five sets of independently sorted cells). [score:1]
C. ΔΔCt values of Real time RT-PCR for miR-181a normalized to miR-142 on NCD4hi and NCD4lo cells (Mean ± SE from four sets of independently sorted cells). [score:1]
Real time PCR for miR-181a and miR142. [score:1]
[1 to 20 of 4 sentences]
94
[+] score: 6
Expression of Aryl hydrocarbon receptor nuclear translocator-like (Arntl or Bmal1) is down-regulated by miR-494, miR-152 and miR-142/-143 in mice [21]. [score:6]
[1 to 20 of 1 sentences]
95
[+] score: 5
Other miRNAs from this paper: mmu-mir-142a, mmu-mir-122
This principle was originally developed by Brown et al. [11], who showed that inclusion of microRNA mir-142-3p binding sites within 3′UTR of retrovirally-encoded transgenes prevented expression in antigen presenting cells, preventing stimulation of an immune response and allowing long term transgene expression in other cells without rejection. [score:5]
[1 to 20 of 1 sentences]
96
[+] score: 5
Other miRNAs from this paper: mmu-mir-142a, mmu-mir-152, mmu-mir-188, mmu-mir-218-1, mmu-mir-218-2
Meanwhile, other miRNAs (miR-152, miR-142, and so on) could also target to Rictor, and increased miR-218 may have other targets important for osteoblast such as Runx2 in this process (Figure 6c), all of which might contribute to age-related bone loss. [score:5]
[1 to 20 of 1 sentences]
97
[+] score: 5
In the case of miRNA quantification, the most abundantly expressed and the least expressed genes in both tissues were U6 and miR-142, respectively. [score:5]
[1 to 20 of 1 sentences]
98
[+] score: 5
For instance, loss of miR-149, miR-200c and mir-141 causes gain of function of oncogenes (KCNMA1, LOX), VEGFA and SEMA6A respectively and increased levels of miR-142-3p, miR-185, mir-34a, miR-224, miR-21 cause loss of function of tumor suppressors LRRC2, PTPN13, SFRP1, ERBB4, and (SLC12A1, TCF21) respectively. [score:3]
As the p-values in Figure 4 indicate, we validate a strong anti-correlation signature between mRNA levels of (KCNMA1, LOX), VEGF, SEMA6A, (LRRC2, PTPN13), SFRP1, ERBB4, SLC12A1 and TCF21, and their identified regulators: miR-149, miR-200c, mir-141, miR-142-3p, miR-185, mir-34a, miR-224 and miR-21 respectively. [score:2]
[1 to 20 of 2 sentences]
99
[+] score: 5
Recent studies have suggested important regulatory roles for miRNAs such as miR-21, miR-216, miR-217, miR-181b, miR-31b and miR-34a, which were confirmed to be upregulated in senescing HUVECs (Menghini et al., 2009), and miR-146, miR-142-3p, miR-223 and miR-29 family members, which were significantly increased in whole aortas of aged mice (Zhao et al., 2010). [score:5]
[1 to 20 of 1 sentences]
100
[+] score: 5
Other miRNAs from this paper: mmu-mir-142a
Although normally low in heart, miR-142-3p is upregulated in patients with non-ischemic dilated cardiomyopathy, and in mouse mo dels of hypertrophic cardiomyopathy 46– 49, consistent with a protective role for AC9 in heart. [score:4]
Reductions in AC9 mRNA and protein also occur via microRNA miR-142-3p 44, 45. [score:1]
[1 to 20 of 2 sentences]