sort by

10 publications mentioning chi-mir-27b

Open access articles that are associated with the species Capra hircus and mention the gene name mir-27b. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 262
The results indicated that the expression of Pax3 was negatively related to miR-27b during goat muscle development, and miR-27b could inhibit proliferation and promote the differentiation of the satellite cells in goat by regulating the expression of Pax3. [score:9]
We found that over -expression of miR-27b inhibited the protein, but not the mRNA, level of Pax3, which indicated that miR-27b could not inhibit Pax3 transcription but could prevent Pax3 protein translation. [score:9]
Bars with different letters are significantly different, p < 0.05. miR-27b inhibits the post-transcriptional expression of Pax3 in goat skeletal muscle satellite cellsUsing target prediction software (TargetScan), we found a binding site for miR-27b in the Pax3 3′UTR (Fig.   10). [score:9]
Based on the EdU assay and detection of the expression of MyoG after up -regulating or down -regulating the expression of miR-27b, we demonstrated that miR-27b could inhibit the proliferation of goat skeletal muscle satellite cells. [score:8]
We observed a lower expression of miR-27b in Boer goats than in Anhuai goats, in which it could promote the differentiation of skeletal muscle satellite cells but inhibit their proliferation by targeting Pax3 gene. [score:7]
We found that the expression of miR-27b in all collected muscle tissues of Anhuai goat, excluding kidney, was higher than in Boer goat, whereas the opposite expression pattern was observed for Pax3, which showed lower expression in Anhuai goat. [score:7]
When the expression of miR-27b was up-regulated in the cells, the fluorescence value and the signal for the blotting band (Figs  S1 and S2) decreased (Fig.   12). [score:6]
To further analyse the regulatory method, we used qPCR, immunofluorescence, and Western blot analysis to detect the expression of Pax3 when the expression of miR-27b was verified. [score:6]
Expression of Pax3 is negatively related to miR-27b during goat muscle developmentFirst, the total RNA was successfully extracted from all the collected tissues and cells, and then the expression pattern of Pax3 and miR-27b in the different goat breeds, muscle tissues, and cells were detected using qPCR. [score:6]
miR-27b targets the 3′-UTR of Pax3 and affects the post-transcriptional expression of Pax3, with consequences for the onset of skeletal muscle differentiation. [score:5]
Transfect the miR-27b mimics, miR-27b inhibitor and miR-27b Negative Control (NC) into skeletal muscle satellite cells and qPCR was used to detect the expression of miR-27b in the cells after transfection to validate the transfection efficiency. [score:5]
In the present study, we first analysed the expression of miR-27b and its predicted target gene, Pax3, in the muscle tissue of Anhuai goat, and the same tissues of Boer goat were used as a reference control. [score:5]
Figure 12 Pax3 protein expression level after over -expression of miR-27b. [score:5]
One study has shown that miR-27b participates in the regulation of the double-muscled phenotype in piedmontese cattle, and the results of a luciferase reporter assay demonstrated that bovine MSTN is a specific target of miR-27b and that miR-27b can promote skeletal muscle growth by targeting MSTN [23]. [score:5]
Using qPCR, we found that the expression of Pax3 mRNA did not significantly differ between the over -expression miR-27b group and the NC (Fig.   11). [score:5]
