sort by

17 publications mentioning sly-MIR164a

Open access articles that are associated with the species Solanum lycopersicum and mention the gene name MIR164a. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 122
Other miRNAs from this paper: sly-MIR164b
Nevertheless, since GOB silencing in AP1>>MIR164 flowers was driven by a heterologous promoter and was not complete as in the gob-3 loss-of-function mutant flowers, the AP1>>MIR164 defective flower-boundary phenotypes might be the result of the down-regulation of GOB and either one or a combination of the other sly-miR164 target genes. [score:6]
SlNAM2 accumulation rescues the fusion phenotypes of AP1>>MIR164 flowersOur results indicated that SlNAM2 is expressed at floral whorl and organ boundaries and might suppress growth when accumulated. [score:5]
Sly-miR164 targets were predicted by psRNATarget (http://plantgrn. [score:5]
Fig. 6. Restoration of normal flower phenotype upon expression of mSlNAM2 in miR164-over -expressing flowers. [score:5]
To generate OP:mSlNAM2, six silent mutations in the SlNAM2 sly-miR164 target site were inserted using two-step PCR mutagenesis. [score:4]
Phylogenetic reconstruction of the corresponding tomato and Arabidopsis NAC-domain proteins indicated that Solyc07g066330 (SlNAC1) encodes a homologue of Arabidopsis miR164-regulated NAC1 which has been found to mediate auxin signalling and to promote lateral root development (Xie et al., 2000; Guo et al., 2005); the related Solyc03g115850 (SlNAM2) and Solyc06g069710 (SlNAM3) proteins (60%/70% identity/similarity), which belong to the same group as the CUC proteins, were distantly related to ORESARA1 (ORE1) which has been found to positively regulate ageing -induced cell death in Arabidopsis leaves (Fig. 1D) (Kim et al., 2009). [score:4]
Similar to its CUC2 homologue, the spatial and temporal expression of GOB is post-transcriptionally regulated by sly-miR164. [score:4]
Black and grey arrowheads mark the proteins encoded by sly-miR164 and ath-miR164 -targeted genes, respectively. [score:3]
The Arabidopsis CUP SHAPED COTYLEDON1 (CUC1) and CUC2 are functionally redundant miR164-regulated NAM genes that promote boundary formation and maintenance throughout vegetative and reproductive development (Aida et al., 1997; Takada et al., 2001). [score:3]
To identify additional NAC-domain genes that are subjected to sly-miR164 -guided cleavage in flowers, candidate mRNA targets were predicted and their cleavage was validated by RLM-RACE. [score:3]
Similar phenotypes have also been observed in plants over -expressing miR164 (Laufs et al., 2004; Mallory et al., 2004). [score:3]
Sly-miR164 expression was normalized to U6 snRNA and levels are indicated below the panel. [score:3]
Alignment of sly-miR164 with its target mRNAs. [score:3]
As a control, SlNAM2 was expressed on the same genetic background (AP1>>MIR164 >>SlNAM2). [score:3]
Flower-specific silencing of sly-miR164 target genes disturbs whorl and sepal separation. [score:3]
Fig. 2. Flower-specific miR164 over -expression leads to sepal and whorl fusions. [score:3]
Reminiscent multiple and serrated cotyledon phenotypes have also been reported as a result of expression of the GOB sly-miR164-resistant mutant gene Gob-4d under its native or leaf-specific FIL promoter, respectively (Berger et al., 2009). [score:3]
Quantitative RT-PCR analysis of sly-miR164 -targeted genes in developing flowers. [score:3]
Sequence alignment of sly-miR164 -targeted NAC transcription factors. [score:3]
This analysis confirmed that in addition to GOBLET (Solyc07g062840), three mRNA targets— Solyc03g115850, Solyc06g069710, and Solyc07g066330—were guided to cleavage by sly-miR164 in tomato flowers (Fig. 1C). [score:3]
