Stem-loop hsa-mir-125b-2

Accession

MI0000470

Symbol

HGNC: MIR125B2

Description

Homo sapiens hsa-mir-125b-2 precursor miRNA

Summary

Caution, this is an AI generated summary based on literature. This may have errors.

MIR125B2 is a gene that was identified through the analysis of SNP sites in the genomic DNAs of offspring [PMC10014956]. This gene, along with other genes such as COL11A1, COL12A1, CATSPER2, KCNJ12, GP6 (ENSG00000088053), MIR99A (ENSG00000207638), MIR99AHG (ENSG00000215386), MIRLET7C (ENSG00000199030), and LINC01250, was selected based on its potential pathogenicity for ACL rupture and its shared regions in affected family members [PMC9536556]. These genes were also chosen because they have been previously associated with ACL rupture and have shared biology/function [PMC9536556]. The identification of SNP sites in the offspring's genomic DNAs allowed for the determination of the imprinting status of MIR125B2 [PMC10014956]. The selection of these specific genes was based on their potential role in ACL rupture and their shared characteristics with previously identified associated genes [PMC9536556]. This approach allowed for a comprehensive analysis that considered both genetic factors and shared biology/function in order to identify potential pathogenic genes related to ACL rupture.

Literature search

687 open access papers mention hsa-mir-125b-2
(4255 sentences)

Sequence

811478 reads, 5102 reads per million, 154 experiments

accagacuuuuccuagUCCCUGAGACCCUAACUUGUGAgguauuuuaguaacaUCACAAGUCAGGCUCUUGGGACcuaggcggagggga
.((...((((.(((((((((.((((.(((.((((((((.((.........)).)))))))).))).)))))))).))))).)))).)).

Structure

a  aga    u     -    U    C   A        g  auu 
 cc   cuuu ccuag UCCC GAGA CCU ACUUGUGA gu   u
 ||   |||| ||||| |||| |||| ||| |||||||| ||   u
 gg   gagg ggauc AGGG UUCU GGA UGAACACU ca   a
a  --g    c     C    -    C   C        a  aug 

Annotation confidence High

Comments

This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1]. Its expression was later verified in human BC-1 cells [2].

Genome context

chr21: 16590237-16590325 [+]

Disease association

hsa-mir-125b-2 is associated with one or more human diseases in the Human microRNA Disease Database

Mature hsa-miR-125b-5p

• Accession: MIMAT0000423
• Description: Homo sapiens hsa-miR-125b-5p mature miRNA
• Sequence: 17 - UCCCUGAGACCCUAACUUGUGA - 38
• Evidence: experimental ; cloned [2,4-6], Illumina [7]

Mature hsa-miR-125b-2-3p

• Accession: MIMAT0004603
• Description: Homo sapiens hsa-miR-125b-2-3p mature miRNA
• Sequence: 54 - UCACAAGUCAGGCUCUUGGGAC - 75
• Evidence: experimental ; cloned [5]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 17616659
   Patterns of known and novel small RNAs in human cervical cancer
   "Lui WO, Pourmand N, Patterson BK, Fire A"
   "Cancer Res (2007) 67:6031-6043


3. PubMed ID: 20158877
   Analysis of deep sequencing microRNA expression profile from human embryonic stem cells derived mesenchymal stem cells reveals possible role of let-7 microRNA family in downstream targeting of hepatic nuclear factor 4 alpha
   Koh W, Sheng CT, Tan B, Lee QY, Kuznetsov V, Kiang LS, Tanavde V
   BMC Genomics (2010) 11:S6


4. PubMed ID: 15978578
   Identification of human fetal liver miRNAs by a novel method
   "Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X"
   "FEBS Lett (2005) 579:3849-3854


5. PubMed ID: 12007417
   Identification of tissue-specific microRNAs from mouse
   "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
   "Curr Biol (2002) 12:735-739


6. PubMed ID: 15800047
   Kaposi's sarcoma-associated herpesvirus expresses an array of viral microRNAs in latently infected cells
   "Cai X, Lu S, Zhang Z, Gonzalez CM, Damania B, Cullen BR"
   "Proc Natl Acad Sci U S A (2005) 102:5570-5575


7. PubMed ID: 15722555
   Depletion of human micro-RNA miR-125b reveals that it is critical for the proliferation of differentiated cells but not for the down-regulation of putative targets during differentiation
   "Lee YS, Kim HK, Chung S, Kim KS, Dutta A"
   "J Biol Chem (2005) 280:16635-16641