Using target prediction software (TargetScan), we found a binding site for miR-27b in the Pax3 3′UTR (Fig.   10). [score:5]
In addition, the expression of miR-27b was highest in the leg muscle of the two goat breeds, and the expression of Pax3 was highest in breast muscle (Fig.   2). [score:5]
Moreover, miR-27b has been reported to regulate Pax3 protein levels, and this downregulation ensures rapid and robust entry into the myogenic differentiation programme in mice [16]. [score:5]
miR-27b inhibits the post-transcriptional expression of Pax3 in goat skeletal muscle satellite cells. [score:5]
The results showed that the endogenous expression of miR-27b decreased during the proliferation of satellite cells; however, the expression of Pax3 gradually increased. [score:5]
Therefore, the results implied that the expression of Pax3 was related to meat production in goat, however, the expression of miR-27b was negatively related to production. [score:5]
In addition, miR-27b can regulate Pax3 protein levels, and this downregulation ensures rapid and robust entry into the myogenic differentiation programme in mice [16]. [score:5]
However, in this study, miR-27b only inhibited Pax3 gene translation and did not degrade Pax3 mRNA. [score:5]
To further explore the function of miR-27b and Pax3 in muscle development in goat, the expression of the two transcripts in skeletal muscle satellite cells from different stages of proliferation and differentiation were analysed. [score:4]
To further elucidate the relationship of miR-27b and Pax3 during the development of muscle satellite cells, the expression of the two transcripts in the cells, which are in different stages of proliferation and on different days of differentiation, were analyzed. [score:4]
Expression of Pax3 is negatively related to miR-27b during goat muscle development. [score:4]
Thus, we concluded that Pax3 was a direct target gene of miR-27b in goat skeletal muscle satellite cells. [score:4]
Compared with the Boer goat, the expression of miR-27b was higher in all the collected muscle tissues of Anhuai goat, excluding kidney, whereas the expression of Pax3 was opposite, demonstrating lower values in all tissues in Anhuai goat (Fig.   2). [score:4]
Taken together, the results suggested that miR-27b could regulate the post-transcriptional expression of Pax3 in goat. [score:4]
In this article, we analysed the expression patterns of miR-27b and Pax3 in different muscle tissues of goat and studied the potential of miR-27b as a regulator of Pax3 in Anhuai goat. [score:4]
Taken together, the results showed that miR-27b could regulate myogenic proliferation and differentiation by targeting Pax3 in goat. [score:4]
Finally, we conducted a dual-luciferase reporter assay to assess whether Pax3 is a target gene of miR-27b during the development of goat muscle. [score:3]
Figure 3Expression of miR-27b and Pax3 during the differentiation and proliferation of satellite cells. [score:3]
The miR-27b mimics, inhibitor, NC, si-Pax3, and pLVX-Pax3-FLAG-IRES-Neo were transfected into goat skeletal muscle satellite cells, respectively, using FugeneHD transfection reagent (Promega, USA) following the manufacturer’s manual. [score:3]
The results showed a negative correlation between the expression patterns of pax3 and miR-27b. [score:3]
Figure 4 Expression of miR-27b in cells after transfection. [score:3]
Figure 11Expression of Pax3 mRNA in cells transfected with miR-27b mimics. [score:3]