To investigate the involvement of the sly-miR164 -targeted NAM genes in flower-boundary formation, sly-miR164 was over-expressed in the flower primordia by transactivation of the previously characterized M82 tomato OP:MIR164 responder line with the available flower-specific AP1:LhG4 driver line, which drives expression throughout young floral primordia (Hen delman et al., 2013). [score:3]
RNA gel blot was used to analyse the expression of sly-miR164 in vegetative and reproductive tomato tissues. [score:3]
This increase was consistent with the significant reduction in GOB (70%) and SlNAC1, SlNAM2, and SlNAM3 (~95%) accumulation in these buds, further corroborating their targeting by sly-miR164 (Fig. 2B). [score:3]
This was done by expressing mSlNAM2 in the background of AP1>>MIR164 plants (AP1>>MIR164 >>mSlNAM2). [score:3]
In accordance with its strong sly-miR164 -mediated silencing in AP1>>MIR164 buds (Fig. 2B), SlNAM2 expression was not detected in them, further confirming the authenticity of the wild-type in situ signal (Fig. 3J– M). [score:3]
Together, these phenotypes indicated that sly-miR164 target genes are required for the normal formation of flower sepal and interwhorl boundaries. [score:3]
In tomato, sly-miR164 has been found to negatively regulate the CUC2-like transcription factor GOB (Berger et al., 2009). [score:2]
MiR164 expression was normalized to U6 snRNA and levels are indicated below the panel. [score:2]
First, sly-miR164 over -expression was validated by Northern analysis of young AP1>>MIR164 buds revealing a 3-fold increase in its levels compared with control buds (Fig. 2A). [score:2]
Boundary development flower miR164 NAC tomato. [score:2]
We thank Yuval Eshed, Department of Plant Sciences, The Weizmann Institute of Science for the OP:MIR164 tomato responder line. [score:1]
An additional query of the tomato genome did not identify any novel miR164 sequences suggesting that the identified sly-miR164 is the only miR164 family member encoded by the tomato genome. [score:1]
This abnormal phenotype was no different from that of AP1>>MIR164 flowers (Fig. 2C, D). [score:1]
To that end, AP1>>MIR164 mutant flowers, which had fused sepals and abnormal whorl separation, were complemented with SlNAM2 and the resulting phenotype was analysed. [score:1]
As expected, analysis of AP1>>MIR164 >>SlNAM2 flowers showed elongated fused sepals and abnormal interwhorl fusion (Fig. 6A– C). [score:1]
org/, last accessed 09 September 13) versus our tomato deep-sequenced small RNA data set (Hen delman et al., 2013) and the publicly available tomato small RNA sequences (Tomato Functional Genomics Database) revealed two putative miR164-like sequences (data not shown), but only the two genomic loci encoding the ath-miR164a-identical ones could fold into a pre-miRNA-like hairpin structure (Fig. 1A; see Supplementary Fig. S1A at JXB online). [score:1]
BLASTN with mature miR164 sequences (miRBase, release 19, http://www. [score:1]
Indeed, transverse sectioning of young AP1>>MIR164 buds at the base of the style showed that the three outer whorls and their organs were not separated at that stage whereas, in control buds, they were completely separated (Fig. 2D). [score:1]
MiR164 is a conserved, important regulator of the CUC genes which are involved in vegetative as well as reproductive organ-boundary formation (Aida et al., 1997; Laufs et al., 2004). [score:1]
Proceedings of the National Academy of Sciences, USA 95, 376– 381 Nikovics K Blein T Peaucelle A Ishida T Morin H Aida M Laufs P 2006 The balance between the MIR164A and CUC2 genes controls leaf margin serration in Arabidopsis. [score:1]
