miRBase entry: hsa-mir-27b

Stem-loop hsa-mir-27b


Accession
MI0000440
Symbol
HGNC: MIR27B
Description
Homo sapiens hsa-mir-27b precursor miRNA mir-27
Gene
family?
RF00644; mir-27

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR27B is a microRNA that has been implicated in various biological processes and diseases [PMC5933288]. It has been found to play a role in thymic involution, with Wnt4 acting as a key inhibitor [PMC5933288]. In breast cancer, the reduction of MIR27B induced by CCL18 promotes invasion and migration of cancer cells [PMC4653020]. In patients with temporal lobe epilepsy (TLE), several miRNA families and clusters, including MIR27B, were found to be differentially methylated compared to controls [PMC9700089]. Additionally, MIR27B, along with miR-101 and miR-128, has been shown to downregulate VEGFC expression and suppress tumor growth, metastasis, invasion, migration, and angiogenesis in gastric cancer, bladder cancer, and hepatocellular carcinoma [PMC7780026]. Furthermore, it is suggested that MIR27B could directly regulate HIV-1 transcription [PMC3697138].

Literature search
301 open access papers mention hsa-mir-27b
(1259 sentences)

Sequence

882609 reads, 4618 reads per million, 159 experiments
accucucuaacaaggugcAGAGCUUAGCUGAUUGGUGAACagugauugguuuccgcuuugUUCACAGUGGCUAAGUUCUGCaccugaagagaaggug
((((((((....(((((((((((((((((.((((.(((((((....(((...)))..))))))))))))))))))))))))))))..)))).)))).

Structure
-    -    aaca                 G    G       ugau   u 
 accu cucu    aggugcAGAGCUUAGCU AUUG UGAACag    ugg  
 |||| ||||    ||||||||||||||||| |||| |||||||    ||| u
 ugga gaga    uccaCGUCUUGAAUCGG UGAC ACUUguu    gcc  
g    a    --ag                 -    -       --uc   u 


Annotation confidence High
Do you think this miRNA is real?
Comments
Lagos-Quintana et al. determined the expression of miR-27b in mouse [1] - a human sequence was predicted based on homology. Michael et al. subsequently verified the expression of this miRNA in human cells [2].

Genome context
chr9: 95085445-95085541 [+]
Clustered miRNAs
3 other miRNAs are < 10 kb from hsa-mir-27b
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-27b is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-27b-5p

Accession MIMAT0004588
Description Homo sapiens hsa-miR-27b-5p mature miRNA
Sequence 19 - AGAGCUUAGCUGAUUGGUGAAC - 40
Evidence experimental
cloned [4-5]
Database links
Predicted targets

Mature hsa-miR-27b-3p

Accession MIMAT0000419
Description Homo sapiens hsa-miR-27b-3p mature miRNA
Sequence 61 - UUCACAGUGGCUAAGUUCUGC - 81
Evidence experimental
cloned [2-5]
Database links
Predicted targets

References

  1. PubMed ID: 12554860
    Numerous microRNPs in neuronal cells containing novel microRNAs
    "Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G"
    "RNA (2003) 9:180-186

  2. PubMed ID: 14573789
    Reduced accumulation of specific microRNAs in colorectal neoplasia
    "Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ"
    "Mol Cancer Res (2003) 1:882-891

  3. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  4. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  5. PubMed ID: 12007417
    Identification of tissue-specific microRNAs from mouse
    "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
    "Curr Biol (2002) 12:735-739