MIR181B1 is a member of the miR181ab1 cluster, which is a key regulator of KRAS-driven carcinogenesis in lung cancer (LC) and pancreatic ductal adenocarcinoma (PDAC) [PMC8430834]. It has been found that certain miRNAs, including MIR181B1, are induced or suppressed upon differentiation [PMC4168020]. MIR181B1 has been implicated in the onset of manic symptoms in bipolar disorder (BD) and has been found to be downregulated in schizophrenia patients with antipsychotic medication [PMC6504680]. On the other hand, MIR181B1 is upregulated in the manic state and shows higher expression in treatment-resistant schizophrenia patients [PMC6504680]. In addition, MIR181B1 has been identified as a gene marker of BD manic episodes [PMC9554663]. Studies have shown that MIR181B1 is necessary for proficient induction of tumorigenesis by mutant KRAS and regulates cell cycle progression [PMC7108928]. It has also been found that combined overexpression of miR181a1 and MIR181B1 enhances tumor growth and cell proliferation rate compared to single overexpression or knockout models [PMC7108928]. Furthermore, miR181a1 and MIR181B1 have non-redundant functions but may be needed together to generate a threshold level of miR181 RNA required for the full oncogenic phenotype [PMC7108928].
ccugugcagagauuauuuuuuaaaa aucAA CUG gaac g ggucaca CAUUCAUUG UCGGUGGGUu ugu u ||||||| ||||||||| |||||||||| ||| ccggugu GUAAGUAAC AGUCACUCga aca g -------------------uucgcc -cAAC --A ---- g
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0000257 |
Description | Homo sapiens hsa-miR-181b-5p mature miRNA |
Sequence | 36 - AACAUUCAUUGCUGUCGGUGGGU - 58 |
Evidence |
experimental
cloned [3-5] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
Accession | MIMAT0022692 |
Description | Homo sapiens hsa-miR-181b-3p mature miRNA |
Sequence | 76 - CUCACUGAACAAUGAAUGCAA - 96 |
Evidence | not_experimental |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|