Sly-miR164 guides the cleavage of four NAC-domain genes in tomato. [score:1]
In addition, the corresponding sly-miR164* strand encoded by each hairpin was identified in our small RNA data set, validating their functionality as sly-miR164 precursors (Fig. 1A). [score:1]
By contrast, the AP1>>MIR164 >>mSlNAM2 flowers had a wild-type-like phenotype. [score:1]
QRT-PCR of young buds revealed accumulation of the sly-miR164-ressistant mSlNAM2 in AP1>>MIR164 >>mSlNAM2 whereas the sly-miR164-sensitive SlNAM2, SlNAC1, SlNAM3, and GOB were silenced (Fig. 6D). [score:1]
Phenotypic analysis of silenced AP1>>MIR164 flowers revealed elongated sepals that were fused to each other at various points (Fig. 2C). [score:1]
Thus, it is highly likely that the reduced levels of GOB in AP1>>MIR164 flower primordia are responsible for at least some of the defective boundary phenotypes. [score:1]
Fig. 1. Characterization of sly-miR164 and its target genes in tomato. [score:1]
Accordingly, longitudinal sectioning of fully developed AP1>>MIR164 flowers showed that the three outer whorls and, in addition, the fourth whorl separated later than in controls (Fig. 2D). [score:1]
SlNAM2 accumulation rescues the fusion phenotypes of AP1>>MIR164 flowers. [score:1]
M82 lines 35S:LhG4 (Lifschitz et al., 2006), AP1:LhG4 (Fernandez et al., 2009), and OP:MIR164 (Alvarez et al., 2006) have been described elsewhere. [score:1]
For the detection of sly-miR164 and U6 small nucleolar RNA, a radiolabelled oligo probe that is complementary to the corresponding small RNA was used. [score:1]
This analysis indicated that sly-miR164 is most abundant in open flowers and ripen fruit (Fig. 1B). [score:1]
Mature sly-miR164 and matching sly-miR164* sequences are marked by grey and black circles, respectively, and the abundance of sly-miR164* in the seedling small RNA data set is indicated below. [score:1]
To investigate this, two homozygous tomato responder lines were generated that are able to express wild-type (SlNAM2) and sly-miR164-resistant (mSlNAM2) versions of the gene upon transactivation (for further details see the Material and methods and see Supplementary Fig. S3 at JXB online). [score:1]
[1 to 20 of 54 sentences]
2
[+] score: 62
Also, miR164(i) showed a negative correlation in expression pattern with NAC at stages 3 and 5 based on qRT-PCR during which miR164(i) was upregulated and NAC was downregulated (not reported previously in tomato-RKN interaction). [score:9]
A few miRNAs including miR393(i), miR482(i), miR1446(i) and variant_miR156(i) were also upregulated at stage 1 (Fig 3A and 3B), whereas, miR164(i), miR319(iv) and miR1446(i) were upregulated (P < 0.05) at stage 5 (Fig 3A). [score:7]
Using psRNAtarget Analysis server, conserved miRNAs including, miR164(i), miR171(i), miR159(i), miR394(i), miR156(i), miR482(ii), miR166(i), and miR168(i) were predicted to target genes including NAC, GRAS, GAMYB-like, Peroxiredoxin, SBP, Resistance protein, HB and AGO-1, respectively. [score:5]
The correlation in expression profile was deciphered between conserved miRNAs including, miR156(i), miR164(i), miR159(i), miR168(i) and miR396(i) and their target genes, SBP, NAC, GAMYB-like (MYB33 and MYB65), AGO1 and GRF1, respectively. [score:5]
0175178.g005 Fig 5Using psRNAtarget Analysis server, conserved miRNAs including, miR164(i), miR171(i), miR159(i), miR394(i), miR156(i), miR482(ii), miR166(i), and miR168(i) were predicted to target genes including NAC, GRAS, GAMYB-like, Peroxiredoxin, SBP, Resistance protein, HB and AGO-1, respectively. [score:5]
