sort by

7 publications mentioning chi-mir-30d

Open access articles that are associated with the species Capra hircus and mention the gene name mir-30d. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 12
confirmed the down-regulation of 8 miRNAs (novel-miR-51, novel-miR-99, miR-30d, miR-574, miR-222, miR-196a, miR-3613a, and miR-27a-5p) and the up-regulation of 4 miRNAs (novel-miR-75, miR-1246, miR-2478, and miR-2904) in infected MDBK cells compared with the uninfected (Figure 4A). [score:6]
Primer Sequence (5′-3′) bta-miR-30d TGTAAACATCCCCGACTGGAAGCT bta-miR-574 TGAGTGTGTGTGTGTGAGTGTGTG bta-miR-222 GAGCTACATCTGGCTACTGGGT bta-miR-196a GGCTAGGTAGTTTCATGTTGTTGGG bta-miR-3613a GCGGCTGTTGTACTTTTTTTTTTGTTC bta-miR-1246 GGCAATGGATTTTTGGAGCAGG bta-miR-2478 GCCGTATCCCACTTCTGACACCA bta-miR-2904 GGGAGCCTCGGTTGGCCT bta-miR-27a-5p GGCTTCACAGTGGCTAAGTTCCG novel-miR-51 TAATACTGCCTGGTAATGATGAC novel-miR-99 TTGGGAAGCACAGACACTAGGACT novel-miR-75 TCAAAGACTCGGACGTGACTGA 5S rRNA-F GTCTACGGCCATACCACCCT Table 2 Primers used to detect target genes expression with RT-qPCR. [score:3]
Primer Sequence (5′-3′) bta-miR-30d TGTAAACATCCCCGACTGGAAGCT bta-miR-574 TGAGTGTGTGTGTGTGAGTGTGTG bta-miR-222 GAGCTACATCTGGCTACTGGGT bta-miR-196a GGCTAGGTAGTTTCATGTTGTTGGG bta-miR-3613a GCGGCTGTTGTACTTTTTTTTTTGTTC bta-miR-1246 GGCAATGGATTTTTGGAGCAGG bta-miR-2478 GCCGTATCCCACTTCTGACACCA bta-miR-2904 GGGAGCCTCGGTTGGCCT bta-miR-27a-5p GGCTTCACAGTGGCTAAGTTCCG novel-miR-51 TAATACTGCCTGGTAATGATGAC novel-miR-99 TTGGGAAGCACAGACACTAGGACT novel-miR-75 TCAAAGACTCGGACGTGACTGA 5S rRNA-F GTCTACGGCCATACCACCCT Table 2 Primers used to detect target genes expression with RT-qPCR. [score:3]
[1 to 20 of 3 sentences]
2
[+] score: 9
To address the relationship between miR-30-5p and miR-15a we measured the expression of miR-15a in GMEC with miR-30e-5p as being overexpressed or inhibited, respectively. [score:5]
Several reports demonstrated the function of the miR-30 family in adipogenesis and inhibition of osteogenesis. [score:3]
Data indicated that miR-30-5p and miR-15a promote fat metabolism. [score:1]
[1 to 20 of 3 sentences]
3
[+] score: 5
Stem-loop Real-time RT-PCR was performed on 15 differential expressed known miRNAs including chi-miR-485, chi-miR-487b, chi-miR-494, chi-miR-382-5p, chi-miR-432, chi-miR-495, chi-miR-365-5p, chi-miR-369-3p, chi-miR-29a, chi-miR-380, chi-miR-503, chi-miR-541, chi-miR-127, chi-miR-299-3p, chi-miR-3958, and 5 novel miRNAs, including chi-novel-miR-47, chi-novel-miR-84, chi-novel-miR-70, chi-novel-miR-30, chi-novel-miR-72. [score:3]
For example, the total reads of chi-novel-miRNA-30, chi-novel-miRNA-84 and chi-novel-miRNA-70 that had the highest reads number, were only 18540, 3436 and 3436, respectively. [score:1]
miRNA-2284, miRNA-2285 and miRNA-30 possessed 7, 6 and 7 members, respectively. [score:1]
[1 to 20 of 3 sentences]
4
[+] score: 4
For miRNA families, each of 6 families (let-7, miR-2284, miR-30, miR-143, miR-10 and miR-378) had more than 100 members, and Alsaweed also reported the members of each family with higher expression abundance [39]. [score:3]
The largest family was miR-2284 with 447 members, which was detected in 43 species, followed by let-7, miR-30, miR-143, miR-10 and miR-378; 152 families were the smallest, each containing only one member. [score:1]
[1 to 20 of 2 sentences]
5
[+] score: 3
Further studies reported that miR-30b, miR-30d, and -miR-494 are differentially expressed in pre-receptive and receptive endometria in human [10], suggesting that miRNAs played important roles in gene reprogramming during the formation of endometrial receptivity. [score:3]
[1 to 20 of 1 sentences]
6
[+] score: 1
In T-cell function, miR-101 is extremely important in the post-transcriptional modulation of Icos, and miR-30 is modulated upon interferon-β exposure [63]. [score:1]
[1 to 20 of 1 sentences]
7
[+] score: 1
However, in late lactation, miR-143, let-7, miR-21, miR-148, miR-30, miR-146, miR-107 and miR-103 were the most abundant, each with more than 100,000 reads. [score:1]
[1 to 20 of 1 sentences]