Figure 2Expression of miR-27b and Pax3 in the different muscle tissues of Boer goats and Anhuai goats. [score:3]
Moreover, the expression of miR-27b increased, and the Pax3 decreased during the differentiation of goat skeletal muscle satellite cells (Fig.   3). [score:3]
The qPCR, immunofluorescence staining, and Western blot analyses were used to determine the influence of miR-27b on the expression of Pax3 mRNA and protein, respectively. [score:3]
Figure 10 Pax3 is a target gene of miR-27b. [score:3]
The results illustrated that miR-27b can inhibit goat skeletal muscle satellite cell proliferation. [score:3]
In addition, the expression of MyoG, which is the marker gene of cell differentiation, was detected by qPCR to analyse the influence of miR-27b and Pax3 on the differentiation of goat skeletal muscle satellite cells. [score:3]
In addition, the expression patterns of miR-27b and pax3 during skeletal muscle satellite cell proliferation and differentiation were determined by qPCR. [score:3]
First, the total RNA was successfully extracted from all the collected tissues and cells, and then the expression pattern of Pax3 and miR-27b in the different goat breeds, muscle tissues, and cells were detected using qPCR. [score:3]
TargetScan was used to predict the putative binding site of miR-27b on Pax3, and constructs with mutations in the putative binding site were generated by overlapping PCR using Pax3-F, Pax3-MR, Pax3-MF, and Pax3-R as primers and the product of the above PCR as template. [score:3]
We detected the expression pattern of MyoG in satellite cells transfected with miR-27b mimics by qPCR. [score:3]
However, the opposite trend was observed for Pax3, which indicated that miR-27b could promote the differentiation but inhibit the proliferation of muscle cells in goat. [score:3]
In our previous study, we found that miR-27b was expressed in a tissue-specific manner in the muscle of Anhuai goat [17]; however, its function and mechanism of action were unclear. [score:3]
For western blot, the goat skeletal muscle satellite cells, which were transfected with miR-27b mimics or NC, were cultured for 48 h, and the total protein of the cells were extracted by the RIPA buffer (TaKaRa, Dalian, China) with 1% PMSF (protease inhibitor). [score:3]
miR-27b has been found to be expressed in a tissue-specific manner in the muscle of Anhuai goat [17], however, its functions and mechanisms remain unclear. [score:3]
However, the percentage of EdU -positive in the cells transfected with miR-27b inhibitor was significantly increased, and the proliferation of the cells was increased by 35% (Fig.   5). [score:3]
The function of miR-27b is to inhibit proliferation and promote goat skeletal muscle satellite cell differentiation. [score:3]
The expression levels of miR-27b and Pax3 were detected using qPCR to determine the transfection efficiency. [score:3]
The results showed that the expression of miR-27b gradually decreased with the proliferation of satellite cells, but increased with the differentiation of cells. [score:3]
miR-27b can inhibit skeletal muscle satellite cell proliferation but promote its differentiation [16]. [score:3]
Function Sequence (5′ → 3′) Pax3 Forward AGCCGCACCACCTTCACA Pax3 Reverse TCTGGGCCAGTTCCTCCC MyoG Forward CGTGGGCGTGTAAGGTGT MyoG Reverse GGCGCTCTATGTACTGGATGG GAPDH Forward CACAGTCAAGGCAGAGAAC GAPDH Reverse TACTCAGCACCAGCATCA miR-27b stem loop primer GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACGCAGAAC miR-27b Forward GGGGTTCACAGTGGCTAA miR-27b Reverse TGAGGTGCTGTGCGTGAC U6 Forward CTCAGAATCACCCAATGC U6 Reverse ATGTTCATCCAGTTGTCAC The miR-27b mimics, inhibitor and negative control (NC) were all designed and synthesized by Ribobio (Ribobio, China). [score:2]
