Cel-lin-4 is a specific type of RNA found at high levels in young adult hermaphrodites [PMC3282659]. Its levels can be affected by adult age [PMC3282659]. In a study, 1 fmole of two Mimic RNA Spike-in, including cel-lin-4, was added to serum samples to normalize the differences in RNA isolation efficiency [PMC7801652]. To isolate RNA from the serum, 300 μL of serum was homogenized in 900 μL of Trizol LS with the addition of 6 μL of cel-lin-4 [PMC4951333]. Cel-lin-4 was also used as a negative control in experiments as it shows no expression in human tissue [PMC2383925]. The expression levels of miRNA-29c were normalized to that of cel-lin-4 using a specific equation [PMC3696003]. Negative controls including ath-mir159a, cel-miR-2, and cel-miR-124 were used to ensure specificity [PMC1874652]. In another study, recombinant cel-lin-4 was added to samples and no significant differences were found among different groups, thus another control (cel-miR39) was used for normalization purposes [PMC4648542]. The expression levels of miRNAs were calculated using the ΔΔCt method [PMC5641166].
--a --- g -uU U C A u - u ugcuu ccg ccug CCC GAGA CUCA GUGUGAg gua c a ||||| ||| |||| ||| |||| |||| ||||||| ||| | acgag ggc ggaC GGG CUCU GGGU CACAcuu cgu g u uag uuu a CAU C C C - a u
Accession | MIMAT0000002 |
Description | Caenorhabditis elegans cel-lin-4-5p mature miRNA |
Sequence | 16 - UCCCUGAGACCUCAAGUGUGA - 36 |
Evidence |
experimental
cloned [1,3-4], 454 [5], Illumina [6], CLIPseq [7] |
Database links |
![]() |
Predicted targets |
![]() |
Accession | MIMAT0015092 |
Description | Caenorhabditis elegans cel-lin-4-3p mature miRNA |
Sequence | 55 - ACACCUGGGCUCUCCGGGUACC - 76 |
Evidence |
experimental
CLIPseq [7] |
Database links |
![]() |