miRBase entry: hsa-mir-107

Stem-loop hsa-mir-107


Accession
MI0000114
Symbol
HGNC: MIR107
Description
Homo sapiens hsa-mir-107 precursor miRNA mir-103
Gene
family?
RF00129; mir-103

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR107, a type of microRNA, has been studied in relation to sepsis and Alzheimer's disease [PMC7310770]. Decreased expressions of MIR107 have been found to have good predictive values for increased 28-day mortality risk in sepsis patients [PMC7310770]. This suggests that MIR107 may be a potential early biomarker for sepsis [PMC7310770]. Additionally, the decreased expression of MIR107 has also been associated with the onset of Alzheimer's disease [PMC4870937]. The study found that peripheral MIR107 and BACE1 mRNA may be important in the development of Alzheimer's disease, indicating that MIR107 could be a candidate biomarker for early detection of the disease [PMC4870937]. These findings highlight the potential significance of MIR107 in both sepsis and Alzheimer's disease research, suggesting its potential as a diagnostic tool and therapeutic target [PMC7310770][PMC4870937[PMC4870937].

Literature search
185 open access papers mention hsa-mir-107
(941 sentences)

Sequence

4415819 reads, 14654 reads per million, 155 experiments
cucucugcuuucagcuucuuuacaguguugccuuguggcauggaguucaAGCAGCAUUGUACAGGGCUAUCAaagcacaga
.(((.((((((.((((.((.(((((((((((.(((.(((.....))))))))))))))))).))))))...)))))).)))

Structure
c   c      --c    u  u           c   u   a 
 ucu ugcuuu   agcu cu uacaguguugc uug ggc u
 ||| ||||||   |||| || ||||||||||| ||| ||| g
 aga acgaaA   UCGG GA AUGUUACGACG Aac uug g
-   c      CUA    -  C           -   -   a 


Annotation confidence High
Do you think this miRNA is real?
Comments
This miRNA was identified by homology to miR-103 [1], and later verified by cloning in human [2].

Genome context
chr10: 89592747-89592827 [-]

Disease association
hsa-mir-107 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-107

Accession MIMAT0000104
Description Homo sapiens hsa-miR-107 mature miRNA
Sequence 50 - AGCAGCAUUGUACAGGGCUAUCA - 72
Evidence experimental
cloned [2]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 11914277
    miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs
    "Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G"
    "Genes Dev (2002) 16:720-728