Compared with NC, the expression of miR-27b was successfully influenced by transfection (Fig.   4). [score:2]
Research examining the mechanism of miR-27b in muscle growth can help to reveal the mechanisms underlying muscle development and provide a theoretical basis for animal breeding. [score:2]
Compared with the NC or blank, the expression of MyoG was significantly increased in response to miR-27b mimic treatment, which indicated that miR-27b could promote the differentiation of satellite cells (Fig.   6). [score:2]
We also found that there may be a close and direct relationship between miR-27b and pax3. [score:2]
To date, many muscle-specific miRNAs, miR-1, miR-133, miR-206, miR-27, were found, which have been shown to play critical roles in skeletal muscle development. [score:2]
As a member of the miR-27 family, miR-27b plays an important role in muscle development. [score:2]
Figure 5Effect of miR-27b on the proliferation of satellite cells. [score:1]
The satellite cells (2 × 10 [4]) were seeded in 96-well plates and transfected with 0.2 µg of reporter vectors, 4.5 µg miR-27b mimics or negative control, and 30 µl Opti-MEM medium (Gibco, USA), using FugeneHD reagent (Promega, USA). [score:1]
For immunofluorescence, goat skeletal muscle satellite cells, which were identified or transfected with miR-27b mimics or NC, were fixed in 4% paraformaldehyde for 10 min, treated with 0.5% Triton X-100 at 37 °C for 15 min, blocked with 1% BSA for 1 h at room temperature, and incubated with primary antibodies against Pax7, MyoD1, Myog and Pax3 overnight and then with secondary antibodies. [score:1]
In conclusion, our results demonstrated that miR-27b played an important role in goat skeletal muscle satellite cell proliferation and differentiation. [score:1]
[1 to 20 of 67 sentences]
2
[+] score: 11
MiR-205 over -expression leads to an expansion of the progenitor-cell population and increased cellular proliferation [26], while miR-27 reduces lipid accumulation by targeting peroxisome proliferator-activated receptor γ (PPARγ) in human adipocyte cells [27], and miR-33 represses sterol transporters in human liver cells [28]. [score:5]
In the mammary glands of lactating goats, we found that miRNAs associated with cell proliferation (miR-26a, miR-21), conferring epithelial phenotype (miR-29a, miR-30a/d), immune response and development (miR-181, let-7a/b/f/g/i) were abundantly expressed, as well as miRNAs involved in lipid metabolism (miR-103, miR-23a, miR-27b, miR-200a/b/c). [score:4]
From the top 30 miRNAs, we found six miRNAs (e. g., miR-23a, miR-27b, miR-103, miR-200a/b/c) to be related to lipid metabolism in human adipocyte cells: miR-23 enhances glutamine metabolism [38]; miR-27 decreases fat accumulation [27]; miR-103 regulates triglyceride content during cell differentiation [39]; and miR-200 affects insulin signaling [40]. [score:2]
[1 to 20 of 3 sentences]
3
[+] score: 10
The 10 most highly expressed miRNAs (miR-99a, miR-148a, miR-143, miR-10b, miR-26a, miR-21, miR-125b, miR-27b, let-7f, and miR-101) identified in the present study were also highly expressed in the ovaries of goats 18, 20, pigs [22], and other animal species as reviewed by Li et al. [9]. [score:5]