Among the validated tomato miRNA targets, SBP, NAC, GAMYB-like, HB and GRAS transcription factors, targets of conserved miRNAs, miR156(i), miR164(i), miR159(i), miR166(i) and miR171(i), respectively were enriched under GO term, transcription factor activity. [score:5]
0175178.g006 Fig 6The correlation in expression profile was deciphered between conserved miRNAs including, miR156(i), miR164(i), miR159(i), miR168(i) and miR396(i) and their target genes, SBP, NAC, GAMYB-like (MYB33 and MYB65), AGO1 and GRF1, respectively. [score:5]
Therefore, it can be suggested that differential regulation of miR164(i) and its target, GOB-like gene (NAC-domain transcription factor) may be involved in tomato-RKN susceptible interactions. [score:4]
A few miRNAs such as miR164(i), miR319(iv) and miR1446(i) were significantly upregulated at stages 3 and 5 (J4s and females/ maintenance of feeding sites). [score:4]
Among all validated miRNAs, the highest expression at stage 3 was observed for miR164(i) followed by variant_miR319(iii), miR9479(i) and miR319(iv). [score:3]
We confirmed through 5’RLM-RACE that tomato miR164(i) targets a GOB-like gene that encodes NAC-domain transcription factor. [score:3]
For example, known targets, SBP, NAC, GRAS, HB, GRF, GAMYB-like and TCP24 transcription factors were predicted for miR156(i), miR164(i), miR171(i), miR166(i), miR396(i), miR159(i) and miR319(i), respectively in our study. [score:3]
Earlier report has shown that miR164 mediated regulation of NAC transcription factors is required for formation of lateral organ boundaries at apical meristem and in developing compound leaves in tomato [50]. [score:2]
The cleavage site of genes including NAC (Solyc07g062840.2), HB (Solyc03g120910.2), AGO1 (Solyc06g072300.2), Resistance protein (Solyc02g036280.2) and GAMYB-like (Solyc06g073640.2, Solyc01g009070.2) was deciphered to lie between 10 [th] and 11 [th] base from 5’ end pairing of miR164(i), miR166(i), miR168(i), miR482(ii) and miR159(i), respectively (Fig 5). [score:1]
For example, miR164(i) and NAC transcription factor gene showed negative correlation at stages 3 and 5. While a negative correlation between miR156(i) and SBP was observed at stage 3 only (Fig 6). [score:1]
[1 to 20 of 15 sentences]
3
[+] score: 52
MiR164 that regulates leaf pattern through its target CUC2 TFs, showed an almost opposite pattern and was down-regulated by ~2.5 folds in leaves following the ToLCNDV infection (see Additional file, Fig. S 3, lanes 1 and 2). [score:6]
miRNA Target Function References miR166 HD-ZIP TFs Leaf development[20] miR395 ATP Sulfurylase; Sulfate metabolism Environmental stress response[7, 23] miR167 ARF TFs Plant development and hormone signaling[50] miR164 NAC domain TFs; CUC1 and CUC2 Leaf development and hormone signaling[18, 21] miR399 Ubiquitin conjugating enzyme Phosphate metabolism[34] Figure 5Semi-quantitative reverse transcription Polymerase chain reaction (RT-PCR) of various pre-miRNAs in (A) leaves and (B) flower tissues of different plants viz. [score:6]
miRNA Target Function References miR166 HD-ZIP TFs Leaf development[20] miR395 ATP Sulfurylase; Sulfate metabolism Environmental stress response[7, 23] miR167 ARF TFs Plant development and hormone signaling[50] miR164 NAC domain TFs; CUC1 and CUC2 Leaf development and hormone signaling[18, 21] miR399 Ubiquitin conjugating enzyme Phosphate metabolism[34] Figure 5Semi-quantitative reverse transcription Polymerase chain reaction (RT-PCR) of various pre-miRNAs in (A) leaves and (B) flower tissues of different plants viz. [score:6]
Microarray and northern hybridization results show that most of the deregulated miRNAs were induced and only few (miR160, miR164, miR169, miR171 and miR391) were down-regulated following ToLCNDV infection. [score:5]
