sort by

3 publications mentioning bta-mir-374c

Open access articles that are associated with the species Bos taurus and mention the gene name mir-374c. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 5
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-98, hsa-mir-99a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-10a, hsa-mir-10b, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-181a-1, hsa-mir-221, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-27b, hsa-mir-30b, hsa-mir-130a, hsa-mir-152, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-185, hsa-mir-193a, hsa-mir-320a, hsa-mir-200c, hsa-mir-1-1, hsa-mir-181b-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-99b, hsa-mir-130b, hsa-mir-30e, hsa-mir-363, hsa-mir-374a, hsa-mir-375, hsa-mir-378a, hsa-mir-148b, hsa-mir-331, hsa-mir-339, hsa-mir-423, hsa-mir-20b, hsa-mir-491, hsa-mir-193b, hsa-mir-181d, hsa-mir-92b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, bta-mir-29a, bta-let-7f-2, bta-mir-148a, bta-mir-18a, bta-mir-20a, bta-mir-221, bta-mir-27a, bta-mir-30d, bta-mir-320a-2, bta-mir-99a, bta-mir-181a-2, bta-mir-27b, bta-mir-30b, bta-mir-106a, bta-mir-10a, bta-mir-15b, bta-mir-181b-2, bta-mir-193a, bta-mir-20b, bta-mir-30e, bta-mir-92a-2, bta-mir-98, bta-let-7d, bta-mir-148b, bta-mir-17, bta-mir-181c, bta-mir-191, bta-mir-200c, bta-mir-22, bta-mir-29b-2, bta-mir-29c, bta-mir-423, bta-let-7g, bta-mir-10b, bta-mir-24-2, bta-mir-30a, bta-let-7a-1, bta-let-7f-1, bta-mir-30c, bta-let-7i, bta-mir-25, bta-mir-363, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-15a, bta-mir-19a, bta-mir-19b, bta-mir-331, bta-mir-374a, bta-mir-99b, hsa-mir-374b, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, bta-mir-1-2, bta-mir-1-1, bta-mir-130a, bta-mir-130b, bta-mir-152, bta-mir-181d, bta-mir-182, bta-mir-185, bta-mir-24-1, bta-mir-193b, bta-mir-29d, bta-mir-30f, bta-mir-339a, bta-mir-374b, bta-mir-375, bta-mir-378-1, bta-mir-491, bta-mir-92a-1, bta-mir-92b, bta-mir-9-1, bta-mir-9-2, bta-mir-29e, bta-mir-29b-1, bta-mir-181a-1, bta-mir-181b-1, bta-mir-320b, bta-mir-339b, bta-mir-19b-2, bta-mir-320a-1, bta-mir-193a-2, bta-mir-378-2, hsa-mir-378b, hsa-mir-320e, hsa-mir-378c, bta-mir-148c, hsa-mir-374c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-378j, bta-mir-378b, bta-mir-378c, bta-mir-378d, bta-mir-148d
In addition, many miRNA families showed low expression (count number <100) in milk exosomes, such as the miR-1, miR-130, miR-17, miR-10, miR-29, miR-374, mir-9, miR-15 and miR-491 families (Figure 12F), which are routinely expressed in specific tissues [53– 56]. [score:5]
[1 to 20 of 1 sentences]
2
[+] score: 1
By analyzing AGO-bound miRNAs in MDBK cells, we found the abundance profile dominated by members of the miR-30, let-7, miR-17, miR-374, miR-21, miR-27 and miR-15 families together accounting for more than 50% (Supplementary Fig.   S2a) [14]. [score:1]
[1 to 20 of 1 sentences]
3
[+] score: 1
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-27a, hsa-mir-31, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-16-2, hsa-mir-192, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-181a-2, hsa-mir-205, hsa-mir-181a-1, hsa-mir-214, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-146a, hsa-mir-184, hsa-mir-186, hsa-mir-193a, hsa-mir-194-1, hsa-mir-155, hsa-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-219a-2, hsa-mir-99b, hsa-mir-26a-2, hsa-mir-365a, hsa-mir-365b, hsa-mir-374a, hsa-mir-148b, hsa-mir-423, hsa-mir-486-1, hsa-mir-499a, hsa-mir-532, hsa-mir-590, bta-mir-26a-2, bta-let-7f-2, bta-mir-103-1, bta-mir-148a, bta-mir-16b, bta-mir-21, bta-mir-221, bta-mir-222, bta-mir-27a, bta-mir-499, bta-mir-125b-1, bta-mir-181a-2, bta-mir-205, bta-mir-27b, bta-mir-30b, bta-mir-31, bta-mir-193a, bta-let-7d, bta-mir-148b, bta-mir-186, bta-mir-191, bta-mir-192, bta-mir-200a, bta-mir-214, bta-mir-22, bta-mir-23a, bta-mir-29c, bta-mir-423, bta-let-7g, bta-mir-24-2, bta-let-7a-1, bta-mir-532, bta-let-7f-1, bta-mir-30c, bta-let-7i, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-125b-2, bta-mir-365-1, bta-mir-374a, bta-mir-99b, hsa-mir-374b, hsa-mir-664a, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-1915, bta-mir-146a, bta-mir-155, bta-mir-16a, bta-mir-184, bta-mir-24-1, bta-mir-194-2, bta-mir-219-1, bta-mir-223, bta-mir-26a-1, bta-mir-365-2, bta-mir-374b, bta-mir-486, bta-mir-763, bta-mir-9-1, bta-mir-9-2, bta-mir-181a-1, bta-mir-2284i, bta-mir-2284s, bta-mir-2284l, bta-mir-2284j, bta-mir-2284t, bta-mir-2284d, bta-mir-2284n, bta-mir-2284g, bta-mir-2339, bta-mir-2284p, bta-mir-2284u, bta-mir-2284f, bta-mir-2284a, bta-mir-2284k, bta-mir-2284c, bta-mir-2284v, bta-mir-2284q, bta-mir-2284m, bta-mir-2284b, bta-mir-2284r, bta-mir-2284h, bta-mir-2284o, bta-mir-664a, bta-mir-2284e, bta-mir-1388, bta-mir-194-1, bta-mir-193a-2, bta-mir-2284w, bta-mir-2284x, bta-mir-148c, hsa-mir-374c, hsa-mir-219b, hsa-mir-499b, hsa-mir-664b, bta-mir-2284y-1, bta-mir-2284y-2, bta-mir-2284y-3, bta-mir-2284y-4, bta-mir-2284y-5, bta-mir-2284y-6, bta-mir-2284y-7, bta-mir-2284z-1, bta-mir-2284aa-1, bta-mir-2284z-3, bta-mir-2284aa-2, bta-mir-2284aa-3, bta-mir-2284z-4, bta-mir-2284z-5, bta-mir-2284z-6, bta-mir-2284z-7, bta-mir-2284aa-4, bta-mir-2284z-2, hsa-mir-486-2, hsa-mir-6516, bta-mir-2284ab, bta-mir-664b, bta-mir-6516, bta-mir-219-2, bta-mir-2284ac, bta-mir-219b, bta-mir-148d
54376002:- bta-miR-374b′-5pbta-mir-374b′bta-miR-374-3p1.460ugauaauacaaccugauaagug220cuuagcagguuguauuauaucc22X:82023929.. [score:1]
[1 to 20 of 1 sentences]