The 10 most abundant miRNAs (miR-99a-5p, miR-148a-3p, miR-143-3p, miR-10b-5p, miR-26a-5p, miR-21-5p, miR-125b-5p, miR-27b-3p, let-7f-5p, and miR-101-3p) were the same in the two libraries, of which miR-21-5p was defined as differentially expressed miRNA with a higher level in the prolific library than in the non-prolific library, but the remaining nine miRNAs did not meet the criteria of differentially expressed miRNA between the breeds (Table  3). [score:5]
[1 to 20 of 2 sentences]
4
[+] score: 10
MiRNAs name Normalized expression level Mature sequences WF BF Goat-miR-146b-5p 186,997.77 158,761.10 ugagaacugaauuccauaggcugu Goat-miR-27b-3p 79,872.78 72,800.46 uucacaguggcuaaguucugc Goat-miR-205-5p 20,575.80 19,911.95 uccuucauuccaccggagucug Goat-miR-181a-2-5p 21,177.16 16,613.29 aacauucaacgcugucggugagu Goat-miR-181a-1-5p 21,176.79 16,613.08 aacauucaacgcugucggugagu Goat-miR-92a-3p 19,003.38 17,003.44 uauugcacuugucccggccugu Goat-miR-182-5p 14,218.79 13,630.30 uuuggcaaugguagaacucacacu Goat-miR-26a-1-5p 14,855.58 12,171.42 uucaaguaauccaggauaggcu Goat-miR-26a-2-5p 14,837.64 12,152.12 uucaaguaauccaggauaggcu Goat-let-7f-5p 10,685.28 8870.12 ugagguaguagauuguauaguu ijms-15-09531-t002_Table 2 Table 2 The five most abundantly expressed novel miRNAs in goat hair follicels. [score:5]
MiRNAs name Normalized expression level Mature sequences WF BF Goat-miR-146b-5p 186,997.77 158,761.10 ugagaacugaauuccauaggcugu Goat-miR-27b-3p 79,872.78 72,800.46 uucacaguggcuaaguucugc Goat-miR-205-5p 20,575.80 19,911.95 uccuucauuccaccggagucug Goat-miR-181a-2-5p 21,177.16 16,613.29 aacauucaacgcugucggugagu Goat-miR-181a-1-5p 21,176.79 16,613.08 aacauucaacgcugucggugagu Goat-miR-92a-3p 19,003.38 17,003.44 uauugcacuugucccggccugu Goat-miR-182-5p 14,218.79 13,630.30 uuuggcaaugguagaacucacacu Goat-miR-26a-1-5p 14,855.58 12,171.42 uucaaguaauccaggauaggcu Goat-miR-26a-2-5p 14,837.64 12,152.12 uucaaguaauccaggauaggcu Goat-let-7f-5p 10,685.28 8870.12 ugagguaguagauuguauaguu ijms-15-09531-t002_Table 2 Table 2 The five most abundantly expressed novel miRNAs in goat hair follicels. [score:5]
[1 to 20 of 2 sentences]
5
[+] score: 8
miR-27b-3p suppresses cell proliferation through targeting receptor tyrosine kinase like orphan receptor 1 in gastric cancer. [score:5]
Moreover, the top 10 most highly expressed miRNAs, such as miR-26a-5p (Guo et al., 2016b) and miR-27b-3p (Tao et al., 2015), were also implicated in cell proliferation. [score:3]
[1 to 20 of 2 sentences]
6
[+] score: 8
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-21, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-99a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-16-2, hsa-mir-192, hsa-mir-148a, hsa-mir-10b, hsa-mir-181a-2, hsa-mir-181a-1, hsa-mir-215, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-mir-15b, hsa-mir-27b, hsa-mir-125b-1, hsa-mir-141, hsa-mir-143, hsa-mir-152, hsa-mir-125b-2, hsa-mir-126, hsa-mir-146a, hsa-mir-184, hsa-mir-200c, hsa-mir-155, hsa-mir-29c, hsa-mir-200a, hsa-mir-99b, hsa-mir-296, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-378a, hsa-mir-342, hsa-mir-148b, hsa-mir-451a, ssc-mir-125b-2, ssc-mir-148a, ssc-mir-15b, ssc-mir-184, ssc-mir-224, ssc-mir-23a, ssc-mir-24-1, ssc-mir-26a, ssc-mir-29b-1, ssc-let-7f-1, ssc-mir-103-1, ssc-mir-21, ssc-mir-29c, hsa-mir-486-1, hsa-mir-499a, hsa-mir-671, hsa-mir-378d-2, bta-mir-26a-2, bta-mir-29a, bta-let-7f-2, bta-mir-103-1, bta-mir-148a, bta-mir-16b, bta-mir-21, bta-mir-499, bta-mir-99a, bta-mir-125b-1, bta-mir-126, bta-mir-181a-2, bta-mir-27b, bta-mir-31, bta-mir-15b, bta-mir-215, bta-mir-30e, bta-mir-148b, bta-mir-192, bta-mir-200a, bta-mir-200c, bta-mir-23a, bta-mir-29b-2, bta-mir-29c, bta-mir-10b, bta-mir-24-2, bta-mir-30a, bta-mir-200b, bta