The RT-PCR primers flanked the putative cleavage site in case of some target genes e. g, NAM-like protein which is targeted by miR164 (Figure 6b). [score:4]
b, The primers designed for RT-PCR based expression analysis flanked the putative miRNA cleavage site, in case of miR164 targeted NAM-like gene. [score:4]
Such low expression levels of miR164 in LA1777 could be attributed to its different genetic background. [score:3]
We chose SCL6- like TF, NAM-like TF and CBF TF that are targets of miR171, miR164 and miR169, respectively. [score:3]
Similarly, miR164 that targets CUC2 also takes care of leaf patterning by controlling serration of leaf margins [21]. [score:3]
The expression levels of miR164 and miR171 were markedly reduced in ToLCNDV (2A+2B) infected leaf samples. [score:3]
Similar to miR164, modest reduction (~ 3 folds) was also observed in the expression of miR171 in ToLCNDV infected leaves (see Additional file 1; Fig. S 3, lane 2) compared to both healthy Pusa Ruby and LA1777 leaves. [score:2]
We used miR159, miR164, miR170/171, miR172 and miR319 for these studies as they are involved in leaf/shoot development as well as stress responses [19- 21]. [score:2]
, miR165/166, miR164 and miR319/159 [19- 21]. [score:1]
, miR165/166, miR159/319, miR164 and miR160. [score:1]
The DNA oligos used as probes for northern analysis are given below: miR159: 5' - TAGAGCTCCCTTCAATCCAAA- 3'; miR164: 5' - TGCACGTGCCCTGCTTCTCCA- 3'; miR171: 5' - AGATGATATTGGCACGGCTCA- 3'; miR172: 5' - ATGCAGCATCATCAAGATTCT -3'; miR319: 5' - CTTGGACTGAAGGGAGCTCC-3'; Total RNA from healthy Pusa Ruby, ToLCNDV (2A+2B) agroinfected Pusa Ruby and LA1777 leaves and flowers was prepared using an RNeasy plant mini kit (Qiagen). [score:1]
Interestingly, miR164 was almost undetectable in healthy LA1777 leaves (see Additional file, Fig. S 3, middle panel, lane 3) almost mimicking the infected condition of Pusa ruby. [score:1]
The DNA oligos used as probes for northern analysis are given below: miR159: 5' - TAGAGCTCCCTTCAATCCAAA- 3'; miR164: 5' - TGCACGTGCCCTGCTTCTCCA- 3'; miR171: 5' - AGATGATATTGGCACGGCTCA- 3'; miR172: 5' - ATGCAGCATCATCAAGATTCT -3'; miR319: 5' - CTTGGACTGAAGGGAGCTCC-3'; Total RNA from healthy Pusa Ruby, ToLCNDV (2A+2B) agroinfected Pusa Ruby and LA1777 leaves and flowers was prepared using an RNeasy plant mini kit (Qiagen). [score:1]
[1 to 20 of 17 sentences]
4
[+] score: 23
MiR390, miR166, miR159 were up-regulated and miR530, miR167, miR164, miR396, miR168, miR393, miR8006 and two new miRNAs, miR#W and miR#M were down-regulated in 7B- 1 anthers. [score:7]
Among the known miRNAs, miR390, miR166, miR159 were up-regulated and miR530, miR167, miR164, miR396, miR168, miR393, and miR8006 were down-regulated in 7B- 1 anthers (Table  2). [score:7]
MiR166 and miR164 had three and two iso-miRs, respectively, while the rest of differentially expressed miRNAs were present only by one member. [score:3]
Zhang et al., [29] reported that miR156, miR159, miR164, miR166, miR172 and miR319 were differentially expressed in sporogenous cell, MMCs and microspores between a male-sterile cotton and its maintainer line. [score:3]
There are increasing evidences showing that the function of miRNAs, including miR156, miR159, miR164, miR167, miR172 and miR319 is crucial during flower development and microsporogenesis [31– 33]. [score:2]