-let-7a-1, bta-mir-342, bta-let-7f-1, bta-let-7a-2, bta-let-7a-3, bta-mir-103-2, bta-mir-125b-2, bta-mir-15a, bta-mir-99b, hsa-mir-664a, ssc-mir-99b, hsa-mir-103b-1, hsa-mir-103b-2, ssc-mir-15a, ssc-mir-16-2, ssc-mir-16-1, bta-mir-141, bta-mir-143, bta-mir-146a, bta-mir-152, bta-mir-155, bta-mir-16a, bta-mir-184, bta-mir-24-1, bta-mir-223, bta-mir-224, bta-mir-26a-1, bta-mir-296, bta-mir-29d, bta-mir-378-1, bta-mir-451, bta-mir-486, bta-mir-671, bta-mir-29e, bta-mir-29b-1, bta-mir-181a-1, ssc-mir-181a-1, ssc-mir-215, ssc-mir-30a, bta-mir-2318, bta-mir-2339, bta-mir-2430, bta-mir-664a, bta-mir-378-2, ssc-let-7a-1, ssc-mir-378-1, ssc-mir-29a, ssc-mir-30e, ssc-mir-499, ssc-mir-143, ssc-mir-10b, ssc-mir-486-1, ssc-mir-152, ssc-mir-103-2, ssc-mir-181a-2, ssc-mir-27b, ssc-mir-24-2, ssc-mir-99a, ssc-mir-148b, ssc-mir-664, ssc-mir-192, ssc-mir-342, ssc-mir-125b-1, oar-mir-21, oar-mir-29a, oar-mir-125b, oar-mir-181a-1, hsa-mir-378b, hsa-mir-378c, ssc-mir-296, ssc-mir-155, ssc-mir-146a, bta-mir-148c, ssc-mir-126, ssc-mir-378-2, ssc-mir-451, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-451b, hsa-mir-499b, ssc-let-7a-2, ssc-mir-486-2, hsa-mir-664b, hsa-mir-378j, ssc-let-7f-2, ssc-mir-29b-2, ssc-mir-31, ssc-mir-671, bta-mir-378b, bta-mir-378c, hsa-mir-486-2, oar-let-7a, oar-let-7f, oar-mir-103, oar-mir-10b, oar-mir-143, oar-mir-148a, oar-mir-152, oar-mir-16b, oar-mir-181a-2, oar-mir-200a, oar-mir-200b, oar-mir-200c, oar-mir-23a, oar-mir-26a, oar-mir-29b-1, oar-mir-30a, oar-mir-99a, bta-mir-664b, chi-let-7a, chi-let-7f, chi-mir-103, chi-mir-10b, chi-mir-125b, chi-mir-126, chi-mir-141, chi-mir-143, chi-mir-146a, chi-mir-148a, chi-mir-148b, chi-mir-155, chi-mir-15a, chi-mir-15b, chi-mir-16a, chi-mir-16b, chi-mir-184, chi-mir-192, chi-mir-200a, chi-mir-200b, chi-mir-200c, chi-mir-215, chi-mir-21, chi-mir-223, chi-mir-224, chi-mir-2318, chi-mir-23a, chi-mir-24, chi-mir-26a, chi-mir-296, chi-mir-29a, chi-mir-29b, chi-mir-29c, chi-mir-30a, chi-mir-30e, chi-mir-342, chi-mir-378, chi-mir-451, chi-mir-499, chi-mir-671, chi-mir-99a, chi-mir-99b, bta-mir-378d, ssc-mir-378b, oar-mir-29b-2, ssc-mir-141, ssc-mir-200b, ssc-mir-223, bta-mir-148d
Ye et al. (2012) examined miRNA expression in the duodenum of E. coli F18-sensitive and -resistant weaned piglets and identified 12 candidate miRNA (ssc-miR-143, ssc-let-7f, ssc-miR-30e, ssc-miR-148a, ssc-miR-148b, ssc-miR-181a, ssc-miR-192, ssc-miR-27b, ssc-miR-15b, ssc-miR-21, ssc-miR-215, and ssc-miR-152) disease markers. [score:5]
Additionally, a number of miRNAs including miR-148a, miR-26a, miR-21-5p, miR-27b, miR-143, bta-miR-30a-5p, let-7a-5p, let-7f, miR-10b, and miR-99a-5p are highly expressed in bovine mammary gland/mammary epithelial cells (Li et al., 2012a, 2014a; Jin et al., 2014a; Le Guillou et al., 2014) suggesting roles in the lactation process and mammary gland functions. [score:3]
[1 to 20 of 2 sentences]
7
[+] score: 6
Lin et al. detected that miR-27 suppresses TAG accumulation in GMEC. [score:3]
Lin et al. [40] detected that miR-27 suppresses TAG accumulation in GMEC. [score:3]
[1 to 20 of 2 sentences]
8
[+] score: 3
Pax3 was reported to be targeted by miRNA-1 [11], miRNA-27b [23] and miRNA-206 [24]. [score:3]
[1 to 20 of 1 sentences]
9
[+] score: 3
found that miR—27 suppress triglycerides accumulation in mammary epithelial cells of goat through the functional study of miR-27 [32]. [score:3]
[1 to 20 of 1 sentences]
10
[+] score: 2
Post-transcriptional regulation of miR-27 in murine cytomegalovirus infection. [score:2]
[1 to 20 of 1 sentences]