1 Aldehyde dehydrogenase Solyc03g118350.2.1 Actin-fragmin kinase Solyc05g053090.1.1GRAS transcription factor [a] Solyc06g007320.2.1 Ubiquitin-activating enzyme E1 Solyc06g059760.2.1 Transcriptional corepressor SEUSS Solyc07g019640.1.1 Transposase Solyc07g045480.2.1 Phytochrome F Solyc09g057910.2.1 N-alpha-acetyltransferase 25 Solyc10g047270.1.1 Potassium transporter family protein Solyc11g006680.1.1 Pentatricopeptide repeat-containing protein Solyc11g020100.1.1 Cc-nbs-lrr, resistance protein Solyc12g013840.1.1 G-protein beta WD-40 repeat miR164 Solyc03g115850.2.1No Apical Meristem (NAM) [a] Solyc06g084350.2.1 U6 snRNA -associated Sm-like protein LSm2 Solyc11g066150.1.1 Bifunctional polymyxin resistance protein ArnA miR167 Solyc02g037530.2.1Auxin response factor 8 [a] Solyc01g010020.2. [score:1]
[1 to 20 of 6 sentences]
5
[+] score: 12
Most of the conserved miRNAs (such as miR156, miR159, miR160, miR164, miR167, miR171, miR172, miR319, and some others) usually target a range of transcription factors like MYBs, ARFs, SBPs, NACs, AP2-like factors, GRFs, and GRASs, and their miRNAs -mediated regulations are important for plant growth and development and may act in the core gene expression networks (Liu et al., 2013). [score:7]
In our present study, homologs of miR162, miR164, miR166, and miR397 were identified as significantly differentially expressed between grafted and control tomato fruits but not in the shoot tissues (Table S7). [score:3]
Some miRNAs such as, miR156, miR162, miR164, miR166, miR172, miR397, and miR398 were reported to be highly conserved in tomato fruit and developmental stages (Zuo et al., 2012; Karlova et al., 2013). [score:2]
[1 to 20 of 3 sentences]
6
[+] score: 11
Similar to stamens, pistil miRNAs were generally downregulated in response to heat-stress treatment at 2 d after heat-stress treatment except for miR164a-5p, which was strongly upregulated at both 2 d and 12 d of treatment. [score:7]
M: marker; asterisk indicates PCR amplification products of decapped mRNA The expression patterns of nine randomly selected miRNAs using qRT-PCR showed that most stamen miRNAs exhibited a decreasing trend after high-temperature treatment except for miR164a-5p, which was significantly increased at 2 d after high-temperature treatment (Fig.   8). [score:3]
Some miRNAs (e. g., miR156, miR164, miR168, miR171, miR393, miR396, and miR398) are associated with a broad range of plant defense responses to stresses including drought, salt, and cold stresses [18]. [score:1]
[1 to 20 of 3 sentences]
7
[+] score: 11
Totally, 53 miRNAs (such as sly‐miR164, sly‐miR166 and sly‐miR408) targeted 23 genes associated with drought response and tissue development, which included NAC‐domain, HD‐ZIP and BCP (blue copper protein). [score:4]
Additionally, stress‐related proteins known as stress‐responsive protein, stress‐enhanced protein, universal stress protein and stress‐induced protein were potentially targeted by 49 miRNAs, such as sly‐miR164a, sly‐miR1074, sly‐miR1873, sly‐miR2628 and sly‐miR5029. [score:3]
These targets were cleaved by sly‐miR156, sly‐miR164, sly‐miR166, sly‐miR169, sly‐miR171, sly‐miR395 and sly‐mir9477 (Table S4). [score:3]
Eleven miRNA families (sly‐miR156, sly‐miR157, sly‐miR164, sly‐miR166, sly‐miR167, sly‐miR168, sly‐miR4414, sly‐miR6022, sly‐miR6027, sly‐miR7822 and sly‐miR9471) were represented with the top read abundance above 10 000 at all libraries (Table S2). [score:1]
[1 to 20 of 4 sentences]
8
[+] score: 10
Nine miRNAs (sly-miR164a-3p, sly-miR166c-5p, sly-miR167b-3p, sly-miR168b-3p, sly-miR168b-5p, sly-miR394-3p, sly-miR396a-3p, sly-miR1919a and sly-miR9471a-5p) were down-regulated in M82, whereas they were up-regulated in IL9–1 (Fig. 5a). [score:7]
For instance, the target of sly-miR156a, sly-miR164a-5p, sly-miR171c, sly-miR171d and sly-miR319c-3p were genes encoding SPL, NAC, MYB, GRAS and TCP transcription factors, respectively, which are all related to plant stress tolerance (Additional file 10: Table S10). [score:3]
[1 to 20 of 2 sentences]
9
[+] score: 8
The majority of such targets are various transcriptional factors including SBP (miR156), MYB (miR159, miR319, miR172), NAM (miR164), and MADS-Box (miR396) that regulate plant development [53] or phytohormone signal transduction [54]. [score:5]
A few known miRNAs were expressed at high levels in fruit, such as miR157, miR162, miR164, miR166, miR168, miR172, miR396. [score:3]
[1 to 20 of 2 sentences]
10
[+] score: 7
For example, exogenous MeJA down-regulates miR156, miR168, miR169, miR172, miR172, miR396, miR480, and miR1310 and up-regulates miR164 and miR390 in Chinese yew (Qiu et al., 2009). [score:7]
[1 to 20 of 1 sentences]
11
[+] score: 4
Ethylene-insensitive3 is a senescence -associated gene that accelerates age -dependent leaf senescence by directly repressing miR164 transcription in Arabidopsis. [score:2]
For example, EIN3, a key transcription factor in ethylene signaling, directly binds to the promoter region of miR164 and represses its transcription (Li et al., 2013). [score:2]
[1 to 20 of 2 sentences]
12
[+] score: 3
In rice, several lncRNAs were also identified as competing endogenous RNAs, which bound miR160 and miR164 in a type of target mimicry [11]. [score:3]
[1 to 20 of 1 sentences]
13
[+] score: 3
For example, two reproduction-related rice lncRNAs were confirmed to be target mimics of miR160 and miR164 11. [score:3]
[1 to 20 of 1 sentences]
14
[+] score: 1
Several miRNA families, including miR157, miR159, miR162, miR164, miR167, miR171, miR172, miR390, miR396, and miR482, were moderately abundant (Figure  2A). [score:1]
[1 to 20 of 1 sentences]
15
[+] score: 1
All conserved miRNAs were divided into 41 miRNA families, and several miRNA families were the first to be detected in tomato, such as miR164, 384, 390, 396, 398, 408, 530, 827, 1886, 3627, 7981, 7982, 7983 and 8007. [score:1]
[1 to 20 of 1 sentences]
16
[+] score: 1
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR162a, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR171a, osa-MIR394, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR160e, osa-MIR160f, osa-MIR162b, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR408, osa-MIR172d, osa-MIR171i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, osa-MIR396e, gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR159a, gma-MIR160a, gma-MIR166a, gma-MIR166b, gma-MIR167a, gma-MIR167b, gma-MIR172a, gma-MIR172b, gma-MIR156a, gma-MIR396a, gma-MIR396b, gma-MIR156b, gma-MIR169a, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR169r, gma-MIR159b, gma-MIR159c, gma-MIR162a, gma-MIR164a, gma-MIR167c, gma-MIR169b, gma-MIR169c, gma-MIR171a, gma-MIR171b, gma-MIR482a, sly-MIR160a, sly-MIR166a, sly-MIR166b, sly-MIR167a, sly-MIR169a, sly-MIR169b, sly-MIR169c, sly-MIR169d, sly-MIR171a, sly-MIR171b, sly-MIR171c, sly-MIR171d, sly-MIR395a, sly-MIR395b, sly-MIR156a, sly-MIR156b, sly-MIR156c, sly-MIR159, sly-MIR162, sly-MIR172a, sly-MIR172b, osa-MIR396f, gma-MIR167d, gma-MIR396c, mdm-MIR482a, gma-MIR167e, gma-MIR167f, gma-MIR172c, gma-MIR172d, gma-MIR172e, osa-MIR396g, osa-MIR396h, osa-MIR396d, osa-MIR395x, osa-MIR395y, gma-MIR396d, gma-MIR482b, gma-MIR167g, gma-MIR156f, gma-MIR169d, gma-MIR172f, gma-MIR171c, gma-MIR169e, gma-MIR394b, gma-MIR156g, gma-MIR159d, gma-MIR394a, gma-MIR396e, gma-MIR156h, gma-MIR156i, gma-MIR160b, gma-MIR160c, gma-MIR160d, gma-MIR160e, gma-MIR162b, gma-MIR164b, gma-MIR164c, gma-MIR164d, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR169f, gma-MIR169g, gma-MIR171d, gma-MIR171e, gma-MIR171f, gma-MIR171g, gma-MIR394c, gma-MIR408d, gma-MIR482c, gma-MIR171h, gma-MIR171i, gma-MIR169h, gma-MIR167h, gma-MIR169i, gma-MIR396f, gma-MIR396g, gma-MIR167i, sly-MIR482e, sly-MIR482a, gma-MIR171j, gma-MIR395a, gma-MIR395b, gma-MIR395c, gma-MIR408a, gma-MIR408b, gma-MIR408c, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR159e, gma-MIR159f, gma-MIR162c, gma-MIR166i, gma-MIR166j, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR171k, gma-MIR172g, gma-MIR172h, gma-MIR172i, gma-MIR172j, gma-MIR396h, gma-MIR396i, gma-MIR482d, gma-MIR167j, gma-MIR171l, gma-MIR156p, gma-MIR171m, gma-MIR172k, gma-MIR171n, gma-MIR156q, gma-MIR171o, gma-MIR172l, gma-MIR169o, gma-MIR171p, gma-MIR394d, gma-MIR169p, gma-MIR156r, gma-MIR396j, gma-MIR171q, gma-MIR156s, gma-MIR169r, gma-MIR169s, gma-MIR396k, gma-MIR166k, gma-MIR156t, gma-MIR482e, gma-MIR171r, gma-MIR394e, gma-MIR169t, gma-MIR171s, gma-MIR166l, gma-MIR171t, gma-MIR394f, gma-MIR171u, gma-MIR395d, gma-MIR395e, gma-MIR395f, gma-MIR395g, gma-MIR166m, gma-MIR169u, sly-MIR482b, sly-MIR482c, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR160f, gma-MIR164e, gma-MIR164f, gma-MIR164g, gma-MIR164h, gma-MIR164i, gma-MIR164j, gma-MIR164k, gma-MIR166n, gma-MIR166o, gma-MIR166p, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR169v, gma-MIR394g, gma-MIR395h, gma-MIR395i, gma-MIR395j, gma-MIR395k, gma-MIR395l, gma-MIR395m, mdm-MIR156a, mdm-MIR156b, mdm-MIR156c, mdm-MIR156d, mdm-MIR156e, mdm-MIR156f, mdm-MIR156g, mdm-MIR156h, mdm-MIR156i, mdm-MIR156j, mdm-MIR156k, mdm-MIR156l, mdm-MIR156m, mdm-MIR156n, mdm-MIR156o, mdm-MIR156p, mdm-MIR156q, mdm-MIR156r, mdm-MIR156s, mdm-MIR156t, mdm-MIR156u, mdm-MIR156v, mdm-MIR156w, mdm-MIR156x, mdm-MIR156y, mdm-MIR156z, mdm-MIR156aa, mdm-MIR156ab, mdm-MIR156ac, mdm-MIR156ad, mdm-MIR156ae, mdm-MIR159a, mdm-MIR159b, mdm-MIR160a, mdm-MIR160b, mdm-MIR160c, mdm-MIR160d, mdm-MIR160e, mdm-MIR162a, mdm-MIR162b, mdm-MIR164a, mdm-MIR164b, mdm-MIR164c, mdm-MIR164d, mdm-MIR164e, mdm-MIR164f, mdm-MIR166a, mdm-MIR166b, mdm-MIR166c, mdm-MIR166d, mdm-MIR166e, mdm-MIR166f, mdm-MIR166g, mdm-MIR166h, mdm-MIR166i, mdm-MIR167a, mdm-MIR167b, mdm-MIR167c, mdm-MIR167d, mdm-MIR167e, mdm-MIR167f, mdm-MIR167g, mdm-MIR167h, mdm-MIR167i, mdm-MIR167j, mdm-MIR169a, mdm-MIR169b, mdm-MIR169c, mdm-MIR169d, mdm-MIR171a, mdm-MIR171b, mdm-MIR171c, mdm-MIR171d, mdm-MIR171e, mdm-MIR171f, mdm-MIR171g, mdm-MIR171h, mdm-MIR171i, mdm-MIR171j, mdm-MIR171k, mdm-MIR171l, mdm-MIR171m, mdm-MIR171n, mdm-MIR172a, mdm-MIR172b, mdm-MIR172c, mdm-MIR172d, mdm-MIR172e, mdm-MIR172f, mdm-MIR172g, mdm-MIR172h, mdm-MIR172i, mdm-MIR172j, mdm-MIR172k, mdm-MIR172l, mdm-MIR172m, mdm-MIR172n, mdm-MIR172o, mdm-MIR394a, mdm-MIR394b, mdm-MIR395a, mdm-MIR395b, mdm-MIR395c, mdm-MIR395d, mdm-MIR395e, mdm-MIR395f, mdm-MIR395g, mdm-MIR395h, mdm-MIR395i, mdm-MIR396a, mdm-MIR396b, mdm-MIR396c, mdm-MIR396d, mdm-MIR396e, mdm-MIR396f, mdm-MIR396g, mdm-MIR408a, mdm-MIR482b, mdm-MIR482c, mdm-MIR408b, mdm-MIR408c, mdm-MIR408d, mdm-MIR482d, mdm-MIR159c, mdm-MIR171o, mdm-MIR169e, mdm-MIR169f, sly-MIR164b, sly-MIR394, sly-MIR166c, sly-MIR156d, sly-MIR156e, sly-MIR396a, sly-MIR167b, sly-MIR482d, sly-MIR169e, sly-MIR396b, sly-MIR171e, gma-MIR167k, gma-MIR167l, gma-MIR169w, sly-MIR172c, sly-MIR408, sly-MIR172d, sly-MIR169f, sly-MIR171f, mdm-MIR159d, mdm-MIR159e, mdm-MIR159f, mdm-MIR166j, mdm-MIR395j, mdm-MIR169g, mdm-MIR169h, mdm-MIR169i, mdm-MIR169j, mdm-MIR171p, mdm-MIR395k, mdm-MIR171q, mdm-MIR169k, mdm-MIR169l, mdm-MIR169m, mdm-MIR169n, mdm-MIR172p, mdm-MIR395l, mdm-MIR169o
In the miR164, miR172 and miR395 families, all miRNA members were involved in duplication events. [score:1]
[1 to 20 of 1 sentences]
17
[+] score: 1
miR159, miR164, miR168, and miR396 declined significantly and miR390 rose visibly. [score:1]
[1 to 20 of 1 sentences]